Literature DB >> 33031421

Emergence of highly pathogenic H5N2 and H7N1 influenza A viruses from low pathogenic precursors by serial passage in ovo.

Agnes Tinuke Laleye1,2, Celia Abolnik2.   

Abstract

Highly pathogenic (HPAI) strains emerge from their low pathogenic (LPAI) precursors and cause severe disease in poultry with enormous economic losses, and zoonotic potential. Understanding the mechanisms involved in HPAI emergence is thus an important goal for risk assessments. In this study ostrich-origin H5N2 and H7N1 LPAI progenitor viruses were serially passaged seventeen times in 14-day old embryonated chicken eggs and Ion Torrent ultra-deep sequencing was used to monitor the incremental changes in the consensus genome sequences. Both virus strains increased in virulence with successive passages, but the H7N1 virus attained a virulent phenotype sooner. Mutations V63M, E228V and D272G in the HA protein, Q357K in the nucleoprotein (NP) and H155P in the neuraminidase protein correlated with the increased pathogenicity of the H5N2 virus; whereas R584H and L589I substitutions in the polymerase B2 protein, A146T and Q220E in HA plus D231N in the matrix 1 protein correlated with increased pathogenicity of the H7N1 virus in embryos. Enzymatic cleavage of HA protein is the critical virulence determinant, and HA cleavage site motifs containing multibasic amino acids were detected at the sub-consensus level. The motifs PQERRR/GLF and PQRERR/GLF were first detected in passages 11 and 15 respectively of the H5N2 virus, and in the H7N1 virus the motifs PELPKGKK/GLF and PELPKRR/GLF were detected as early as passage 7. Most significantly, a 13 nucleotide insert of unknown origin was identified at passage 6 of the H5N2 virus, and at passage 17 a 42 nucleotide insert derived from the influenza NP gene was identified. This is the first report of non-homologous recombination at the HA cleavage site in an H5 subtype virus. This study provides insights into how HPAI viruses emerge from low pathogenic precursors and demonstrated the pathogenic potential of H5N2 and H7N1 strains that have not yet been implicated in HPAI outbreaks.

Entities:  

Mesh：

Year:  2020        PMID： 33031421      PMCID： PMC7544131          DOI： 10.1371/journal.pone.0240290

Source DB:  PubMed          Journal:  PLoS One        ISSN： 1932-6203            Impact factor:   3.240


Introduction

Wild aquatic birds are the natural reservoirs of all avian influenza virus (IAV) subtypes that are designated by the combination of hemagglutinin (HA; H1-H16) and neuraminidase (NA; N1-N9) glycoprotein antigens on the virion [1]. IAVs are further distinguished by their pathogenicity in chickens; most strains are low pathogenic (LPAI) and cause sub-clinical or mild infections, but some LPAI viruses of the H5Nx or H7Nx subtypes (where x denotes any of the nine N subtypes) can mutate to a highly pathogenic form (HPAI) that causes severe disease in poultry, with enormous economic losses and zoonotic potential [2]. The pathogenicity of HPAI viruses is a multigenic trait, but the HA protein plays the major role. HA mediates the attachment of the virus to cellular receptors and viral penetration of the host cell through fusion of the viral envelope with cellular membranes [3, 4]. To facilitate this, the precursor HA protein, HA0, must be proteolytically cleaved into the disulphide linked HA1 and HA2 polypeptides to expose the membrane fusion peptide [5]. However, whether or not proteolytic activation occurs depends on the amino acid motif at the HA1-HA2 cleavage site (HACS) and the presence of an appropriate host endoprotease. Typical LPAI viruses contain the HA0 motifs PQRETR/GLF for H5 or PELPKGK/GLF for H7, i.e. single or non-consecutive basic amino acids (R or K) adjacent to the cleavage site, which are recognised by trypsin-like enzymes that are only expressed in epithelial cells. Thus, the activation and spread of LPAI viruses is confined to the epithelial linings of the respiratory and gastrointestinal tracts. HPAI viruses contain two or more consecutive basic amino acids preceding the cleavage site that are cleavable by subtilisin-like enzymes (e.g. furin) found in a wider range of cell types. Consequently, HPAI viruses replicate in and spread between multiple tissues producing a more severe disease [6, 7]. The conversion of LPAI to HPAI through amino acid modifications at the HACS only occurs in terrestrial poultry, seemingly after a period of circulation in high density populations over the course of a few weeks up to several months [2]. For H5Nx subtypes, the HACS mutation can occur by substitution of nonbasic with basic amino acids, but more frequently by the insertion of additional basic amino acids at the CS, likely through polymerase duplication or slippage events during RNA replication [8-10]. All H7Nx HPAI viruses have insertions of up to ten additional basic amino acids at the HACS, either through RNA polymerase slippage/ duplication events or alternatively by non-homologous recombination events with either viral or cellular RNA sequences [11-13]. Homologous recombination in the HACS has not been described in H5Nx viruses. The reasons for why only H5Nx and H7Nx viruses and not the other subtypes are prone to mutations at the HACS, and precise mechanism/s underlying this remain unresolved. Numerous laboratory studies have emulated the natural mutation of LPAI viruses to HPAI via passages in chickens of different ages and inoculation routes, cell cultures, embryonated chicken eggs and a combination of the aforementioned, with varying success [14]. Embryonated chicken eggs (ECEs) are used extensively in influenza research, routine diagnostic tests, and to propagate viruses for vaccines [15, 16]. Typically, IAVs are inoculated into the allantoic cavities of ECEs aged between 9 and 11 days, when the embryo is approximately halfway through gestation. LPAIVs replicate in the allantoic epithelium where trypsin-like proteases are present and viruses are released into the allantoic fluid, but when inoculated via the chorioallantoic membrane (CAM) route, LPAIV replication is restricted to the endoderm that is composed of allantoic epithelium. In contrast, replication of HPAIVs is unrestricted irrespective of the ECE inoculation route, occurring in multiple cell types including the embryo itself and the blood vessels [17, 18]. Notably, serial passage of LPAIVs in ECEs of 9-to-11 days of age does not lead to the mutation or selection of HPAI viruses in the sub-population, however fourteen-day-old embryos appear to exert a mutational and/or selective pressure enabling HPAIV emergence [19-23]. Perdue and coworkers (1990) first reported that LPAIVs and HPAIVs could be distinguished by their mean death times in older age embryos (12-13-day-old ECEs) but not younger aged embryos (8-9-day-old ECEs), and since then the pathogenic potential of HPAIVs generated by serial passage in 14-day old ECEs has been assessed by the subsequent intravenous inoculation of chickens and/or the ability to form plaques in cell cultures without trypsin [19-22] or ultra-deep sequencing [14]. The phenomenon of HPAI emergence via passage in 14-day-old ECEs is thought to be facilitated by several factors. The change in anatomy of the growing embryo after day 10 could impede the distribution of LPAIVs because of limited access to trypsin-like proteases [24]; additionally, the increased protease activity in the allantoic fluid of older embryos causes degradation of both LPAIVs and HPAIVs, but HPAIVs could have a selective advantage because they are able to replicate in other anatomical sites such as the embryo itself [19, 25, 26]. In view of the human health threat and economic devastation that HPAI is capable of, understanding how and under which conditions HPAI viruses emerge in poultry from their LPAI progenitors is an important goal for risk assessments. In ovo passage in 14-day-old ECEs is a more practical alternative to using live hatched chickens in terms of turnaround time and space required, therefore we conducted seventeen serial passages in 14-day ECEs of H5N2 and H7N1 LPAIV progenitors that were originally isolated from commercial ostriches in order to gain a better understanding of the emergence of HPAIVs. Two LPAI strains, A/ostrich/South Africa/ORD/2012 (H7N1) and A/ostrich/South Africa/325863/2015 (H5N2) were isolated from asymptomatic commercial ostriches (Struthio camelus) in the southern Cape region in 2012 and 2015 respectively. In the latter case, prompt and strict control measures prevented spread of the virus, unlike previous H5N2 strains that circulated in flocks and eventually mutated to HPAI [27-30]. Interestingly, no mutation in ostriches of LPAI H7Nx strains to HPAI has ever been reported, despite frequent detection and extended periods of circulation [30]. Ion Torrent ultra-deep sequencing and mean death times were used to monitor the incremental changes in viral genomic molecular markers and the pathotypes, respectively.

Materials and methods

Viruses and passage experiments

Experiments in ECEs were conducted with the approval of the Research and Animal Ethics Committees of the University of Pretoria (protocol number V010-17). Second passage stocks of A/ostrich/South Africa/ORD/2012 (H7N1) and A/Ostrich/South Africa/325863/2015 (H5N2) were propagated in 9- to 11- day old specific pathogen free (SPF) ECEs (AviFarms (Pty) Ltd, Pretoria) following the standard international protocol (OIE, 2015), with titration to determine the 50% egg infectious dose (EID50) [31]. The allantoic cavities of 3 to 5 14-day old ECEs were inoculated with 0.2 ml of allantoic fluid (AF) containing 106.0 EID50/0.1 ml of the H5N2 or H7N1 viruses and were incubated for up to 5 days with candling every 24 hours. Eggs containing dead embryos within the first 24 hours of inoculation were discarded as nonspecific mortalities. Thereafter, eggs with dead embryos were removed and kept in a refrigerator at 4°C. All eggs remaining at the end of the incubation period were chilled overnight at 4°C. Daily mortalities were recorded and were used to calculate mean time to death (MDT). The AF was harvested and tested for hemagglutinating (HA) activity according to the standard international standard method [15]. The presence of IAV was confirmed by real-time reverse transcription PCR using the M-gene targeted oligonucleotides and cycling parameters described by Spackman et al. [32] with VetMAX™-Plus One-Step RT-PCR reagents (ThermoFischer Scientific, Johannesburg) on a StepOnePlus thermal cycler (ThermoFischer Scientific, Johannesburg). The IAV-positive AFs from replicate ECEs were pooled and used to inoculate the subsequent passage. Passages 1 to 7 were performed using only the aspirated AFs but, to ensure the broadest possible representation of the viral population within the embryo, from passage eight onwards the whole embryos were harvested along with the AF, homogenised in antibiotic solution containing 50 mg gentamycin (Virbac, Centurion, South Africa) and 100 mg enrofloxacin (Bayer, Johannesburg) per litre and centrifuged at 1000 x g for 5 minutes, and the supernatants were pooled and inoculated in the subsequent passage. In total, seventeen passages were performed with the H5N2 and H7N1 viruses. All virus passage experiments were performed in the University’s Poultry Biosafety Level 3 facility.

Ion Torrent sequencing

The first seven passages plus passages 11, 15 and 17 were selected for Ion Torrent sequencing, as well as the original inoculum of H5N2 and H7N1 to confirm the consensus sequences previously deposited in Genbank (accession numbers KY765295-KY765302 and KT777901-KT777908, respectively). Total RNA was extracted from AF using TRIzol® reagent (Gibco, Invitrogen) according to the manufacturer’s recommended procedure. RNA pellets resuspended in 40 μl diethylpyrocarbonate (DEPC) treated Milli-Q water were quantified with a Nanodrop® Spectrophotometer (ThermoFischer Scientific, Johannesburg) and shipped on ice to the Stellenbosch University Sequencing Facility for Ion Torrent deep sequencing. RNAs were assessed for RNA integrity scores (RIN) and quantified on a BioAnalyzer 2100 using the RNA 6000 Nano Chip and reagents (Agilent Technologies, Waldbronn, Germany). The Ion Total RNA-Seq Kit v2 was used to convert total RNA into a representative cDNA library for strand specific RNA sequencing on the Ion Torrent™ Ion Proton™ system according to manufacturer’s protocol. Briefly, 25 μl of total RNA was concentrated to 10 μl at 37°C for 2 hrs. The 10 μl RNA volume was then fragmented with RNAse III for 2 min at 37°C. The fragmented RNA was purified using the magnetic bead clean-up module and eluted in nuclease-free water. The yield and size of the fragmented RNA was not evaluated due to expected low concentrations. Instead, the full volume of RNA was used for subsequent hybridization and ligation to adapters at 30°C for 1 hour. The RNA, with hybridized adapters, was reverse transcribed to generate single stranded cDNA libraries. The cDNA products were amplified to prepare barcoded cDNA libraries using the Ion Xpress™ RNA-Seq Barcode Kit, purified using the magnetic bead clean-up module and assessed for yield and fragment size distribution using the High Sensitivity DNA Kit and chips on the BioAnalyser 2100 (Agilent Technologies) according to recommended procedures. The libraries were considered sufficient for template preparation and enrichment if <50% of fragments were present in the 50 bp to 160 bp range. The barcoded cDNA libraries were diluted to a target concentration of 80 pM and combined in equimolar amounts for sequencing template preparation using the Ion PI™ Hi Q™ Chef Kit. Enriched, template positive ion sphere particles were loaded onto an Ion PI™ (v3) Chip. Massively parallel sequencing was performed on the Ion Proton™ System using solutions and reagents supplied by the manufacturer and according to the recommended procedure. Flow space calibration and basecaller analysis were performed using standard analysis parameters in the Torrent Suite Version 5.4.0 Software (Thermo Fisher Scientific, Waltham, MA, USA). Sequencing reads with bases of Phred scores ≥ 20 were used for analysis.

Data analysis

Consensus genome assembly

Sequence reads were imported into the CLC Genomics Workbench v7.5.2 (CLC Bio, Qiagen) and the default settings were used to assemble the reads against each of the eight reference IAV genome segments for H5N2 (KY765295-KY765302) or H7N1 (KT777901-KT777908) for each passage. Consensus sequences for the eight gene segments at each passage level were imported into BioEdit v7.1.3.0 [33] for multiple sequence alignments of the translated protein sequences. Abbreviations for the encoded genes are as follows: polymerase B2 (PB2); polymerase B1 (PB1); polymerase B1- Fragment 2 (PB1-F2); polymerase A (PA); polymerase A- X (PA-X); HA: hemagglutinin (HA); nucleoprotein (NP); membrane protein 1 (M1), membrane protein 2 (M2e), non-structural protein 1 (NS1) and nuclear export protein (NEP). Raw sequence reads for each passage were deposited in the Genbank BioSample database under BioProject number PRJNA629435 with accession numbers SAMN14775585—SAMN14775604.

Hemagglutinin cleavage site variant analysis

Two modified sequence tags (MSTs) each for the H5 HACS and H7 HACS were designed and imported into the CLC Genomics Workbench (Table 1). For each passage the sub-set of reads that mapped against Segment 4 (HA gene) was extracted and used to map against the relevant MST pair. The HACS extends from nucleotides 1009 to 1035 in the H5 HA gene and from nucleotides 997 to 1026 in the H7 HA gene, both starting with proline-encoding CCT codon and ending with the phenyalanine-encoding TTT codon (Table 1). Mapped reads extending up to 100 bp upstream or downstream of the HACS were extracted and exported in FASTA file format. In BioEdit the reads were visually inspected and converted to the reverse complement where necessary. The sequences were aligned using MAFFT online v 7 [34] before manual inspection and editing in Bioedit, retaining for analysis only the reads that spanned the entire cleavage site. Amino acid translations were also performed in BioEdit.
Table 1

Modified sequence tags used to retrieve reads spanning the hemagglutinin cleavage site.

LPAI H5 HACS sequence:P Q R E T R   G L F
CCT CAA AGA CAG ACA AGA --- --- GGG CCT TTT
H5 HA MST 1:CCT CAA AGA AAA AAA AAA AAA --- GGG CCT TTT
H5 HA MST 2:CCT CAA AGA AAA AAA AAA AAAAAA GGG CCT TTT
LPAI H7 HACS sequence:P E L P  K G R G L F
CCC GAA CTC CCA --- AAG GGA AGA GGC CTG TTT
H7 HA MST 1:CCC GAA CTC CCA AAA AAG GGA AGA GGC CTG TTT
H7 HA MST 2:CCC GAA CTC CCA --- AAAAAAAAA GGC CTG TTT

Amino acid translations are in boldface; changes are underlined; “¬¬-”= no nucleotide.

Amino acid translations are in boldface; changes are underlined; “¬¬-”= no nucleotide.

Results

Increasing pathogenicity to chicken embryos with subsequent passages of H5N2 and H7N1 LPAIVs

Embryos of the sham-inoculated controls (phosphate-buffered saline, pH 7.4) appeared normal whereas the H5N2- and H7N1-virus infected embryos that died within the 90 hour incubation period showed generalised haemorrhages that are characteristic of HPAI, plus stunting and sparse feather suggestive of arrested embryonic development. All eggs inoculated with H5N2 LPAI virus survived the first three passages (Fig 1) whereas all embryos after P4 were dead with MDTs of 60 hours or less. Mean death times and the proportion of surviving embryos infected with H5N2 virus were variable between P4 and P13. The percentage of live embryos and the MDTs had been decreasing up until passage 7, but in passage 8 the phenotype of both viruses changed with an increase in the percentage of live embryos and MDTs of >90 hours. The only change in the protocol was that stocks were frozen at -80°C during a University recess; this likely caused a slight drop in the viability of the viruses in passage 8, causing the delayed embryo deaths. Eggs inoculated with the H7N1 LPAI virus had a 100% survival rate for the first passage only. From passages 2 to 9 a proportion of the embryos died with each passage but most had MDTs of 72 hours and above except P5. From P10 onwards all H7N1-infected embryos were dead within 60 hours.
Fig 1

Mortality patterns and mean death times (MDTs) of (a) H5N2 and (b) H7N1 low pathogenic avian influenza viruses passaged in 14-day old embryonated eggs. A 100% survival rate and MDTs >90 hours are coloured green. Survival rates between 50 and 100% and MDTs between 60 and 90 hours are coloured orange. Survival rates less than 50% and MDTs of 60 hours and less are coloured red.

Mortality patterns and mean death times (MDTs) of (a) H5N2 and (b) H7N1 low pathogenic avian influenza viruses passaged in 14-day old embryonated eggs. A 100% survival rate and MDTs >90 hours are coloured green. Survival rates between 50 and 100% and MDTs between 60 and 90 hours are coloured orange. Survival rates less than 50% and MDTs of 60 hours and less are coloured red.

Emergence of potential virulence markers in the consensus sequences of H5N2 and H7N1 viruses during passages

The total number of sequencing reads generated for the H5N2 virus varied from 3,9 million for P4 to 16,7 million for P11 with average read lengths of between 61 and 138 bp (S1 Table). H5N2 influenza A -specific genome coverage ranged from 8,113 reads mapped to segment 8 in P2 up to 376,580 reads mapped to segment 1 in P11. For H7N1, total read numbers ranged from 3,6 million for P1 to 19,4 million for passage 7 with average read lengths of 91 to 141 bp (S2 Table). H7N1 influenza A -specific genome coverage ranged from 2,196 for segment 2 of P4 up to 526,100 reads mapped to segment 7 in P15.

Molecular markers in the H5N2 consensus sequences

The H5N2 consensus sequences for the PB2, PB1, PB1-F2, PA-X, M2 and NEP proteins did not change over the course of seventeen successive passages in 14-d ECEs (Table 2). A single D216Y substitution emerged in the PA protein after P1 and was retained to P17.
Table 2

Amino acid changes in the consensus H5N2 virus genomes across passages (P), compared to the original LPAI H5N2 virus.

ProteinP1P2P3P4P5P6P7P11P15P17
PB2----------
PB1----------
PB1-F2----------
PAD216YD216YD216YD216YD216YD216YD216YD216YD216YD216Y
PA-X----------
HA--------V63MV63M
-A200DA200DA200DA200DA200DA200DA200DA200DA200D
-----E228VE228VE228VE228VE228V
--------D272GD272G
V452IV452IV452IV452IV452IV452IV452IV452IV452IV452I
S511NS511NS511NS511NS511NS511NS511NS511NS511NS511N
NP-----Q357KQ357KQ357KQ357KQ357K
NA-------H155PH155PH155P
I464NI464NI464NI464NI464NI464NI464N---
M1-T168IT168IT168IT168IT168IT168IT168IT168IT168I
M2----------
NS1-------E60GE60GE60G
NEP----------

- No change.

- No change. The H5N2 HA protein had the highest proportion of amino acid substitutions. V452I and S511N emerged early in P1 and A200D emerged in P2, but the MDTs were all <90 hours with 100% survival in the first three passages of the virus therefore these three mutations were unlikely to have caused the increased pathogenicity of the virus. Candidates for virulence markers in the HA protein included E228V that appeared in P6 plus V63M and D272G that were present in the consensus sequence from P15 onwards. V63M, E228V and D272G have not previously been experimentally verified as molecular markers involved in H5 AIV pathogenicity, receptor binding, replicative capacity or inter-species transmission [35] nor are present in field HPAIVs to date [36], but E228V is strategically located in the 220-loop of the HA receptor binding site. Alone or in combination, these three substitutions in the HA of the H5N2 virus could be molecular virulence determinants for the increased pathogenicity of the virus from P14 onwards (Fig 1), but experimentally verification is required. In the NP protein a Q357K mutation emerged in passage 6, and in mice a Q357L mutation (in combination with E627K in PB2) was associated with enhanced virulence [35]. In the NA protein, I464N emerged in P1, but disappeared from the consensus sequence after P7. An H155P substitution detected in P11 was retained to P17, but neither of these molecular markers is known to be associated with increased pathogenicity or resistance to antiviral compounds. Similarly, the T168I substitution in the M1 protein from P2 onwards was not previously described as virulence determinants [35, 36]. The E60G substitution in NS1 was however also present in Mexican HPAI H5N2 strains from 1994 to 1995 that emerged from low pathogenic precursors [37].

Molecular markers in the H7N1 consensus sequences

Two amino acid substitutions in the H7N1 consensus PB2 proteins, namely P349L and H748Q, plus P58L in the NEP emerged in P1 (Table 3) where MDTs were >90 hours (Fig 1) and were therefore unlikely to influence the pathogenicity of the H7N1 strain. All eggs had died consistently from P10 onwards and in P11, when PB1 R584H and L589I had emerged in the consensus genome. These two candidates for virulence markers in the PB1 protein have not been described before.
Table 3

Amino acid changes in the consensus H7N1 genome across passages (P), compared to the original LPAI H7N1 virus.

ProteinP1P2P3P4P5P6P7P11P15P17
PB2P349LP349LP349LP349LP349LP349LP349LP349LP349LP349L
H748QH748QH748QH748QH748QH748QH748QH748QH748QH748Q
PB1-------R584HR584HR584H
-------L589IL589IL589I
PB1-F2----------
PA----------
PA-X----------
HA--------A146TA146T
-------Q220EQ220E-
-----N434K----
------N455YN455Y--
NP----------
NA-----S369G----
M1--------D231ND231N
M2e----------
NS1----------
NEPP58LP58LP58LP58LP58LP58LP58LP58LP58LP58L

- No change.

- No change. The H7N1 HA protein had several substitutions appearing from P6 onwards. A146T emerged between P8 and P15 where it was present in the consensus sequence of latter passage. The A146T mutation was also observed in an H7N3 HPAI that emerged from low pathogenic precursor in Italy [38], although the significance in host adaptation and pathogenicity shift is yet to be elucidated. A146S was one of four HA mutations in an H7N7 virus found to be associated with increased pathogenicity in mice and transmission in guinea pigs [39]. The Q220E and N455Y substitutions also appeared post P7 but were not stably maintained in the majority viral population. The amino acid sequence in the M1 protein is characterized by a pair of aspartate residues at positions 231 and 232. In this study D231N in the M1 protein detected in P15 was retained until the end of the experiment at passage 17 but interestingly, only the adjacent D232N is associated with field HPAIVs [35].

Variation within the HACS and emergence of multibasic motifs of H5N2 and H7N1 viruses

Modified sequence tags (MSTs) (Table 1) were used to extract all reads completely spanning the HACS of the H5N2 and H7N1 viruses. Altering the MSTs to include longer insertions of A or G nucleotides, and modifying nucleotides at other positions were tested but these did not result in the retrieval of longer inserts or other populations. Reads were sorted according to length and translated to amino acids.

Variation at the HACS of the H5N2 virus during passage

The total number of reads recovered for the HACS of the H5N2 virus varied from 40 for P2 to 425 for P6 (S3 Table). Variation at the HACS was generated through random deletions of between one and three nucleotides, insertions of up to six nucleotides and substitutions, resulting in amino acid substitutions and/ or frame shifts in the encoded peptides. There was no correlation between the number of HACS reads recovered and the number of variants detected. The original LPAI nucleotide sequence dominated the total read percentage at each passage level, with the lowest frequency of 47.71% at P15. Overall, there appeared to be a general increase in the proportion of variant HACS sequences after P6, but there was no increase in the frequency of longer insertions. Notably, non-homologous recombination in the HACS was evident in two instances; in P6 an insertion of 13 nts encoding the peptide TGTGV (not in frame) originated from an unknown source and in P17 a 42-nt insert in-frame with and immediately adjacent to the HACS was found. The insert (underlined) encoded the motif PQRETRRESRNPGNAEIEDLIF and bore 100% identity similarity with nucleotides 729 to 776 of the NP gene of influenza A virus [40].

Detection of in-frame monobasic and multibasic HACS motifs in the H5N2 virus across passages

H5 HACS sequences that encoded complete HACS motifs flanked by “PQ” and “GLF” residues (S3 Table) are collated in Table 4. The motif PQRGTR/GLF (variation is underlined), detected in P1, P11 and P15 at low frequency is commonly detected in wild bird LPAIVs [40]. The motifs PQKETR/GLF (P3, P6 and P15), PQREAR/GLF (P4 and P15), and PQRKTR/GLF (P15) were detected at low frequencies and are commonly detected in wild bird and poultry LPAIVs [40]. PQRETK/GLF detected in P4 has been previously described in A/gull/Pennsylvania/4175/83 (H5N1) as well as South Korean wild duck H5N2 LPAIVs. PQREIR/GLF in P17 was also previously reported in duck-origin H5N2 LPAIVs from North America, namely A/Muscovy duck/New York/09-005059-002/2009 and A/duck/New York/09-005059-001/2009 [40].
Table 4

Hemagglutinin cleavage sites (HA0) detected in the H5N2 low pathogenic avian influenza virus passaged in 14-day old ECEs.

Passage no. (total reads)HA0 cDNA nucleotide sequenceNumber of reads (percentage)Translated amino acidPredicted cleavability in vivo
1 (225)CCTCAAAGAGAGACAAGAGGGCTATTT184 (82.14)PQRETR/GLFconventional monobasic LPAI
CCTCAAAGAGGGACAAGAGGGCTATTT2 (0.89)PQRGTR/GLF1monobasic, LPAI
CCTCAAAGACGAGACA_GAGGGCTATTT1 (0.44)PQRRDR/GLFmonobasic, LPAI
2 (40)CCTCAAAGAGAGACAAGAGGGCTATTT33 (82.50)PQRETR/GLFconventional monobasic LPAI
3 (57)CCTCAAAGAGAGACAAGAGGGCTATTT46 (80.70)PQRETR/GLFconventional monobasic LPAI
CCTCAAAAAGAGACAAGGGGGCTATTT1 (1.75)PQKETR/GLF2monobasic, LPAI
4 (259)CCTCAAAGAGAGACAAGAGGGCTATTT240 (92.66)PQRETR/GLFconventional monobasic LPAI
CCTCAAAGAGAGGCAAGAGGGCTATTT2 (0.77)PQREAR/GLF3monobasic, LPAI
CCTCAAAGAGAGACAAAAGGGCTATTT1 (0.39)PQRETK/GLF4monobasic, LPAI
CCTCAAACGAGAGCACCAAGAGGGCTATTT1 (0.39)PQTRAPR/GLFmonobasic, LPAI
5 (290)CCTCAAAGAGAGACAAGAGGGCTATTT267 (92.07)PQRETR/GLFconventional monobasic LPAI
6 (425)CCTCAAAGAGAGACAAGAGGGCTATTT404 (95.06)PQRETR/GLFconventional monobasic LPAI
CCTCAA_GAGAGACAACGAGGGCTATTT2 (0.47)PQERQR/GLFmonobasic, LPAI
CCTCAAAAAGAGACAAGAGGGCTATTT1 (0.24)PQKETR/GLF2monobasic, LPAI
7 (114)CCTCAAAGAGAGACAAGAGGGCTATTT82 (71.93)PQRETR/GLFconventional monobasic LPAI
CCTCAA_GAGAGGACAAGAGGGCTATTT1 (0.88)PQERTR/GLFmonobasic, LPAI
11 (208)CCTCAAAGAGAGACAAGGGGGCTATTT134 (64.42)PQRETR/GLFconventional monobasic LPAI
CCTCAAGAGAGACGAAGAGGGCTATTT1 (0.48)PQERRR/GLFmultibasic, HPAI
CCTCAAAGAGAAGACA_GAGGGCTATTT1 (0.48)PQREDR/GLFmonobasic, LPAI
CCTCAAAGAGGGACAAGAGGGCTATTT1 (0.48)PQRGTR/GLF1monobasic, LPAI
CCTCAAAGAAGAGGACAAGAGGGCTTATTT3 (1.44)PQRRGQE/GLFmonobasic, LPAI
15 (301)CCTCAAAGAGAGACAAGAGGGCTATTT146 (47.71)PQRETR/GLFconventional monobasic LPAI
CCTCAAAAAGAGACAAGAGGGCTATTT2 (0.66)PQKETR/GLF2monobasic, LPAI
CCTCAAAAGAAGAGACAAGACGGGCTATTT1 (0.33)PQKKRQD/GLFmonobasic, LPAI
CCTCAAAGAGAGGCAAGAGGGCTATTT3 (0.98)PQREAR/GLF3monobasic, LPAI
CCTCAAAGAGAGAGAAGAGGGCTATTT3 (0.98)PQRERR/GLFmultibasic, HPAI
CCTCAAAGAGGGACAAGAGGGCTATTT3 (0.98)PQRGTR/GLF1monobasic, LPAI
CCTCAAAGAAAGACAAGAGGGCTATTT1 (0.33)PQRKTR/GLF5monobasic, LPAI
CCTCAAAGAAGAGACGAAGAAGGGCTATTT1 (0.33)PQRRDEE/GLFmonobasic, LPAI
CCTCAAAGAAGAGGACAAGAGGGCTTATTT1 (0.33)PQRRGQE/GLFmonobasic, LPAI
CCTCAAAGACGTAGACAAGAGGGCTTATTT1 (0.33)PQRRRQE/GLFmonobasic, LPAI
17 (130)CCTCAAAGAGAGACAAGAGGGCTATTT81 (62.31)PQRETR/GLFconventional monobasic LPAI
CCTCAA_GAGAGAGCAAGAGGGCTATTT1 (0.77)PQERAR/GLFmonobasic, LPAI
CCTCAA_GAACGAGACAAGATGGGCCTATTT1 (0.77)PQERDKM/GLFmonobasic, LPAI
CCTCAA_GAGAGACAACGAGGGCTATTT1 (0.77)PQERQR/GLFmonobasic, LPAI
CCTCAA_GAGAGACGAAGAGGGCTATTT1 (0.77)PQERRR/GLFmultibasic, HPAI
CCTCAAAGAGAGATAAGAGGGCTATTT1 (0.77)PQREIR/GLF6monobasic, LPAI
CCTCAAAGAAGAGGACAAGAGGGCTTATTT2 (1.54)PQRRGQE/GLFmonobasic, LPAI
CCTCAAAGAGTACGGACGAACGAGGGCCTATTT1 (0.77)PQRVRTNE/GLFmonobasic, LPAI

1, 2, 3 Motifs common in wild bird H5Nx LPAIVs.

4Motif detected in A/gull/Pennsylvania/4175/83(H5N1) (NCBI Sequence ID: AAD13575) and South Korean wild duck H5N2 LPAIVs.

5Motif common in wild bird and poultry H5Nx LPAIVs.

6Motif detected in A/Muscovy duck/New York/09-005059-002/2009 (H5N2) (NCBI Sequence ID: AWX60259) and A/duck/New York/09-005059-001/2009 (H5N2) (NCBI Sequence ID: AWX60391).

1, 2, 3 Motifs common in wild bird H5Nx LPAIVs. 4Motif detected in A/gull/Pennsylvania/4175/83(H5N1) (NCBI Sequence ID: AAD13575) and South Korean wild duck H5N2 LPAIVs. 5Motif common in wild bird and poultry H5Nx LPAIVs. 6Motif detected in A/Muscovy duck/New York/09-005059-002/2009 (H5N2) (NCBI Sequence ID: AWX60259) and A/duck/New York/09-005059-001/2009 (H5N2) (NCBI Sequence ID: AWX60391). An HACS that contained a dibasic amino acid pair adjacent to the peptide cleavage site was first detected in P11, with the sequence of PQERRR/GLF. The additional arginine residue resulted not from a duplication event, but rather from the deletion of A and the insertion of a G nucleotide, but this sequence has not yet been reported in nature. The same motif was detected in P17 but was not in P15. A second multi-basic motif, viz. PQRERR/GLF, was detected in P15 where the T to R substitution was caused by an A to G nucleotide mutation.

Variation at the HACS of the H7N1 virus during passage

Substantially more reads spanning the complete HACS were recovered for the H7N1 virus (S4 Table), even though the depth of coverage obtained for the segment 4 for H7N1 compared to the H5N2 virus was variable (S1 and S2 Tables). Total reads spanning the entire HACS in H7N1 ranged from 60 recovered for P4 to 13,681 recovered for P15. Similar to the H5N2 virus, there was no obvious correlation between the number of HACS reads and the amount of variation detected, but unlike the H5N2 virus there was no apparent increase in the proportion of variants compared to the original LPAI sequence in the later H7N1 virus passages; the original LPAI sequence remained in the vast majority at above 93.96% across passages.

Detection of in-frame monobasic and multibasic HACS motifs in the H7N1 virus across passages

H7 HACS sequences that encoded complete HACS motifs flanked by “PE” and “GLF” residues (S4 Table) are collated in Table 5. The motif PELPKGK/GLF was detected in P2, P3, P7, P15 and P17 and was previously described in wild bird LPAIVs in the Netherlands and Korea [40]. PEPPKGR/GLF (P2, P7, P11 and P15) is a common motif in wild bird H7Nx LPAIVs [40]. PEFPKGR/GLF (P3, P5, P7 and P11) was detected in an H7N3 LPAI isolate, A/ruddy shelduck/Mongolia/598C2/2009. PEVPKGR/GLF (P3 only), is a common motif in wild duck and poultry H7N1 and H7N9 LPAIVs (NCBI, 2020). PESPKGR/GLF (P7 and P15) was previously identified in H7N7 strain A/goose/Guangdong/7472/2012 [40], whereas PETPKGR/GLF (P7, P11 and P15) is a common motif in wild bird and poultry H7Nx LPAIVs (NCBI, 2000).
Table 5

Hemagglutinin cleavage sites (HA0) detected in the H7N1 low pathogenic avian influenza virus passaged in 14-day old ECEs.

Passage no. (total reads)HA0 cDNA nucleotide sequenceNumber of reads (percentage)Translated amino acidPredicted cleavability in vivo
1 (1778)CCCGAACTCCCAAAGGGAAGAGGCCTGTTT1690 (95.05)PELPKGR/GLFconventional monobasic LPAI
CCCGAACTCTCAAAGGGAAGAGGCCTGTTT8 (0.45)PELSKGR/GLFmonobasic, LPAI
CCCGAACTCCCAAGGGGAAGAGGCCTGTTT7 (0.39)PELPRGR/GLFmonobasic, LPAI
CCCGAACGCCCAAAGGGAAGAGGCCTGTTT1 (0.06)PERPKGR/GLFmonobasic, LPAI
2 (2869)CCCGAACTCCCAAAGGGAAGAGGCCTGTTT2730 (95.15)PELPKGR/GLFconventional monobasic LPAI
CCCGAACTCCCAAAGGAAAGAGGCCTGTTT1 (0.04)PELPKER/GLFmonobasic, LPAI
CCCGAACTCCCAAAGGGAAAAGGCCTGTTT4 (0.14)PELPKGK/GLF1monobasic, LPAI
CCCGAACCCCCAAAGGGAAGAGGCCTGTTT3 (0.11)PEPPKGR/GLF2monobasic, LPAI
CCCGAACTCCGAAAGGGAAGAGGCCTGTTT1 (0.04)PELRKGR/GLFmonobasic, LPAI
CCCGAACTCCCAAGGGGAAGAGGCCTGTTT5 (0.17)PELPRGR/GLFmonobasic, LPAI
3 (4016)CCCGAACTCCCAAAGGGAAGAGGCCTGTTT3910 (97.36)PELPKGR/GLFconventional monobasic LPAI
CCCGAACATCCAAAGGGAAGAGGCCTGTTT1 (0.03)PEHPKGR/GLFmonobasic, LPAI
CCCGAACTCCCAAAGGGAAAAGGCCTGTTT1 (0.03)PELPKGK/GLF1monobasic, LPAI
CCCGAATTCCCAAAGGGAAGAGGCCTGTTT1 (0.03)PEFPKGR/GLF3monobasic, LPAI
CCCGAACTCCCAAGGGGAAGAGGCCTGTTT7 (0.17)PELPRGR/GLFmonobasic, LPAI
CCCGAACTCCCAACGGGAAGAGGCCTGTTT2 (0.05)PELPTGR/GLFmonobasic, LPAI
CCCGAAGTCCCAAAGGGAAGAGGCCTGTTT2 (0.05)PEVPKGR/GLF4monobasic, LPAI
CCCGAACTCCAAAAGGGAAGAGGCCTGTTT2 (0.05)PELQKGR/GLFmonobasic, LPAI
CCCGAACTCCAACGGAAGGAGGGCCTGTTT1 (0.03)PELQRKE/GLFmonobasic, LPAI
CCCGAACTCTCAAAGGGAAGAGGCCTGTTT1 (0.03)PELSKGR/GLFmonobasic, LPAI
CCCGAACCCCCAAAGGGAAGAGGCCTGTTT1 (0.03)PEPPKGR/GLF2monobasic, LPAI
5 (74)CCCGAACTCCCAAAGGGAAGAGGCCTGTTT72 (97.30)PELPKGR/GLFconventional monobasic LPAI
CCCGAATTCCCAAAGGGAAGAGGCCTGTTT1 (1.35)PEFPKGR/GLF3monobasic, LPAI
6 (1030)CCCGAACTCCCAAAGGGAAGAGGCCTGTTT985 (95.63)PELPKGR/GLFconventional monobasic LPAI
CCCGAACTCTCAAAGGGAAGAGGCCTGTTT1 (0.10)PELSKGR/GLFmonobasic, LPAI
CCCGAACTCCCAAGGGGAAGAGGCCTGTTT3 (0.29)PELPRGR/GLFmonobasic, LPAI
7 (2331)CCCGAACTCCCAAAGGGAAGAGGCCTGTTT2232 (95.75)PELPKGR/GLFconventional monobasic LPAI
CCCGAATTCCCAAAGGGAAGAGGCCTGTTT2 (0.09)PEFPKGR/GLF3monobasic, LPAI
CCCGAACATCCCAAGGGAAGAGGCCTGTTT1 (0.04)PEHPKGR/GLFmonobasic, LPAI
CCCGAACTCCCAAAGGAAAGAGGCCTGTTT1 (0.04)PELPKER/GLFmonobasic, LPAI
CCCGAACTCCCAAAGGGAAAAGGCCTGTTT2 (0.09)PELPKGK/GLF1monobasic, LPAI
CCCGAACTCCCAAAGAGAAGAGGCCTGTTT3 (0.13)PELPKRR/GLF5multibasic, HPAI
CCCGAACTCCCAA_GGGAACGAGGCCTGTTT2 (0.09)PELPRER/GLFmonobasic, LPAI
CCCGAACTCCCAAGGGGAAGAGGCCTGTTT1 (0.04)PELPRGR/GLFmonobasic, LPAI
CCCGAACTCCAACGGAAGGAAGGCCTGTTT1 (0.04)PELQRKE/GLFmonobasic, LPAI
CCCGAACCCCCAAAGGGAAGAGGCCTGTTT3 (0.13)PEPPKGR/GLF2monobasic, LPAI
CCCGAATCCCCAAAGGGAAGAGGCCTGTTT1 (0.04)PESPKGR/GLF6monobasic, LPAI
CCCGAAACTCC_AAAGGGAAGAGGCCTGTTT1 (0.04)PETPKGR/GLF7monobasic, LPAI
CCCGAACTCCCAAAGGGGAAGAAGGGCCTGTTT1 (0.04)PELPKGKK/GLFmultibasic, HPAI
CCCGAACTCCCCAAAAGGGGAAGAGGCCTGTTT1 (0.04)PELPKRGR/GLFmonobasic, LPAI
CCCGAAACTCCCCAAAAGGGAAGAGGCCTGTTT1 (0.04)PETPQKGR/GLFmonobasic, LPAI
11 (3625)CCCGAACTCCCAAAGGGAAGAGGCCTGTTT3406 (93.95)PELPKGR/GLFconventional monobasic LPAI
CCCGAATTCCCAAAGGGAAGAGGCCTGTTT1 (0.03)PEFPKGR/GLF3monobasic, LPAI
CCCGAAATCCCAAAGGGAAGAGGCCTGTTT2 (0.06)PEIPKGR/GLF8monobasic, LPAI
CCCGAACTCCCAAGGGGAAGAGGCCTGTTT3 (0.08)PELPRGR/GLFmonobasic, LPAI
CCCGAACTCCAACGGAAGGAAGGCCTGTTT1 (0.03)PELQRKE/GLFmonobasic, LPAI
CCCGAACCCCCAAAGGGAAGAGGCCTGTTT4 (0.11)PEPPKGR/GLF2monobasic, LPAI
CCCGAAACTCCCAAGGGAAGAGGCCTGTTT1 (0.03)PETPKGR/GLF7monobasic, LPAI
15 (13681)CCCGAACTCCCGAAGGGAAGAGGCCTGTTT12985 (94.72)PELPKGR/GLFconventional monobasic LPAI
CCCGAACTCCCAAAGGGAAAAGGCCTGTTT5 (0.04)PELPKGK/GLF1monobasic, LPAI
CCCGAACACCCAAAGGGAAGAGGCCTGTTT2 (0.02)PEHPKGR/GLFmonobasic, LPAI
CCCGAAATCCCAAAGGGAAGAGGCCTGTTT1 (0.01)PEIPKGR/GLF8monobasic, LPAI
CCCGAACTCCTAAAGGGAAGAGGCCTGTTT3 (0.02)PELLKGR/GLFmonobasic, LPAI
CCCGAACTCCCAAAGGAAAGAGGCCTGTTT6 (0.04)PELPKER/GLFmonobasic, LPAI
CCCGAACTCCAAAAGGGAAGAGGCCTGTTT1 (0.01)PELQKGR/GLFmonobasic, LPAI
CCCGAACTCCAACGGAAGGAAGGCCTGTTT1 (0.01)PELQRKE/GLFmonobasic, LPAI
CCCGAACTCCCAAAGAGAAGAGGCCTGTTT1 (0.01)PELPKRR/GLF5multibasic, HPAI
CCCGAACTCCCAAAGGTAAGAGGCCTGTTT7 (0.05)PELPKVR/GLFmonobasic, LPAI
CCCGAACTCCCAAGGGGAAGAGGCCTGTTT13 (0.10)PELPRGR/GLFmonobasic, LPAI
CCCGAACTCCGAAAGGGAAGAGGCCTGTTT1 (0.01)PELRKGR/GLFmonobasic, LPAI
CCCGAACGCCCAAAGGGAAGAGGCCTGTTT1 (0.01)PERPKGR/GLFmonobasic, LPAI
CCCGAAACTCCC_AAGGGAAGAGGCCTGTTT2 (0.02)PETPKGR/GLF7monobasic, LPAI
CCCGAACCCCCAAAGGGAAGAGGCCTGTTT16 (0.12)PEPPKGR/GLF2monobasic, LPAI
CCCGAACTCCCGAAAGGGAAGACAGGCCTGTTT1 (0.01)PELPKGKT/GLFmonobasic, LPAI
CCCGAACATCCCAAACGGGAAAGAGGCCTGTTT1 (0.01)PEHPKRER/GLFmonobasic, LPAI
CCCGAAACTCCCCAAAAGGGAAGAGGCCTGTTT1 (0.01)PETPQKGR/GLFmonobasic, LPAI
CCCGAAACTCCCAAAGGGAAGGAGGGCCTGTTT1 (0.01)PETPKGKE/GLFmonobasic, LPAI
CCCGAAACTCCCCAAAAGGGGAAAGAGGGCCTGTTT1 (0.01)PETPQKGKE/GLFmonobasic, LPAI
17 (7280)CCCGAACTCCCAAAGGGAAGAGGCCTGTTT7079 (97.24)PELPKGR/GLFconventional monobasic LPAI
CCCGAACTCCCAAAGGGAAAAGGCCTGTTT1 (0.01)PELPKGK/GLF1monobasic, LPAI
CCCGAACTCTCAAAGGGAAGAGGCCTGTTT2 (0.03)PELSKGR/GLFmonobasic, LPAI
CCCGAACTCCCAAGGGGAAGAGGCCTGTTT8 (0.11)PELPRGR/GLFmonobasic, LPAI
CCCGAACTCCCAAAGAGAGGAGGCCTGTTT1 (0.01)PELPKRG/GLFmonobasic, LPAI
CCCGAAACTCCCAAACGGGAAGAGGGCCTGTTT1 (0.01)PETPKREE/GLFmonobasic, LPAI

1Motif detected in wild bird H7N1 LPAIVs in the Netherlands and Korea in 2011, e.g. A/mallard duck/Netherlands/43/2011(H7N1) NCBI Sequence ID: APC30435.

2, 7, 8 Motifs common in wild bird H7Nx LPAIVs.

3Motif detected in A/ruddy shelduck/Mongolia/598C2/2009 (H7N3), NCBI Sequence ID: AGL07608.

4Motif detected in wild duck and poultry H7N1 and H7N9 LPAIVs.

5Motif detected in A/quail/Aichi/4/2009(H7N6) NCBI Sequence ID: BAJ08819.

6Motif detected in A/goose/Guangdong/7472/2012(H7N7) Sequence ID: AGQ80959.

1Motif detected in wild bird H7N1 LPAIVs in the Netherlands and Korea in 2011, e.g. A/mallard duck/Netherlands/43/2011(H7N1) NCBI Sequence ID: APC30435. 2, 7, 8 Motifs common in wild bird H7Nx LPAIVs. 3Motif detected in A/ruddy shelduck/Mongolia/598C2/2009 (H7N3), NCBI Sequence ID: AGL07608. 4Motif detected in wild duck and poultry H7N1 and H7N9 LPAIVs. 5Motif detected in A/quail/Aichi/4/2009(H7N6) NCBI Sequence ID: BAJ08819. 6Motif detected in A/goose/Guangdong/7472/2012(H7N7) Sequence ID: AGQ80959. Multi-basic H7N1 HACS motifs were first detected in P7. PELPKGKK/GLF was only detected in P7, and the mutation was the result of insertions of A and G nucleotides at non-consecutive positions in the HACS. This motif has not been reported in nature, but the second multi-basic motif in P7, PELPKRR/GLF, was previously identified in an H7N6 isolate, A/quail/Aichi/4/2009 [41]. Here, the G to R substitution was caused by a G to A mutation in the nucleotide sequence, and this motif was also detected in P15. Even though H7 multi-basic cleavage site sequences were not detected in P11 or P17 (possibly due to insufficient sequencing depth in the specific region) it is likely that they were present according to the consistently low MDTs (Fig 1).

Discussion

Deep sequencing technologies have revolutionised studies on viral evolution, and here the emergence of highly pathogenic H5N2 and H7N1 avian influenza viruses from low pathogenic precursors was followed over the course of seventeen serial passages in embryonated chicken eggs. The 14-day egg model is a useful alternative to infecting live birds for studying the LPAI-HPAI conversion/ selection process [14, 19, 21] as well as viral pathogenicity by the embryo mean death times [8]. The H5N2 and H7N1 precursor strains were isolated from commercial ostriches but were not associated with any HPAI outbreaks, and deep sequencing of the stocks used for the experiments confirmed that only LPAIVs were present in the sub-populations. Whereas initially both viruses were avirulent with 100% of the embryos surviving and MDTs of >90 hours, both strains gradually increased in virulence for 14-day old chick embryos as the passages progressed. By P14 100% of the embryos were dead, and by the seventeenth passage the MDTs were markedly shorter at 48 h and 36 h for H5N2 and H7N1 respectively. The progression of pathogenicity in ovo was markedly different for the two viral strains; the H5N2 virus remained avirulent longer than the H7N1 strain since three passages of H5N2 compared to just one of H7N1 virus were required before the embryos started to die. The H7N1 virus also attained high virulence sooner, with 100% mortalities and MDTs of < 60 hours being reached at P10, four passages earlier than the H5N2 virus. The HACS is the key virulence determinant but it is not sufficient for expression of full virulence [42, 43] therefore; we monitored the emergence of molecular markers in the various proteins encoded by the consensus sequences. In the H5N2 virus the combination of emergent V63M, E228V and D272G substitutions in the HA, Q357K in NP and H155P in NA correlated with the increased pathogenicity of H5N2 according to the MDT profile. Most interestingly the E60G substitution in NS1 was also present in H5N2 HPAIVs that emerged from an LPAI precursor in a Mexican poultry outbreak [37]. The viral NS1 protein is a well-known virulence factor that suppresses the host’s innate immunity by preventing host cell mRNA processing, blocking the nuclear export of polyadenylated cellular transcripts and inhibiting type I interferon responses, as well as an inhibitor of adaptive immunity through its various effects on dendritic cells [44]. The combination of R584H and L589I substitutions in PB2, A146T (and possibly Q220E) in HA with D231N in M1 correlated with the increasing MDTs for the H7N1 virus. Overall, the results for these H5N2 and H7N1 strains are consistent with other studies that compared the switch from LPAI to HPAI, whereby between 7 and 68 amino acids are substituted with changes occurring in the HA gene, but also often in the polymerase genes [37]. Apart from E60G substitution in the NS1 of the H5N2 virus, none of the other mutations in H5N2 or H7N1 detected here were present in the H5Nx and H7Nx strains used in other LPAI-HPAI conversion studies, nor are they known to be associated with increased pathogenicity [14, 35, 37], reflecting the complexity of viral pathogenesis outside of the HACS. Deep sequencing enables the study of minority variants at the HACS which otherwise may not be identifiable at the consensus level. Ion Torrent sequencing is known to have a high error rate in base calls in long homopolymer regions [45], but extended homopolymeric regions such as those caused by RNA polymerase slippage were absent from our data. In the H5N2 virus an HACS containing a dibasic amino acid pair adjacent to the peptide cleavage site, PQERRR/GLF, was first detected in P11 and a second motif, PQRERR/GLF, was detected in P15. Even though the intervening passages (P8 to P10) were retrospectively sequenced to pinpoint the emergence of the H5N2 multi-basic HACS in the population, the depth of coverage obtained was too poor for analysis, probably due to degradation of the RNA during prolonged storage. Neither of the aforementioned H5 multi-basic motifs has been reported in nature yet [40, 43]. Two multi-basic HACS motifs, PELPKGKK/GLF and PELPKRRGLF, were detected for the first time in P7 of the H7N1 virus but only the latter has been found in nature thus far, in an H7N9 virus isolated from an outbreak in quails in Japan [40, 41].Thus, Fig 2 summarizes that the increasing virulence of the H5N2 and H7N1 viruses was an accretion of the HA multibasic cleavage sites, other amino acid substitutions in the HA and in some of the other proteins. It was previously hypothesized that an accumulation of multiple basic amino acids at the HACS is the final step required to transform a LPAIV into a HPAIV when the remainder of the viral genome supports a highly pathogenic phenotype [46], which is supported by the results of this study.
Fig 2

Schematic overview of the pathogenicity of H5N2 and H7N1 LPAI viruses, the emergence of potential virulence markers and the detection of multi-basic hemagglutinin cleavage sites (MB HACS) in the viral sub-population after seventeen passages in 14-day old ECEs.

Pink embryos indicate mean death times (MDTs) with 100% survival to 90 h, yellow embryos with dotted lines indicate partial survival and/or MDTs between 60 and 90 hours, and red embryos with solid lines indicate 100% mortality within 60 hours or less. Red genome segments indicate one or more amino acid substitutions in the consensus protein sequence with key amino acid substitutions listed below the figures.

Schematic overview of the pathogenicity of H5N2 and H7N1 LPAI viruses, the emergence of potential virulence markers and the detection of multi-basic hemagglutinin cleavage sites (MB HACS) in the viral sub-population after seventeen passages in 14-day old ECEs.

Pink embryos indicate mean death times (MDTs) with 100% survival to 90 h, yellow embryos with dotted lines indicate partial survival and/or MDTs between 60 and 90 hours, and red embryos with solid lines indicate 100% mortality within 60 hours or less. Red genome segments indicate one or more amino acid substitutions in the consensus protein sequence with key amino acid substitutions listed below the figures. Non-homologous recombination is a rare event in RNA viruses [47], but cases of insertions into the HACS have been reported for H7 strains, with the earliest reports stemming from viruses passaged under experimental conditions. Twelve passages of an H7N3 virus [48] and five passages of an H7N7 virus [49] in chicken embryo cells without the addition of trypsin, led to the insertion in the HACS of a 54 nt insert derived from the 28S rRNA gene or nt 284–343 of the NP, respectively, with both viruses demonstrating an increased pathogenicity in chickens. The first reported field case of non-homologous recombination at the HACS was during an H7N1 outbreak in Italian poultry in 1999, with peptide insertions SRVR and SRMR of unknown origin [50]. The SRVR peptide insertion recurred in an H7N3 outbreak in commercial turkeys in 2002 in the Netherlands. The virus had an increased intravenous pathogenicity index in chickens and the authors speculated that the 12-nt insertion was possibly derived from turkey major histocompatibility complex B locus RNA [51]. In 2002, an HPAI H7N3 emerged in in broiler breeder chickens in Chile, that had a 10 aa insert at the HACS corresponding to nt 1268–1297 of the NP gene [11]. An H7N3 virus with increased pathogenicity that caused an epidemic in chicken broiler breeder farms, in 2004 in British Columbia, Canada was found to have a 21 insert of nucleotides 737 to 757 of the M1 gene [52], and another H7N3 HPAI virus in 2007 with increased mortality in 24-week roosters, Saskatchewan, Canada had an HACS insert of TKPRPR of undetermined origin. Yet another H7N3 HPAI virus caused poultry farm outbreaks in Jalisco State, Mexico, and that strain had an 8-amino acid insertion of host 28S rRNA at the HACS [53]. Non-homologous recombination was not detected in the H7N1 virus used in the present study at any passage, however, in the H5N2 virus a 13 nt insert of unknown origin was detected at P6. More significantly, in P17 a 42-nt insert encoding the peptide RESRNPGNAEIED appeared to be derived from nucleotides 729 to 776 of the NP gene. This is the first report of non-homologous recombination in the HACS of an H5 virus. Most multi-basic cleavage sites in H5 and H7 viruses in nature contain stretches of between 5 and 8 basic amino acids, and a higher number of basic amino acids correlates with increased pathogenicity [37, 43]. The mechanism of extension of the HACS has only been studied for H5 viruses thus far, entailing the slippage of the viral RNA-dependent RNA polymerase complex, preceded by random point mutations that destabilize the RNA secondary structure adjacent to the HACS [9, 10]. Furthermore, there seems to be a selection bias towards longer multibasic insertions, where mid-length pHACS are rapidly replaced by extended forms [9, 54]. We did not observe any progressive extension of the HACS caused by polymerase slippage as the passages progressed, but seventeen passages may have been insufficient to generate these from a native LPAI progenitor. Most other experimental trials that investigated the conversion of LPAI to HPAI in vitro, in vivo or in ovo used LPAI precursor viruses that were isolated prior to HPAI emergence in the flock, therefore it’s difficult to exclude the possibility of the selection of minority HPAI variants already present in the field isolate [14, 37, 50]. This study has provided further insight into how HPAI viruses emerge from low pathogenic precursors but it also demonstrated the pathogenic potential of H5N2 and H7N1 strains that have not yet been implicated in HPAI outbreaks.

Ion Torrent sequencing results and read coverage for the H5N2 genome.

Genes encoded within each segment are in italics; nt: nucleotides. (DOCX) Click here for additional data file.

Ion Torrent sequencing results and read coverage for the H7N1 genome.

Genes encoded within each segment are in italics; nt: nucleotides. (DOCX) Click here for additional data file.

Variants detected at the hemagglutinin cleavage site (HA0) of H5N2 low pathogenic avian influenza viruses passaged in 14-day old embryonated chicken eggs.

#Insertions, deletions and substitutions in relation to the conventional low pathogenic sequence‡ are underlined; stop codons are indicated by “*”. †In-frame HA2 [] total number of variants: total number of HACS reads ratio. (DOCX) Click here for additional data file.

Variants detected at the hemagglutinin cleavage site (HA0) of H7N1 low pathogenic avian influenza viruses passaged in 14-day old embryonated chicken eggs.

#Insertions, deletions and substitutions in relation to the conventional low pathogenic sequence‡ are underlined; stop codons are indicated by “*”. †In-frame HA2. [] total number of variants: total number of HACS read ratio. (DOCX) Click here for additional data file. 5 Aug 2020 PONE-D-20-15349 Emergence of highly pathogenic H5N2 and H7N1 influenza A viruses from low pathogenic precursors by serial passage in ovo PLOS ONE Dear Dr. Abolnik, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please consider carefully comments of reviewer 1, in particular the ones related to the statistical analysis. It seems that probably some technical terms were misused and to the organization of the result and discussion sections. Please submit your revised manuscript by Sep 19 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Maria Serena Beato Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. We noted in your submission details that a portion of your manuscript may have been presented or published elsewhere. "Some of the results were published in the PhD dissertation of Dr A.T Laleye (University of Pretoria, 2018)." Please clarify whether this publication was peer-reviewed and formally published. If this work was previously peer-reviewed and published, in the cover letter please provide the reason that this work does not constitute dual publication and should be included in the current manuscript. 3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide. 4. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data. 5. Please include a separate caption for each figure in your manuscript. 6. Please upload a copy of Figures 2 and 3, to which you refer in your text on pages 17 and 21. If the figure is no longer to be included as part of the submission please remove all reference to it within the text. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No Reviewer #2: N/A ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In the manuscript “Emergence of highly pathogenic H5N2 and H7N1 influenza A viruses from low pathogenic precursors by serial passage in ovo”, the authors used embryonated eggs to serially passage two low pathogenic avian influenza viruses to study the evolution of the phenotype towards a highly pathogenic one, and to correlate the phenotype with substitution appearing in the genome. The manuscript is well written and the study design is rigorous. The work performed is original in the way the substitutions at the cleavage site were studied. Extracting the reads of Next-Generation Sequencing that specifically cover the cleavage site in the heamagglutinin is a nice approach that required probably a huge analytical work. Introduction Line 62: the canonical LPAI cleavage motif could be given here to illustrate the positions of the basic amino acids. Lines 101-107: Are these lines useful in the introduction? Aim of paper is not to explain why 14-day embryos are more susceptive to HPAI selection. Lines 129-133: This might fit better in either the discussion or the introduction. Line 142: Rephrase. Mean death times were calculated, but ‘dead’ or ‘alive’ was recorded daily. Line 150: This change in the protocol is not discussed or explained anywhere in the manuscript. Is it linked to Lines 101-107? Line 199: Table 1 is giving nucleotide sequences, so it is confusing to see only analyses on amino-acids mentioned. Was any analysis at the nucleotide level performed? Any interesting synonymous substitutions in addition to the non-synonymous, for example in the non-coding regions? This could perhaps be mentioned in the discussion? Results Table 2: Maybe transform into figures that might be better for a clearer visualization of the number of positive (out of tested) and MDT? Generally speaking, there are a lot of discussion elements in the results. Do the authors consider the description of identified mutations by other studies or in samples elsewhere as results or discussion? Line 282: P11? There is no P10 in table 3. Clarify. In addition, was any sequencing of intermediate passages (between 7 and 11) performed for these mutations? Was I464N found as a difference with the inoculum? Can H150P be considered as a replacement of I464N. From page 15, there is no line numbering For H7N1, same comment as for H5N2: elements of discussion are given with the results. P15 L6: ‘in PB1’ should be mentioned along the 2 substitutions when first mentioned. “A146T emerged between P8 and P15”: where does this come from? It should be clearer how this data was obtained as it is not presented in Table 4. It seems that, for HA paragraph, the authors took into account the “quasispecies” to evaluate when the substitution appeared. It should be clearer in the text and table 4. For M1, not clear. Only one substitution mentioned in table 4. Table S3 and similar: indication of frameshift with amino-acid consequences in the cleavage site. But what about full length HA: truncated forms in addition to changes in cleavage site? What does it mean “in frame HA2”? Does it mean that for the other variants, this is not the case? Clarify. In the text, highlight (underline or bold) also the differences in the cleavage sites to facilitate the reader’s understanding. Data of this cleavage site analysis should be synthesized in a clearer manner as it is not easy to follow the proportions of the variants over passages. These proportions should be given in the text. This is what makes a variant potentially relevant. See also comments over the Discussion, as this needs to be discussed in light of the Ion Torrent error rate. Discussion: Lines 9-10: deep sequencing on original sample or of the stock used for the experiments reported in this manuscript (passage 3 in 9-10 d old embryonated eggs)? Line 13: significantly? There are no statistic test results. Lines 21-22: “markers in the proteins encoded by the consensus sequences” is not clear. For the identified mutations: have they been tested alone or in combination using reverse genetics to study their impact? This could be mentioned and discussed. The results of the cleavage site analysis should be discussed in light with the level of error rate of Ion Torrent. Which proportion of a variant was taken as “true”? When there are only very few reads concerned with a substitution/deletion, is it relevant? This should be discussed. The authors should try to find a way to summarize the finding of a figure. They talk about correlation between substitutions and pathogenicity, but Figure 1 comes too late and does not present the specific mutations that the authors suggest as marker of pathogenicity. Conclusions might need to be slightly amended based of analysis of proportions and taking into account error rate of technique. Reviewer #2: Thank you for allowing me to review the paper by Abolnik and colleague entitled "Emergence of highly pathogenic H5N2 and H7N1 influenza A viruses from low pathogenic precursors by serial passage in ovo". The authors present data on H5N2 and H7N1 LPAI naturally occurring influenza viruses in ostrich; and serially passaged these isolates in eggs to force emergence of mutations that correlated with higher pathogenicity. A few comments: Around passage 8-9 for both viruses (Table 2) seems to be a switch of phenotype for both viruses, as all embryos were dying up to passage 7 but then switches to 100% live and an increase on mean death time (MDT), is there an explanation for this? May be include a brief comment or explanation. Could it be protocol related? Text needs some formatting: for example, line numbering stops in page 13 and start again in the discussion section, also it is confusing to find figure 1 legend in the middle of the discussion section (page 28). Overall the paper gives clear results and interesting observations without overstating their findings. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 10 Sep 2020 PONE-D-20-15349 Response to Reviewers’ comments Reviewer #1 In the manuscript “Emergence of highly pathogenic H5N2 and H7N1 influenza A viruses from low pathogenic precursors by serial passage in ovo”, the authors used embryonated eggs to serially passage two low pathogenic avian influenza viruses to study the evolution of the phenotype towards a highly pathogenic one, and to correlate the phenotype with substitution appearing in the genome. The manuscript is well written and the study design is rigorous. The work performed is original in the way the substitutions at the cleavage site were studied. Extracting the reads of Next-Generation Sequencing that specifically cover the cleavage site in the heamagglutinin is a nice approach that required probably a huge analytical work. INTRODUCTION Line 62: the canonical LPAI cleavage motif could be given here to illustrate the positions of the basic amino acids. Line 62 was modified to “Typical LPAI viruses contain the HA0 motifs PQRETR/GLF for H5 or PELPKGK/GLF for H7, i.e. single or non-consecutive basic amino acids (R or K) adjacent to the cleavage site” Lines 101-107: Are these lines useful in the introduction? Aim of paper is not to explain why 14-day embryos are more susceptive to HPAI selection. The paragraph was included to facilitate the reader’s understanding of the choice of 14-day old embryonated eggs for the study. No change made. Lines 129-133: This might fit better in either the discussion or the introduction. The text was moved to the Introduction as suggested Line 142: Rephrase. Mean death times were calculated, but ‘dead’ or ‘alive’ was recorded daily. Line 142 was rephrased as suggested Line 150: This change in the protocol is not discussed or explained anywhere in the manuscript. Is it linked to Lines 101-107? Yes. To clarify this the sentence was modified as follows: “Passages 1 to 7 were performed using only the aspirated AFs but, to ensure the broadest possible representation of the viral population within the embryo, from passage eight onwards the whole embryos were harvested along with the AF…” Line 199: Table 1 is giving nucleotide sequences, so it is confusing to see only analyses on amino-acids mentioned. Was any analysis at the nucleotide level performed? Any interesting synonymous substitutions in addition to the non-synonymous, for example in the non-coding regions? This could perhaps be mentioned in the discussion? Table 1 details the various modified sequence tags (MSTs) we used to retrieve the HA0-spanning regions (subsequently translated to amino acids), and the canonical amino acid sequence is provided for reference. No, we did not analyze the synonymous substitutions due to the sheer volume of the data we generated. No changes made. RESULTS Table 2: Maybe transform into figures that might be better for a clearer visualization of the number of positive (out of tested) and MDT? Table 2 was converted to a figure (Figure 1) as suggested. Table and figure numbers were adjusted accordingly throughout the manuscript. Generally speaking, there are a lot of discussion elements in the results. Do the authors consider the description of identified mutations by other studies or in samples elsewhere as results or discussion? Yes we did consider it and after various drafts of the manuscript we decided that the present format was the most clear and concise for readers. No changes made. Line 282: P11? There is no P10 in table 3. Clarify. In addition, was any sequencing of intermediate passages (between 7 and 11) performed for these mutations? Was I464N found as a difference with the inoculum? Can H150P be considered as a replacement of I464N. The typing error has been addressed; P10 was corrected to P11 in Table 3 (renamed as Table 2). H150P is also a typing error; it was corrected to H155P in the table and text. It might be possible that H155P is a compensation for I4464N, but functional studies would be required to verify this. From page 15, there is no line numbering Corrected in the revised version. For H7N1, same comment as for H5N2: elements of discussion are given with the results As above, the discussion points in the Results section are pertinent to the specific mutations we observed, and to remove them here and incorporate into the Discussion would mean the reader is constantly paging back and forth in reference to the tables. The Discussion would then be extremely long and verbose, whereas the Results section would contain only the tables. We would like to retain the manuscript in its present format as this makes it the easiest for the reader to follow. P15 L6: ‘in PB1’ should be mentioned along the 2 substitutions when first mentioned. Changed as suggested. “A146T emerged between P8 and P15”: where does this come from? It should be clearer how this data was obtained as it is not presented in Table 4. It seems that, for HA paragraph, the authors took into account the “quasispecies” to evaluate when the substitution appeared. It should be clearer in the text and table 4. A146T was/is presented in Table 4 (now Table 3), no change made. For M1, not clear. Only one substitution mentioned in table 4. The only substitution (D231N) observed at consensus level in the M1 is the one presented in the Table 4 (now Table 3), no change made. Table S3 and similar: indication of frameshift with amino-acid consequences in the cleavage site. But what about full length HA: truncated forms in addition to changes in cleavage site? What does it mean “in frame HA2”? Does it mean that for the other variants, this is not the case? Clarify. The sequences presented here covers only the cleavage site of the HA and not the entire HA protein. Typically, the HACS starts with proline-encoding codon and terminates in Phenylalanine-encoding codon. As we indicated in Table S3, insertions or deletions can cause +1 or +2 frameshifts in the open reading frame (ORF) of the HA2 gene, leading to truncation of the protein. Sequences that produce the correct ORF are said to be “in-frame”. The latter is a widely-used term. No changes made. In the text, highlight (underline or bold) also the differences in the cleavage sites to facilitate the reader’s understanding. The differences in the HACS sequences for both H5 and H7 are now underlined in the text with “(variation underlined)” added Data of this cleavage site analysis should be synthesized in a clearer manner as it is not easy to follow the proportions of the variants over passages. These proportions should be given in the text. This is what makes a variant potentially relevant. See also comments over the Discussion, as this needs to be discussed in light of the Ion Torrent error rate. This manuscript represents the analysis of a massive amount of data and a lot of thought was given to what the best way would be to make it concise and interesting to a reader, yet avoid the pitfalls of over-interpretation. The proportions of the variants between passages (including those in the HACs) will be directly related to the depth of coverage we obtained for each segment (Tables S1 and S2) as well as the depth of coverage of the reads in specific regions of the segment that tends to be highly variable (data not shown). In some cases the coverage was very low, and this would certainly cause problems in assigning relevance to the proportions of variants. Therefore, to avoid over-interpreting the data, we focused on the cumulative effects of the mutations, and only when a variant emerged in the consensus genome was it flagged as being potentially relevant. We have made all the raw sequence data publically available should follow-up studies be of interest to anyone. DISCUSSION Lines 9-10: deep sequencing on original sample or of the stock used for the experiments reported in this manuscript (passage 3 in 9-10 d old embryonated eggs)? Both, although on the originals stocks the aligned HACs was only examined visually in the CLC Genomics Workbench (not results of this study). For clarification the sentence was modified to “…and deep sequencing of the stocks used for the experiments confirmed that only LPAIVs were present in the sub-populations.” Line 13: significantly? There are no statistic test results. “significantly” was replaced with “markedly” Lines 21-22: “markers in the proteins encoded by the consensus sequences” is not clear. This refers to mutations in viral proteins other than the HA. To clarify this, the text was rephrased to read “molecular markers in the various proteins encoded by the consensus sequences” For the identified mutations: have they been tested alone or in combination using reverse genetics to study their impact? This could be mentioned and discussed. No study has been carried out to determine the impact of the novel mutations observed. However, this could be carried out in the future as was recommended in parts of the discussion The results of the cleavage site analysis should be discussed in light with the level of error rate of Ion Torrent. Which proportion of a variant was taken as “true”? When there are only very few reads concerned with a substitution/deletion, is it relevant? This should be discussed. A high Phred cutoff score (20) was applied to filter reads prior to analysis (as per the Materials and Methods section). We also stated in the manuscript that the variants we detected were probably an underrepresentation of what was present in the population. The following was added to the discussion: “Ion Torrent sequencing is known to have a high error rate in base calls in long homopolymer regions (45), but extended homopolymeric regions such as those caused by RNA polymerase slippage were absent from our data. The reference list was updated with Besser et al., 2018. The authors should try to find a way to summarize the finding of a figure. They talk about correlation between substitutions and pathogenicity, but Figure 1 comes too late and does not present the specific mutations that the authors suggest as marker of pathogenicity. The figure (renamed as Fig. 2) has been modified to list the key amino acid substitutions from Tables 2 and 3 on it. Conclusions might need to be slightly amended based of analysis of proportions and taking into account error rate of technique. Addressed in previous comments Reviewer #2 Thank you for allowing me to review the paper by Abolnik and colleague entitled "Emergence of highly pathogenic H5N2 and H7N1 influenza A viruses from low pathogenic precursors by serial passage in ovo". The authors present data on H5N2 and H7N1 LPAI naturally occurring influenza viruses in ostrich; and serially passaged these isolates in eggs to force emergence of mutations that correlated with higher pathogenicity. A few comments: Around passage 8-9 for both viruses (Table 2) seems to be a switch of phenotype for both viruses, as all embryos were dying up to passage 7 but then switches to 100% live and an increase on mean death time (MDT), is there an explanation for this? May be include a brief comment or explanation. Could it be protocol related? Yes the reviewer is correct, we did notice this and the following text was added to provide an explanation: “The percentage of live embryos and the MDTs had been decreasing up until passage 7, but in passage 8 the phenotype of both viruses changed with an increase in the percentage of live embryos and MDTs of >90 hours. The only change in the protocol was that stocks were frozen at -80�C during a University recess; this likely caused a slight drop in the viability of the viruses in passage 8, causing the delayed embryo deaths.” Text needs some formatting: for example, line numbering stops in page 13 and start again in the discussion section, also it is confusing to find figure 1 legend in the middle of the discussion section (page 28). Line numbers were included through the length of the original manuscript uploaded, some formatting might have been lost due to different versions of Microsoft office. This is now corrected. Overall the paper gives clear results and interesting observations without overstating their findings. Thank you. Submitted filename: Response to Reviewers.docx Click here for additional data file. 24 Sep 2020 Emergence of highly pathogenic H5N2 and H7N1 influenza A viruses from low pathogenic precursors by serial passage in ovo PONE-D-20-15349R1 Dear Dr. Abolnik, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Camille Lebarbenchon Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: (No Response) ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: N/A ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The new Figure 1 is still in fact a table. If a true figure is not made, then go back to a true table that is formatted according to the journal requirements Table 3: I am still confused by A146T. It is indeed presented in table 3, but only at P15 and P17. But the text still states that it was detected from P8. So why is A146T also indicated for P11 in table 3? I still think that there is too much discussion in the results. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No 28 Sep 2020 PONE-D-20-15349R1 Emergence of highly pathogenic H5N2 and H7N1 influenza A viruses from low pathogenic precursors by serial passage in ovo Dear Dr. Abolnik: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Camille Lebarbenchon Academic Editor PLOS ONE
  44 in total

1.  Nonhomologous recombination between the hemagglutinin gene and the nucleoprotein gene of an influenza virus.

Authors:  M Orlich; H Gottwald; R Rott
Journal:  Virology       Date:  1994-10       Impact factor: 3.616

2.  Susceptibility and Status of Avian Influenza in Ostriches.

Authors:  Celia Abolnik; Adriaan Olivier; Chevonne Reynolds; Dominic Henry; Graeme Cumming; Dionne Rauff; Marco Romito; Deryn Petty; Claudia Falch
Journal:  Avian Dis       Date:  2016-05       Impact factor: 1.577

3.  Assessing potential pathogenicity of avian influenza virus: current and experimental system.

Authors:  C W Lee; Y J Lee; D Swayne; D Senne; D J Linares; D Suarez
Journal:  Avian Dis       Date:  2007-03       Impact factor: 1.577

4.  Development of real-time RT-PCR for the detection of avian influenza virus.

Authors:  E Spackman; D A Senne; L L Bulaga; T J Myers; M L Perdue; L P Garber; K Lohman; L T Daum; D L Suarez
Journal:  Avian Dis       Date:  2003       Impact factor: 1.577

5.  Molecular changes in virulent mutants arising from avirulent avian influenza viruses during replication in 14-day-old embryonated eggs.

Authors:  T Horimoto; Y Kawaoka
Journal:  Virology       Date:  1995-01-10       Impact factor: 3.616

Review 6.  Molecular pathogenesis of H5 highly pathogenic avian influenza: the role of the haemagglutinin cleavage site motif.

Authors:  Jasmina M Luczo; John Stambas; Peter A Durr; Wojtek P Michalski; John Bingham
Journal:  Rev Med Virol       Date:  2015-10-15       Impact factor: 6.989

7.  Hemagglutinin activation of pathogenic avian influenza viruses of serotype H7 requires the protease recognition motif R-X-K/R-R.

Authors:  M Vey; M Orlich; S Adler; H D Klenk; R Rott; W Garten
Journal:  Virology       Date:  1992-05       Impact factor: 3.616

8.  The surface glycoproteins of H5 influenza viruses isolated from humans, chickens, and wild aquatic birds have distinguishable properties.

Authors:  M Matrosovich; N Zhou; Y Kawaoka; R Webster
Journal:  J Virol       Date:  1999-02       Impact factor: 5.103

9.  H5N1 outbreaks and enzootic influenza.

Authors:  Robert G Webster; Malik Peiris; Honglin Chen; Yi Guan
Journal:  Emerg Infect Dis       Date:  2006-01       Impact factor: 6.883

10.  MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization.

Authors:  Kazutaka Katoh; John Rozewicki; Kazunori D Yamada
Journal:  Brief Bioinform       Date:  2019-07-19       Impact factor: 11.622
View more
  7 in total

1.  Evidence for Different Virulence Determinants and Host Response after Infection of Turkeys and Chickens with Highly Pathogenic H7N1 Avian Influenza Virus.

Authors:  Claudia Blaurock; Elsayed M Abdelwhab; Florian Pfaff; David Scheibner; Bernd Hoffmann; Alice Fusaro; Isabella Monne; Thomas C Mettenleiter; Angele Breithaupt
Journal:  J Virol       Date:  2022-08-22       Impact factor: 6.549

2.  Evolutionary Dynamics of Mexican Lineage H5N2 Avian Influenza Viruses.

Authors:  Wanhong Xu; Roberto Navarro-López; Mario Solis-Hernandez; Francisco Liljehult-Fuentes; Miguel Molina-Montiel; María Lagunas-Ayala; Marisol Rocha-Martinez; Eduardo Ferrara-Tijera; Juan Pérez de la Rosa; Yohannes Berhane
Journal:  Viruses       Date:  2022-05-03       Impact factor: 5.818

3.  Insertions of codons encoding basic amino acids in H7 hemagglutinins of influenza A viruses occur by recombination with RNA at hotspots near snoRNA binding sites.

Authors:  Alexander P Gultyaev; Monique I Spronken; Mathis Funk; Ron A M Fouchier; Mathilde Richard
Journal:  RNA       Date:  2020-11-13       Impact factor: 4.942

4.  Host Manipulation Mechanisms of SARS-CoV-2.

Authors:  Steven E Massey
Journal:  Acta Biotheor       Date:  2021-12-13       Impact factor: 1.185

5.  Phylodynamic study of the conserved RNA structure encompassing the hemagglutinin cleavage site encoding region of H5 and H7 low pathogenic avian influenza viruses.

Authors:  Gabriel Dupré; Claire Hoede; Thomas Figueroa; Pierre Bessière; Stéphane Bertagnoli; Mariette Ducatez; Christine Gaspin; Romain Volmer
Journal:  Virus Evol       Date:  2021-11-01

Review 6.  Hemagglutinin Subtype Specificity and Mechanisms of Highly Pathogenic Avian Influenza Virus Genesis.

Authors:  Anja C M de Bruin; Mathis Funk; Monique I Spronken; Alexander P Gultyaev; Ron A M Fouchier; Mathilde Richard
Journal:  Viruses       Date:  2022-07-19       Impact factor: 5.818

Review 7.  High-throughput sequencing technologies in the detection of livestock pathogens, diagnosis, and zoonotic surveillance.

Authors:  Godagama Gamaarachchige Dinesh Suminda; Srishti Bhandari; Yoonkyung Won; Umesh Goutam; Krishna Kanth Pulicherla; Young-Ok Son; Mrinmoy Ghosh
Journal:  Comput Struct Biotechnol J       Date:  2022-09-26       Impact factor: 6.155
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.