| Literature DB >> 33066701 |
Shona C Moore1, Rebekah Penrice-Randal1, Muhannad Alruwaili1, Nadine Randle1, Stuart Armstrong1, Catherine Hartley1, Sam Haldenby1, Xiaofeng Dong1, Abdulrahman Alrezaihi1, Mai Almsaud1, Eleanor Bentley1, Jordan Clark1, Isabel García-Dorival1, Paul Gilmore1, Ximeng Han1, Benjamin Jones1, Lisa Luu1, Parul Sharma1, Ghada Shawli1, Yani Sun1,2, Qin Zhao1,2, Steven T Pullan3, Daniel P Carter3, Kevin Bewley3, Jake Dunning3,4, En-Min Zhou2, Tom Solomon1,4,5, Michael Beadsworth6, James Cruise6, Derrick W Crook7, David A Matthews8, Andrew D Davidson8, Zana Mahmood1,9, Waleed Aljabr1,10, Julian Druce11, Richard Vipond3,4, Lisa Ng1,4,5,12, Laurent Renia12, Peter J M Openshaw13, J Kenneth Baillie14, Miles W Carroll3,4,7, James Stewart1,5, Alistair Darby1,5, Malcolm Semple1,4,5, Lance Turtle1,4,5, Julian A Hiscox1,4,5,12.
Abstract
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is the causative agent of coronavirus disease 2019 (COVID-19). Sequencing the viral genome as the outbreak progresses is important, particularly in the identification of emerging isolates with different pathogenic potential and to identify whether nucleotide changes in the genome will impair clinical diagnostic tools such as real-time PCR assays. Although single nucleotide polymorphisms and point mutations occur during the replication of coronaviruses, one of the biggest drivers in genetic change is recombination. This can manifest itself in insertions and/or deletions in the viral genome. Therefore, sequencing strategies that underpin molecular epidemiology and inform virus biology in patients should take these factors into account. A long amplicon/read length-based RT-PCR sequencing approach focused on the Oxford Nanopore MinION/GridION platforms was developed to identify and sequence the SARS-CoV-2 genome in samples from patients with or suspected of COVID-19. The protocol, termed Rapid Sequencing Long Amplicons (RSLAs) used random primers to generate cDNA from RNA purified from a sample from a patient, followed by single or multiplex PCRs to generate longer amplicons of the viral genome. The base protocol was used to identify SARS-CoV-2 in a variety of clinical samples and proved sensitive in identifying viral RNA in samples from patients that had been declared negative using other nucleic acid-based assays (false negative). Sequencing the amplicons revealed that a number of patients had a proportion of viral genomes with deletions.Entities:
Keywords: MinION; SARS-CoV-2; amplicon; next-generation sequencing
Mesh:
Substances:
Year: 2020 PMID: 33066701 PMCID: PMC7602519 DOI: 10.3390/v12101164
Source DB: PubMed Journal: Viruses ISSN: 1999-4915 Impact factor: 5.048
Primer pairs by sequence order.
| Primer Name | Sequence 5′–3′ | Location | Size (bp) | Multiplex Pool | |
|---|---|---|---|---|---|
| Start | End | ||||
| SARS-CoV-2_1_F | GTGTGACCGAAAGGTAAGATGG | 248 | 269 | 956 | 1 |
| SARS-CoV-2_1_R | TTGCATTCATTTGGTGACGC | 1203 | 1184 | ||
| SARS-CoV-2_2_F | GGTGTATACTGCTGCCGTGA | 944 | 963 | 1213 | 2 |
| SARS-CoV-2_2_R | GCCAATCAAGGACGGGTTTG | 2156 | 2137 | ||
| SARS-CoV-2_3_F | CCGCACTCTTGAAACTGCTC | 1912 | 1931 | 1254 | 3 |
| SARS-CoV-2_3_R | GCAGAAGTGGCACCAAATTC | 3165 | 3146 | ||
| SARS-CoV-2_4_F | ACACCACTGGGCATTGATTTAG | 2936 | 2957 | 1264 | 4 |
| SARS-CoV-2_4_R | TTTCAGTAGTGCCACCAGCC | 4199 | 4180 | ||
| SARS-CoV-2_5_F | CTTCATCCAGATTCTGCCAC | 4052 | 4071 | 1296 | 5 |
| SARS-CoV-2_5_R | AGCAGGTGGATTAAACTTCAACTC | 5347 | 5324 | ||
| SARS-CoV-2_6_F | CAACATTAACCTCCACACGC | 4990 | 5009 | 1189 | 6 |
| SARS-CoV-2_6_R | ATCAATAGCCACCACATCACC | 6178 | 6158 | ||
| SARS-CoV-2_7_F | AGAAACCTGCTTCAAGAGAGC | 6108 | 6128 | 1373 | 1 |
| SARS-CoV-2_7_R | ATTACAACCGTCTACAACATGCAC | 7480 | 7457 | ||
| SARS-CoV-2_8_F | GTCACTATTGCAACCTACTGTAC | 7091 | 7113 | 1093 | 2 |
| SARS-CoV-2_8_R | CTTGCCGAGCTGCTGAAATA | 8183 | 8164 | ||
| SARS-CoV-2_9_F | AATCAGCGTCTGTTTACTACAGTC | 7929 | 7952 | 1192 | 3 |
| SARS-CoV-2_9_R | GTGTCAGGGCGTAAACTTTC | 9120 | 9101 | ||
| SARS-CoV-2_10_F | TTGTCGTGCCTGGTTTGC | 8856 | 8873 | 1303 | 4 |
| SARS-CoV-2_10_R | ACGTCATCAAGCCAAAGACC | 10158 | 10139 | ||
| SARS-CoV-2_11_F | AGTGGAGCAATGGATACAAC | 9917 | 9936 | 1239 | 5 |
| SARS-CoV-2_11_R | AGCTACAGTGGCAAGAGAAG | 11209 | 11190 | ||
| SARS-CoV-2_12_F | AGGGTACACACCACTGGTTG | 10995 | 11014 | 1185 | 6 |
| SARS-CoV-2_12_R | CACCATTAGCAACAGCCTGC | 12179 | 12160 | ||
| SARS-CoV-2_13_F | GTGAAGAAATGCTGGACAACAG | 12057 | 12078 | 1180 | 1 |
| SARS-CoV-2_13_R | GCACCACCAAAGGATTCTTG | 13236 | 13217 | ||
| SARS-CoV-2_14_F | TAGTTTAGCTGCCACAGTACG | 12997 | 13017 | 1200 | 2 |
| SARS-CoV-2_14_R | AGTTAAAGCCCTGGTCAAGG | 14196 | 14177 | ||
| SARS-CoV-2_15_F | ATACGCCAACTTAGGTGAACG | 13962 | 13982 | 1284 | 3 |
| SARS-CoV-2_15_R | AACATGTTGTGCCAACCACC | 15245 | 15226 | ||
| SARS-CoV-2_16_F | TGAGTTATGAGGATCAAGATGCAC | 14996 | 15019 | 1243 | 4 |
| SARS-CoV-2_16_R | GCCTGTAAGACTGTATGCGG | 16238 | 16219 | ||
| SARS-CoV-2_17_F | CCCAGATCCATCAAGAATCCTAG | 15933 | 15955 | 1214 | 5 |
| SARS-CoV-2_17_R | TGCGAGCAGAAGGGTAGTAG | 17146 | 17127 | ||
| SARS-CoV-2_18_F | AAGGTGACTATGGTGATGCTG | 16841 | 16861 | 1336 | 6 |
| SARS-CoV-2_18_R | GGTATGCCAGGTATGTCAACAC | 18176 | 18155 | ||
| SARS-CoV-2_19_F | ACTCAAACCACTGAAACAGCTC | 17875 | 17896 | 1239 | 1 |
| SARS-CoV-2_19_R | GTCACTACAAGGCTGTGCATC | 19113 | 19093 | ||
| SARS-CoV-2_20_F | AGCTAGTTGTGATGCAATCATGAC | 18846 | 18869 | 1235 | 2 |
| SARS-CoV-2_20_R | CTTGTTTGGGACCTACAGATGG | 20098 | 20077 | ||
| SARS-CoV-2_21_F | TTTGGGTGTGGACATTGCTG | 19842 | 19861 | 1323 | 3 |
| SARS-CoV-2_21_R | ATAGCCACGGAACCTCCAAG | 21164 | 21145 | ||
| SARS-CoV-2_22_F | TAAGACAGTGGTTGCCTACG | 20912 | 20931 | 1125 | 4 |
| SARS-CoV-2_22_R | TCTGAACTCACTTTCCATCCAAC | 22036 | 22014 | ||
| SARS-CoV-2_23_F | TTCGAAGACCCAGTCCCTAC | 21895 | 21914 | 1405 | 5 |
| SARS-CoV-2_23_R | TGGATCACGGACAGCATCAG | 23299 | 23280 | ||
| SARS-CoV-2_24_F | TTGAACTTCTACATGCACCAGC | 23106 | 23127 | 1111 | 6 |
| SARS-CoV-2_24_R | CCAGAAGTGATTGTACCCGC | 24216 | 24197 | ||
| SARS-CoV-2_25_F | TTGCTGCTAGAGACCTCATTTG | 24093 | 24114 | 1190 | 1 |
| SARS-CoV-2_25_R | GCAACTGGTCATACAGCAAAG | 25282 | 25262 | ||
| SARS-CoV-2_26_F | GGTGACATCTCTGGCATTAATGC | 25061 | 25083 | 1163 | 2 |
| SARS-CoV-2_26_R | TGCTTACAAAGGCACGCTAG | 26223 | 26204 | ||
| SARS-CoV-2_27_F | ACCAGCTGTACTCAACTCAATTG | 26027 | 26049 | 1137 | 3 |
| SARS-CoV-2_27_R | CTGCTACTGGAATGGTCTGTG | 27163 | 27143 | ||
| SARS-CoV-2_28_F | TGACCAGACCGCTTCTAGAAAG | 26908 | 26929 | 1180 | 4 |
| SARS-CoV-2_28_R | GCCTCATCCACGCACAATTC | 28087 | 28068 | ||
| SARS-CoV-2_29_F | TGTCACGCCTAAACGAACATG | 27876 | 27896 | 1147 | 5 |
| SARS-CoV-2_29_R | GATTTCTTAGTGACAGTTTGGCC | 29022 | 29000 | ||
| SARS-CoV-2_30_F | CGAATTCGTGGTGGTGACG | 28550 | 28568 | 1173 | 6 |
| SARS-CoV-2_30_R | GGTGGCTCTTTCAAGTCCTC | 29722 | 29703 | ||
Figure 1(A) Schematic diagram of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) genome showing the position of major open reading frames and the position of the amplicons along the genome. (B) Agarose gel electrophoresis analysis of the amplicon products resulting from RT-PCR using the designated forward and reverse primers to amplify the SARS-CoV-2 genome from RNA purified from Vero cells infected with the virus. (C) The amplicon products were purified and sequenced on a single flow cell using an Oxford Nanopore MinION. Shown are the number of reads that map (y-axis) to each amplicon across the SARS-CoV-2 genome from 5′ to 3′ (x-axis).
Figure 2(A) Agarose gel electrophoresis analysis of amplicons generated by RT-PCR from RNA isolated from a nasopharyngeal swab taken from patient REMRQ0001, who had coronavirus disease 2019 (COVID-19), and diagnosed positive for SARS-CoV-2 by a laboratory-based test. Primer pairs are indicated above each amplicon. (B) The amplicon products were purified and sequenced on a single flow cell using an Oxford Nanopore MinION. Shown are the number of reads that map (y-axis) to each amplicon across the SARS-CoV-2 genome from 5′ to 3′ (x-axis). (C) Agarose gel electrophoresis analysis of amplicons generated by RT-PCR from RNA isolated from a nasopharyngeal swab taken from patient REMRQ0001, who had COVID-19, and subsequently found negative for SARS-CoV-2 by a laboratory-based test. Note that the brightness of the image has been adjusted post-image capture to more clearly show amplicon products.
Figure 3(A,B) Agarose gel electrophoresis analysis of amplicons generated by RT-PCR from RNA isolated from a nasopharyngeal swab taken from patient REMRQ0002, who had COVID-19, and diagnosed positive for SARS-CoV-2 by a laboratory-based test. Primer pairs are indicated above each amplicon. Note that the image in (B) is the same image as (A) but the brightness has been enhanced post-image capture in order to more clearly show amplicon products. (C) The amplicon products were purified and sequenced on a single flow cell using an Oxford Nanopore MinION. Shown are the number of reads that map (y-axis) to each amplicon across the SARS-CoV-2 genome from 5′ to 3′ (x-axis).
Figure 4(A) Agarose gel electrophoresis analysis of amplicons generated by multiplex RT-PCR from RNA isolated from a nasopharyngeal swab taken from patients who had COVID-19 and diagnosed positive for SARS-CoV-2 by a laboratory-based test. Primer pairs are indicated above each amplicon and exemplar data from two patients (numbers 36 and 37) are shown. Note that amplicons from multiplex pool 1, for patient 36, is shown to the left as these were run on a separate gel. Also shown are negative controls and a positive control using RNA isolated from SARS-CoV-2 infected cells. (B,C) The amplicon products were purified, barcoded and sequenced on a single flow cell using an Oxford Nanopore MinION. Shown are the number of reads that map (y-axis) to each amplicon across the SARS-CoV-2 genome from 5′ to 3′ (x-axis).
Analysis of deletions in the SARS-CoV-2 genome in patients with COVID-19. The columns from left to right are as follows: sample barcode, deletion start position (bp), deletion end position (bp), number of reads supporting this deletion, quality score (similar to number of reads supporting, but also takes into account read mapping quality scores with a score greater than 10 having higher confidence), standard deviation (SD) of deletion span (bp) from supporting reads, SD of deletion position (bp) from supporting reads. If the deletion interrupts a gene, these are the coordinates of the gene, the gene name, and the bp overlap with the deletion. In cases where the deletion overlaps >1 gene, the information of the second gene is provided.
| Deletion Information | Affected Gene Information | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Patient Number | Start (bp) | End (bp) | Supporting Reads | Quality Score | SD Span | SD Pos | Gene Start | Gene End | Gene Name | Overlap (bp) | Gene2 Start | Gene2 End | Gene2 Name | Overlap2 (bp) |
| 22 | 19325 | 19380 | 9 | 10 | 4.42 | 58.42 | 266 | 21555 |
| 55 | − | − | − | − |
| 22 | 20294 | 20429 | 8 | 10 | 0 | 0 | 266 | 21555 |
| 135 | − | − | − | − |
| 22 | 25417 | 25796 | 10 | 12 | 0.79 | 0.86 | 25393 | 26220 |
| 379 | − | − | − | − |
| 22 | 27578 | 27624 | 16 | 19 | 2.49 | 2.45 | 27394 | 27759 |
| 46 | − | − | − | − |
| 22 | 28756 | 28884 | 7 | 8 | 2.27 | 3.4 | 28274 | 29533 |
| 128 | − | − | − | − |
| 23 | 2143 | 2198 | 5 | 5 | 4.36 | 73.69 | 266 | 21555 |
| 55 | − | − | − | − |
| 23 | 2375 | 2421 | 8 | 8 | 5.54 | 82.85 | 266 | 21555 |
| 46 | − | − | − | − |
| 23 | 2589 | 2642 | 6 | 6 | 3.2 | 41.78 | 266 | 21555 |
| 53 | − | − | − | − |
| 23 | 2654 | 2741 | 5 | 5 | 8.73 | 51.88 | 266 | 21555 |
| 87 | − | − | − | − |
| 23 | 2859 | 2904 | 9 | 10 | 2.42 | 88.48 | 266 | 21555 |
| 45 | − | − | − | − |
| 25 | 20274 | 20383 | 7 | 8 | 6.2 | 7.5 | 266 | 21555 |
| 109 | − | − | − | − |
| 25 | 20279 | 20340 | 10 | 12 | 3.83 | 2.57 | 266 | 21555 |
| 61 | − | − | − | − |
| 25 | 27594 | 27640 | 10 | 11 | 2.37 | 31.77 | 27394 | 27759 |
| 46 | − | − | − | − |
| 26 | 27386 | 27699 | 91 | 99 | 0.86 | 1.66 | 27394 | 27759 |
| 305 | 27202 | 27387 |
| 1 |
| 26 | 20274 | 20338 | 9 | 11 | 1.5 | 1.02 | 266 | 21555 |
| 64 | − | − | − | − |
| 27 | 27020 | 27073 | 11 | 13 | 0.6 | 0.3 | 26523 | 27191 |
| 53 | − | − | − | − |
| 27 | 27522 | 27761 | 24 | 29 | 1.09 | 2.04 | 27394 | 27759 |
| 237 | − | − | − | − |
| 27 | 27689 | 27763 | 23 | 27 | 3.58 | 29.9 | 27394 | 27759 |
| 70 | ||||
| 28 | 2025 | 2088 | 5 | 5 | 7.16 | 80.94 | 266 | 21555 |
| 63 | ||||
| 28 | 25508 | 25568 | 6 | 6 | 8.31 | 61.45 | 25393 | 26220 |
| 60 | ||||
| 28 | 27884 | 27934 | 6 | 6 | 7.19 | 27.43 | 27894 | 28259 |
| 40 | ||||
| 29 | 27546 | 27650 | 7 | 8 | 14.61 | 64.8 | 27394 | 27759 |
| 104 | ||||
| 29 | 28454 | 28731 | 6 | 7 | 26.89 | 58.79 | 28274 | 29533 |
| 277 | ||||
| 30 | 25398 | 25776 | 12 | 14 | 1.56 | 69.87 | 25393 | 26220 |
| 378 | ||||
| 30 | 27555 | 27625 | 31 | 38 | 1.94 | 5.71 | 27394 | 27759 |
| 70 | ||||
| 30 | 8676 | 8723 | 11 | 12 | 1.79 | 38.61 | 266 | 21555 |
| 47 | ||||
| 31 | 28444 | 28775 | 62 | 77 | 1.29 | 1.31 | 28274 | 29533 |
| 331 | ||||
| 32 | 25480 | 25551 | 97 | 99 | 1.62 | 2.04 | 25393 | 26220 |
| 71 | ||||
| 36 | 20274 | 20339 | 11 | 13 | 1.43 | 0.87 | 266 | 21555 |
| 65 | ||||
| 37 | 25429 | 25641 | 11 | 13 | 17 | 7.89 | 25393 | 26220 |
| 212 | ||||
| 37 | 25432 | 25808 | 10 | 12 | 5.24 | 44.62 | 25393 | 26220 |
| 376 | ||||
| 37 | 28444 | 28776 | 8 | 9 | 0.71 | 0.65 | 28274 | 29533 |
| 332 | ||||
| 43 | 27426 | 27559 | 5 | 5 | 19.77 | 50.25 | 27394 | 27759 |
| 133 | ||||
| 43 | 27690 | 27732 | 6 | 6 | 2.25 | 49.85 | 27394 | 27759 |
| 42 | ||||
| 43 | 28011 | 28062 | 13 | 14 | 5.36 | 77.82 | 27894 | 28259 |
| 51 | ||||
| 43 | 28196 | 28238 | 5 | 5 | 2 | 96.73 | 27894 | 28259 |
| 42 | ||||
| 43 | 28481 | 28536 | 5 | 5 | 3 | 64.73 | 28274 | 29533 |
| 55 | ||||
| 28601 | 28718 | 5 | 5 | 4.82 | 43.76 | 28274 | 29533 |
| 117 | |||||