Trypanosomatid selenophosphate synthetase structure, function and interaction with selenocysteine lyase.

Eukaryotes from the Excavata superphylum have been used as models to study the evolution of cellular molecular processes. Strikingly, human parasites of the Trypanosomatidae family (T. brucei, T. cruzi and L. major) conserve the complex machinery responsible for selenocysteine biosynthesis and incorporation in selenoproteins (SELENOK/SelK, SELENOT/SelT and SELENOTryp/SelTryp), although these proteins do not seem to be essential for parasite viability under laboratory controlled conditions. Selenophosphate synthetase (SEPHS/SPS) plays an indispensable role in selenium metabolism, being responsible for catalyzing the formation of selenophosphate, the biological selenium donor for selenocysteine synthesis. We solved the crystal structure of the L. major selenophosphate synthetase and confirmed that its dimeric organization is functionally important throughout the domains of life. We also demonstrated its interaction with selenocysteine lyase (SCLY) and showed that it is not present in other stable assemblies involved in the selenocysteine pathway, namely the phosphoseryl-tRNASec kinase (PSTK)-Sec-tRNASec synthase (SEPSECS) complex and the tRNASec-specific elongation factor (eEFSec) complex. Endoplasmic reticulum stress with dithiothreitol (DTT) or tunicamycin upon selenophosphate synthetase ablation in procyclic T. brucei cells led to a growth defect. On the other hand, only DTT presented a negative effect in bloodstream T. brucei expressing selenophosphate synthetase-RNAi. Furthermore, selenoprotein T (SELENOT) was dispensable for both forms of the parasite. Together, our data suggest a role for the T. brucei selenophosphate synthetase in the regulation of the parasite's ER stress response.

Introduction

pan class="Species">Trypanosoma brucei, Trypanosoma cruzi and Leishmania sp. protist parasites [1] are collectively responsible for thousands of productive life years lost worldwide, as a consequence of human sleeping sickness [2], Chagas’ disease [3], and leishmaniasis [4], respectively. They cycle between an insect vector and a mammalian host, progressing through different life-cycle stages with varying metabolism, cell morphology and surface architecture. Adverse environmental conditions such as nutrient deficiency, hypoxia, oxidative stress, pH and temperature variation occur throughout their life cycle [5]. Trypanosomatids depend on dynamic gene expression to regulate their adaptation to stress, differentiation and proliferation, in response to diverse environmental signals within different hosts [5,6]. Interestingly, gene expression is controlled post-transcriptionally by spliced leader (SL) trans-splicing, RNA editing and mRNA stability [6].

In their life cycle, these parasites are exposed to n class="Chemical">reactive oxygen species that are controlled by a unique thiol-redox system based on trypanothione reductase, tryparedoxin and tryparedoxin peroxidase [7,8,9]. In contrast, the main redox regulatory enzymes in mammals are thioredoxin and gluthatione reductases, which contain the L-selenocysteine (Sec) residue in the active site [10]. Remarkably, only three selenoproteins, namely SELENOK, SELENOT and SELENOTryp, have been reported in trypanosomatids to contain Sec-based putative redox centers, as confirmed by 75Se-labeled homologs from T. brucei [11], T. cruzi [12] and L. donovani [13]. Selenocysteine biosynthesis and incorporation into selenoproteins require an intricate molecular machinery that is present, but not ubiquitous, in all domains of life [14]. In eukaryotes [14,15,16] it begins with tRNA[Ser]Sec acylation with L-serine by the seryl-tRNA synthetase (SerRS) followed by its conversion to Sec-tRNA[Ser]Sec, sequentially catalyzed by phosphoseryl-tRNASec kinase (PSTK) and Sec-tRNA[Ser]Sec synthase (SEPSECS). Selenophosphate synthetase (SEPHS) is a key enzyme in the Sec pathway, being responsible for catalyzing the formation of the active selenium donor for this reaction, selenophosphate, from selenide and ATP. Finally, a tRNASec-specific elongation factor (eEFSec) directs the Sec-tRNA[Ser]Sec molecule to the ribosome in response to an UGASec codon, in the presence of a Sec insertion sequence (SECIS) in the mRNA. However, details of the protein-protein and protein-RNA interaction network and the mechanism of selenoprotein biosynthesis and its regulation in trypanosomatids remain poorly understood [12,17].

Furthermore, little is known about pan class="Chemical">selenium metabolism itself in trypanosomatids [17]. It has been reported that selenium in trace amounts is essential for several organisms throughout several domains of life, although at high concentration it is cytotoxic [17,18]. Selenocysteine is specifically decomposed by selenocysteine lyase (SCLY) into L-alanine and selenide, which is potentially reused by selenophosphate synthetase in several eukaryotes, including trypanosomatids [19,20,21]. Mammals conserve two paralogues of selenophosphate synthetase, namely SEPHS1 and SEPHS2. Mammalian SEPHS2 is itself a selenoprotein known to be essential for selenophosphate formation and consequently selenoprotein biosynthesis. In contrast, the SPS1 isoform (SEPHS1) does not conserve a cysteine or selenocysteine residue in the catalytic site and is likely involved in redox homeostasis regulation [22,23,24]. Strikingly, the cellular availability of hydrogen peroxide is altered by SEPHS1 deficiency in embryonic mammalian cells [25]. Our group previously showed that trypanosomatids conserve only one selenophosphate synthetase, SEPHS2 (SPS2), containing a catalytic cysteine [26]. Its function has been related to selenoprotein synthesis [11].

Not only pan class="Species">T. brucei SEPHS2 (TbSEPHS2) but also PSTK, SEPSECS and eEFSec (TbPSTK, TbSEPSECS and TbeEFSec, respectively) [11] independent knockdowns impair selenoprotein synthesis in the parasite procyclic form (PCF). Interestingly, TbPSTK and TbSEPSECS double-knockout cell lines demonstrated that T. brucei PCF does not depend on selenoproteins [11]. This result was extended with the observation that TbSEPSECS is not essential for normal growth of the bloodstream form (BSF) T. brucei [27] and its survival in the mammalian host [28]. In addition, a TbSEPSECS knockout cell line did not show any growth disruption upon hydrogen peroxide-induced oxidative stress in PCF [27]. This result also seems to be valid for other trypanosomatids, since L. donovani SEPSECS null mutant promastigote (LdSEPSECS) cell lines show normal growth even upon oxidative stress, and during macrophage infection [13]. On the other hand, TbSEPHS2 RNAi PCF and BSF T. brucei cells are sensitive to oxidative stress induced by hydrogen peroxide [29]. The reason why trypanosomatids maintain such complex machinery for selenoprotein biosynthesis remains unclear.

Moreover, the function of Kinetoplastea n class="Gene">selenoproteins has not been elucidated yet. Interestingly, T. brucei PCF and BSF are sensitive to nanomolar concentrations of auranofin [12,17], an inhibitor of mammalian selenoprotein biosynthesis. Nonetheless, auranofin did not show any differential effect on TbSEPSECS knockout lines, when compared to the wild type T. brucei PCF [27] or the counterpart L. donovani amastigote [13]. SELENOTryp (SelTryp) is a novel selenoprotein exclusive to trypanosomatids that contains a conserved C-terminal redox motif, often found in selenoproteins that carry out redox reactions through the reversible formation of a selenenylsulfide bond [12]. On the other hand, mammalian SELENOK/SelK [30] and SELENOT/SelT [31] homologs were recently shown to be endoplasmic reticulum (ER) residents, where they have a role in regulating Ca2+ homeostasis. Regulation of ER redox circuits control homeostasis and survival of cells with intense metabolic activity [30,31]. Chemical induction of ER stress with DTT and tunicamycin in PCF T. brucei, but not BSF [32] apparently results in ER expansion and elevation in the ER chaperone BiP, inducing the unfolded protein response (UPR) [33,34,35]. Prolonged ER stress induces the spliced leader RNA silencing (SLS) pathway [34]. Induction of SLS, either by prolonged ER stress or silencing of the genes associated with the ER membrane that function in ER protein translocation, lead to programmed cell death (PCD). This result is evident by the surface exposure of phosphatidyl serine, DNA laddering, increase in ROS production and cytoplasmic Ca2+, and decrease of mitochondrial membrane potential [34].

Despite the wealth of information on the pan class="Chemical">selenocysteine machinery in eukaryotes, selenoprotein biosynthesis and function in the superphylum Excavata remain poorly understood. Here, we present a detailed structural, biochemical and functional analysis of trypanosomatid selenophosphate synthetase (TbSEPHS2). The TbSEPHS2 crystal structure demonstrates that a conserved aminoimidazole ribonucleotide synthetase (AIRS)-like fold is important for its function. We also show that TbSEPHS2 interacts with T. brucei selenocysteine lyase (TbSCLY) in vitro and that they co-purify from procyclic T. brucei cell extracts. We further demonstrate that the TbSEPHS2-SCLY binary complex is not part of other stable complexes in the Sec-pathway of T. brucei, namely the TbSEPSECS-tRNA[Ser]Sec-PSTK complex and the TbEFSec-tRNA[Ser]Sec complex. We also determined that TbSEPHS2 ablation in procyclic T. brucei cells leads to growth defect in the presence of the ER stressors DTT or tunicamycin while only DTT showed a negative effect in bloodstream cells. Also, SELENOT was found to be dispensable for both PCF and BSF T. brucei. Together, our data shed light into the protein assemblies involved in the selenocysteine pathway in T. brucei and suggest a possible role for the T. brucei selenophosphate synthetase in regulation of the parasite’s ER stress response.

Results

The L. major selenophosphate synthetase crystal structure is highly similar to its orthologs, despite sharing low amino acid sequence identity

pan class="Species">T. brucei and L. major selenophosphate synthetases SEPHS2 isoforms have low sequence identity to the well characterized orthologs from Homo sapiens, Aquifex aeolicus and Escherichia coli (42%, 29% and 28%, respectively) (S1 Fig). We described the crystallization of TbSEPHS2 and ΔN(69)-LmSEPHS2 elsewhere [36]. The full-length TbSEPHS2 structure determination was not successful due to lack of sufficient experimental data, and the full-length LmSEPHS2 was recalcitrant to crystallization. Here we present the crystal structure of ΔN-LmSEPHS2 (PDB 5L16) at 1.9 Å resolution solved by molecular replacement using human SEPHS1 (PDB 3FD5) as a search model. The structure was refined to Rfree/Rwork of 0.21/0.17 (detailed refinement statistics are shown in Table 1).

Table 1

ΔN-LmSEPHS2 crystal structure refinement statistics.

Refinement	ΔN-LmSEPHS2
PDB code	5L16
Refinement program	REFMAC 5.8.0135
Total number of atoms	2,736
Number of amino acid residues	323
Number of solvent atoms	293
Ligand	1 molecule of sulfate ion
Resolution range (Å) (completeness)	1.882–40.845 (96.1%)
Reflections used in refinement (in cross validation, random)	33,411 (5%)
Rwork/Rfree	0.1732/0.2131
Fo, Fc correlation	0.95
B-factors (Å2)
All atoms	27.3
Protein atoms	18.0
Ligand atoms	46.5
Water	52.5
R.M.S.D
Bond lengths (Å)	0.006
Bond angles (o)	1.018
Ramachandran plot (%)
Favored regions	98.8
Allowed regions	99.7
Outliers	0.3
MolProbity
Clashscore	2.46
MolProbity score	1.31

ΔN-pan class="Chemical">LmSEPHS2 crystallized as a monomer in the asymmetric unit showing a typical aminoimidazole ribonucleotide synthetase (AIRS)-like fold [37], which consists of two α+β domains labeled N- and C-terminal AIRS (AIRS and AIRS_C, respectively) ranging from amino acid residues 74 to 190 and 204 to 384, respectively. The N-terminal AIRS domain folds into a six-stranded β-sheet flanked by two α-helices and one 310-helix, while the AIRS_C domain also presents a six-stranded β-sheet that is flanked by seven α-helices and one 310-helix (Fig 1A). Overall, the ΔN-LmSEPHS2 monomer is highly similar to its orthologs, as revealed by the root mean square (R.M.S.D.) deviation of main-chain atomic positions between 0.7 Å and 2.2 Å when ΔN-LmSEPHS2 is compared to H. sapiens SEPHS1 [22] (0.7 Å and 0.8 Å for PDBs 3FD5 and 3FD6, respectively), A. aeolicus SEPHS [38] (1.0 Å for PDBs 2ZAU, 2ZOD and 2YYE) and E. coli SEPHS (SelD) [39] (2.2 Å for PDB 3UO0) monomers, respectively (Fig 1B). The main differences occur in loops that are longer in LmSEPHS. Our finding that the AIRS fold of selenophosphate synthetase is also conserved in our L. major crystal structure suggests its necessity for the enzyme mechanism.

Fig 1

ΔN-LmSEPHS2 crystal structure.

A- Cartoon representation of the monomer structure in the asymmetric unit showing a typical AIRS-like folding. The sulfate ion is represented as sticks. B- Superimposition of AaSEPHS (grey) [38], EcSEPHS (green) [39], HsSEPHS1 (light blue) [22] and LmSEPHS2 (purple). C- Dimeric model generated using PDBePISA [40] depicting amino acid residue conservation. D- Native gel electrophoresis showing the prevalence of dimers in solution for T. brucei (Tb) and L. major (Lm) selenophosphate synthetases at 2 mg/mL. A small amount of tetramers is also observed for both protein preparations (top bands). MW: molecular weight. E- Sedimentation coefficient distribution (S) at increasing protein concentration normalized to the most abundant oligomer (dimer) obtained by sedimentation velocity analytical ultracentrifugation (SV-AUC). The inset displays sedimentation coefficients measured for dimers at increasing total protein concentration. F- Measured and theoretical sedimentation coefficient, molecular weight and relative abundance of dimers and tetramers. ssphere corresponds to the theoretical sedimentation coefficient calculated for a spherical protein. The discrepancy between the experimental sedimentation coefficient for the dimer and its theoretical value (ssphere) suggests that it is elongated.

A- Cartoon representation of the monomer structure in the asymmetric unit showing a typical AIRS-like folding. The pan class="Chemical">sulfate ion is represented as sticks. B- Superimposition of AaSEPHS (grey) [38], EcSEPHS (green) [39], HsSEPHS1 (light blue) [22] and LmSEPHS2 (purple). C- Dimeric model generated using PDBePISA [40] depicting amino acid residue conservation. D- Native gel electrophoresis showing the prevalence of dimers in solution for T. brucei (Tb) and L. major (Lm) selenophosphate synthetases at 2 mg/mL. A small amount of tetramers is also observed for both protein preparations (top bands). MW: molecular weight. E- Sedimentation coefficient distribution (S) at increasing protein concentration normalized to the most abundant oligomer (dimer) obtained by sedimentation velocity analytical ultracentrifugation (SV-AUC). The inset displays sedimentation coefficients measured for dimers at increasing total protein concentration. F- Measured and theoretical sedimentation coefficient, molecular weight and relative abundance of dimers and tetramers. ssphere corresponds to the theoretical sedimentation coefficient calculated for a spherical protein. The discrepancy between the experimental sedimentation coefficient for the dimer and its theoretical value (ssphere) suggests that it is elongated.

Notably, pan class="Chemical">selenophosphate synthetases were reportedly active dimers in E. coli [39], A. aeolicus [38] and H. sapiens [22]. Indeed, both recombinant full-length LmSEPHS2 and TbSEPHS2 predominantly oligomerize as elongated 84±3 kDa dimers in vitro as shown by native gel electrophoresis (Fig 1D and S2 Fig) and sedimentation velocity analytical ultracentrifugation (SV-AUC) (Fig 1E and 1F). Curiously, a relatively small amount of tetramers was also detected in vitro (Fig 1D–1F). Tetramer-dimer dissociation constants of 161±10 μM and 178±10 μM were measured by sedimentation equilibrium AUC (SE-AUC, S3 Fig) for TbSEPHS2 and LmSEPHS2, respectively. The data indicate that the dimer corresponds to the likely dominant form of selenophosphate synthetase in solution. An elongated dimer model of ΔN-LmSEPHS2 (Fig 1C) was generated using PDBePISA [40] as a likely quaternary structure, stable in solution with a 3230 Å2 buried surface. The dimerization surface occurs mainly between the β2 and β5 strands of adjacent monomers and is also stabilized by hydrophobic interactions between side chains, leading to the formation of an eight-stranded β-barrel. The dimeric structure of ΔN-LmSEPHS2 conserves two symmetrically arranged ATP-binding sites, formed along the interface between AIRS and AIRS-C domains in each monomer. Amino acid residues previously described to bind ATP phosphate groups [22,38,39] are also conserved (Lys46, Asp64, Thr95, Asp97, Asp120, Glu173 and Asp279), although Lys46 and Asp64 are not present in the crystal structure (Fig 1 and S1 Fig). Interestingly, a novel sulfate binding site was identified in the ΔN-LmSEPHS2 monomer at His84 and Thr85 (represented as sticks in Fig 1).

The N-terminal portion of pan class="Chemical">selenophosphate synthetases has been shown to be highly flexible in the absence of ligand [22,38,39,41,42], and it is disordered in the crystal structure of the apo A. aeolicus SEPHS [42]. Similarly, the apo ΔN-LmSEPHS2 crystal structure lacks a 69-amino acid residues-long N-terminal region that includes a glycine-rich loop, where the conserved catalytic residues Cys46 and Lys49 are located. A molecular tunnel formed by the long N-terminal loop in substrate-bound selenophosphate synthetase structures is believed to protect unstable catalysis intermediates [22,38,39]. Furthermore, the disordered SPSH2 N-terminal region does not seem to be essential for the protein dimerization in-vitro (S2 Fig) and its absence does not destabilize its secondary structure (S4A Fig).

The N-terminal region of trypanosomatid SEPHS2 is important but not essential for ATPase activity in vitro and selenoprotein biosynthesis in selD-deficient E. coli

Our group previously showed that both pan class="Chemical">TbSEPHS2 and LmSEPHS2 have a slow kinetics in vitro in the presence of selenide [26]. We further evaluated their ATPase activity in the absence of selenide by monitoring the ATP peak over time by HPLC, as shown in Fig 2A. Full-length LmSEPHS2 consumed most of the ATP available in vitro during the first five hours of reaction, while full-length TbSEPHS2 consumed half of it during the same period. Interestingly, ΔN(25)-TbSEPHS2, which lacks the predicted disordered N-terminus but preserves all catalytic residues, consumed half of the available ATP only after an 18 hour reaction, indicating that this region is important but not essential for its ATPase activity. On the other hand, ΔN(70)-TbSEPHS2 constructs, which lack the functional residues necessary for selenophosphate formation but conserve most amino acid residues composing the two ATP-binding sites, showed only small residual ATP hydrolysis in the absence of selenide. Curiously, ΔN-LmSEPHS2 showed residual ATPase activity comparable to ΔN(25)-TbSEPHS2. As a control, ATP did not show any residual hydrolysis in the absence of selenophosphate synthetase even after 72 hours of incubation in the reaction buffer.

Fig 2

ATPase activity and functional complementation assays.

A- ATP hydrolysis in vitro over time measured by HPLC for full length and N-terminally truncated constructs of T. brucei and L. major selenophosphate synthetases. B- Selenophosphate synthetase functional complementation assays in SEPHS deficient E. coli strain (WL400 (DE3)) transformed with different constructs. The purple color indicates a functional formate dehydrogenase H selenoprotein expression. R1 and R2 correspond to biological duplicates.

pan class="Chemical">A- ATP hydrolysis in vitro over time measured by HPLC for full length and N-terminally truncated constructs of T. brucei and L. major selenophosphate synthetases. B- Selenophosphate synthetase functional complementation assays in SEPHS deficient E. coli strain (WL400 (DE3)) transformed with different constructs. The purple color indicates a functional formate dehydrogenase H selenoprotein expression. R1 and R2 correspond to biological duplicates.

Like pan class="Species">E. coli SEPHS (SelD) [39], but in contrast with its H. sapiens orthologs, trypanosomatid SEPHS2 is not a selenoprotein itself [26]. LmSEPHS2 was previously shown to restore selenoprotein biosynthesis in a SEPHS deficient E. coli WL400(DE3) strain [26]. To extend this information, we verified that both full-length TbSEPHS2 and ΔN(25)-Tb SEPHS2, but not ΔN(70)-TbSEPHS2 and ΔN-LmSEPHS2, are also capable of complementing selD deletion in E. coli (Fig 2B). As expected, no functional complementation resulted from Cys42Ala-TbSEPHS2 and Cys46Ala-LmSEPHS2 mutants, as negative controls (Fig 2B). Notably, although having slow kinetics in vitro, ΔN(25)-TbSEPHS2 successfully restored E. coli SEPHS function (Fig 2B).

T. brucei SEPHS2 binds selenocysteine lyase (TbSCLY) but does not co-purify with higher order complexes of the selenocysteine pathway from T. brucei

A putative interaction of eukaryotic pan class="Chemical">selenophosphate synthetase with selenocysteine lyase has been suggested based on reported co-immunoprecipitation of mouse homologs [43]. Thus, we sought to evaluate the T. brucei SCLY-SEPHS2 direct interaction in vitro by SEC-MALS. We unambiguously observed a binary hetero-complex formation in vitro (Fig 3A). Isothermal titration calorimetry (ITC) confirmed the interaction (Fig 3B and S5A Fig). We also determined that the pyridoxal-phosphate (PLP) molecule bound to the active sites of SCLY is hidden upon SEPHS2 interaction, as measured by a decrease in PLP fluorescence accompanied by a blue shift (Fig 3C). Additionally, we observed that ΔN(70)-TbSEPHS2 does not bind TbSCLY as measured by ITC (S5B Fig), indicating that the N-terminal region is necessary for in vitro interaction, similarly to the E. coli SEPHS (EcSEPHS) N-terminal dependence for SEPHS-SelA-tRNA[Ser]Sec ternary complex formation in E. coli [41].

Fig 3

Interaction between selenophosphate synthetase and selenocysteine lyase.

A- SEC-MALS profiles for TbSCLY (40 μM; theoretical molecular weight (dimer) = 127 kDa), TbSEPHS2 (40 μM; theoretical molecular weight (dimer) = 89 kDa) and 1 TbSCLY (40 μM): 1 TbSEPHS (40 μM) indicating the formation of a binary complex in vitro. The molecular weight (MW) corresponding to the highest peak centroid is indicated. B- ITC curves obtained by in vitro titration of TbSEPHS2 (200 μM, syringe) to TbSCLY (10 nM, calorimeter cell). C- TbSCLY-PLP (20 μM) fluorescence in the presence of different concentrations of TbSEPHS2 (1:0.5, 1:0.75, 1:1, 1:1.25, 1:1.5). D- SyproRubyTM stained SDS-PAGE of tandem affinity purification (TAP) products of either TbSEPHS2-PTP, TbSCLY-PTP, TbPSTK-PTP, TbSEPSECS-PTP or TbeEFSec-PTP as baits. E- Analysis of tRNASec copurification by RT-PCR. Input: lysate expressing the respective PTP-tagged protein. IP: Immunoprecipitated complex using anti-IgG beads. F- LC-MS/MS analysis of the corresponding SDS-PAGE bands.

A- pan class="Chemical">SEC-MALS profiles for TbSCLY (40 μM; theoretical molecular weight (dimer) = 127 kDa), TbSEPHS2 (40 μM; theoretical molecular weight (dimer) = 89 kDa) and 1 TbSCLY (40 μM): 1 TbSEPHS (40 μM) indicating the formation of a binary complex in vitro. The molecular weight (MW) corresponding to the highest peak centroid is indicated. B- ITC curves obtained by in vitro titration of TbSEPHS2 (200 μM, syringe) to TbSCLY (10 nM, calorimeter cell). C- TbSCLY-PLP (20 μM) fluorescence in the presence of different concentrations of TbSEPHS2 (1:0.5, 1:0.75, 1:1, 1:1.25, 1:1.5). D- SyproRubyTM stained SDS-PAGE of tandem affinity purification (TAP) products of either TbSEPHS2-PTP, TbSCLY-PTP, TbPSTK-PTP, TbSEPSECS-PTP or TbeEFSec-PTP as baits. E- Analysis of tRNASec copurification by RT-PCR. Input: lysate expressing the respective PTP-tagged protein. IP: Immunoprecipitated complex using anti-IgG beads. F- LC-MS/MS analysis of the corresponding SDS-PAGE bands.

Importantly, pan class="Chemical">TbSEPHS2 and TbSCLY co-purified with each other in independent PTP (protein A—TEV site—protein C)-TAP (tandem affinity purification) experiments (Fig 3D and 3F, and S1 Table). However, no tRNA[Ser]Sec was copurified in either experiment (Fig 3E), suggesting that this interaction may occur independent of tRNA[Ser]Sec. Interestingly, TbSCLY was previously reported to localize predominantly to the nucleus of PCF T. brucei [21]. On the other hand, we immunolocalized a C-terminally PTP-tagged construct of TbSEPHS2 both in the nucleus and the cytoplasm of the cell (S6 Fig). We further observed that TbPSTK sub-cellular localization in PCF T. brucei is similar to TbSPSH2, whereas TbSEPSECS and TbeEFSec were excluded from the nucleus (S6 Fig). Since a colocalization experiment was not possible due to the unavailability of antibodies against each protein, we sought to evaluate the formation of putative larger complexes involved in the Sec pathway (Fig 4A) using PTP-TAP experiments of TbPSTK-PTP, TbSEPSECS-PTP and TbeEFSec-PTP. TbSEPSECS-PTP did not co-purify any other protein, whereas TbPSTK-PTP co-purified with TbSEPSECS (Fig 3D). The C-terminal PTP-tag of TbSEPSECS might have impeded its interaction with TbPSTK. Additionally, no stable protein-protein complex was observed for TbeEFSec-PTP (Figs 3D and 4A). RT-PCR analysis revealed that tRNA[Ser]Sec co-precipitates with the TbPSTK-P-SEPSECS complex and with TbeEFSec (Fig 3E).

Fig 4

Polysomal profile analysis of selenoprotein synthesis factors.

A- Schematic representation of the selenocysteine pathway in trypanosomatids. Lysates of PCF T. brucei PTP-tagged selenocysteine biosynthesis proteins were fractionated in a sucrose gradient centrifugation (7–47% sucrose) as ribosome-free, monosome (40S, 60S and 80S) and polysome fractions as monitored by UV absorbance at 254 nm. Western blot analyses of tagged proteins, using anti-protein A antibody were carried out to localize selenoprotein synthesis factors (B- TbPSTK-PTP, C- TbSCLY-PTP, D- TbSEPSECS-PTP, and E- TbeEFSec-PTP). BiP and EIF5A were used as ribosome-free and polysome fraction markers, respectively. F- Ribosomes dissociation into monosome units in the presence of EDTA fractionated in a 5–25% sucrose gradient.

A- Schematic representation of the pan class="Chemical">selenocysteine pathway in trypanosomatids. Lysates of PCF T. brucei PTP-tagged selenocysteine biosynthesis proteins were fractionated in a sucrose gradient centrifugation (7–47% sucrose) as ribosome-free, monosome (40S, 60S and 80S) and polysome fractions as monitored by UV absorbance at 254 nm. Western blot analyses of tagged proteins, using anti-protein A antibody were carried out to localize selenoprotein synthesis factors (B- TbPSTK-PTP, C- TbSCLY-PTP, D- TbSEPSECS-PTP, and E- TbeEFSec-PTP). BiP and EIF5A were used as ribosome-free and polysome fraction markers, respectively. F- Ribosomes dissociation into monosome units in the presence of EDTA fractionated in a 5–25% sucrose gradient.

Furthermore, poly-ribosomal profiling experiments showed that neither pan class="Chemical">TbSEPHS2 nor TbSCLY are present in ribosomal complexes involved in the Sec pathway in PCF T. brucei (Fig 4B and 4C, respectively). Also, TbPSTK and TbSEPSECS were mostly present in ribosome-free fractions (Fig 4B and 4D, respectively). A small amount of these proteins was detected in monosome fractions possibly due to an overlap between ribosome-free and 40S ribosome fractions, as confirmed by the detection of BiP control in both fractions (Fig 4) consistent with Small-Howard et al [44] results that showed that HsSEPHS1 is also present in mammalian in ribosome-free fractions. Additionally, TbeEFSec was detected in all the fractions, including present in 80S ribosomes and polysomes (Fig 4E), as shown for HseEFSec [44]. Disruption of the mounted ribosome with the chelating agent EDTA demonstrated that TbeEFSec dissociated from monosomes or polysomes, being detected only in mRNA-free fractions (Fig 4F).

TbSEPHS2 RNAi-induced T. brucei cells are sensitive to endoplasmic reticulum chemical stressors

Ablation of pan class="Chemical">selenophosphate synthetase function impairs selenoprotein synthesis not only in mammals [24] but also in T. brucei [11]. However, TbSEPHS2 is not essential for either PCF and BSF T. brucei under laboratory-controlled conditions [11,27]. Recent work showed that mammalian selenoprotein T (SELENOT) is involved in ER stress response [31]. Therefore, we sought to investigate whether chemical ER stress upon SEPHS2 ablation impairs T. brucei viability. We induced RNAi expression against TbSEPHS2 with tetracycline for 48 hours and the cells were subsequently treated with common stressors of ER, namely DTT and tunicamycin (TN) for two hours.

Both pan class="Chemical">DTT and TN caused a slight but significant reduction in viability of induced PCF T. brucei cells, suggesting that they negatively interfere with ER metabolism in the absence of TbSEPHS2 (Fig 5A and 5C). Additionally, TbSEPHS2-RNAi BSF T. brucei cells were induced with tetracycline for 24 hours and subsequently incubated with TN or DTT for two hours. Treatment with DTT at 150 and 300 μM showed a reduction of TbSEPHS2-RNAi BSF T. brucei cells (Fig 5B) viability. No effect was detected at any concentration of TN in BSF T. brucei (Fig 5D). Also, no alteration of BiP expression in both TbSEPHS2-RNAi PCF and BSF T. brucei cells was observed by Western blot (Fig 5I and 5J, respectively).

Fig 5

TbSEPHS2-RNAi T. brucei cells sensitivity to DTT and tunicamycin.

Tetracycline non-induced (dark bars) and induced (grey bars) TbSEPHS2 RNAi PCF and BSF T. brucei cells treated with various concentrations of DTT and tunicamycin. The plots show cell concentration relative to untreated control after incubation at 28°C and 37°C for procyclic (PCF) and bloodstream (BSF) T. brucei, respectively. Bars represent the average of 3 independent experiments including standard deviations of experiments proceeded in A- and C- PCF T. brucei cells, and B- and D- BSF T. brucei cells. The asterisks represent significant differences between the stressors of ER treatment (PCF T. brucei, 0.5 mM DTT: ** P = 0.007; 1.0 mM DTT: * P = 0.020; 2.0 mM DTT: P = 0.040; 5μg/mL tunicamycin: * P = 0.033; 10μg/mL tunicamycin: * P = 0.010; 20μg/mL tunicamycin: * P = 0.020; BSF T. brucei, 0.15 mM DTT: * P = 0.020; 0.3 mM DTT: * P = 0.010; two-tailed Student’s t test). Western blot analysis of BiP in whole cell extracts of I- PCF and J- BSF TbSEPHS2 RNAi T. brucei cell (12% SDS-PAGE; α-tubulin as a normalization standard).

pan class="Chemical">Tetracycline non-induced (dark bars) and induced (grey bars) TbSEPHS2 RNAi PCF and BSF T. brucei cells treated with various concentrations of DTT and tunicamycin. The plots show cell concentration relative to untreated control after incubation at 28°C and 37°C for procyclic (PCF) and bloodstream (BSF) T. brucei, respectively. Bars represent the average of 3 independent experiments including standard deviations of experiments proceeded in A- and C- PCF T. brucei cells, and B- and D- BSF T. brucei cells. The asterisks represent significant differences between the stressors of ER treatment (PCF T. brucei, 0.5 mM DTT: ** P = 0.007; 1.0 mM DTT: * P = 0.020; 2.0 mM DTT: P = 0.040; 5μg/mL tunicamycin: * P = 0.033; 10μg/mL tunicamycin: * P = 0.010; 20μg/mL tunicamycin: * P = 0.020; BSF T. brucei, 0.15 mM DTT: * P = 0.020; 0.3 mM DTT: * P = 0.010; two-tailed Student’s t test). Western blot analysis of BiP in whole cell extracts of I- PCF and J- BSF TbSEPHS2 RNAi T. brucei cell (12% SDS-PAGE; α-tubulin as a normalization standard).

Selenoprotein T (SELENOT) is not essential for both procyclic and bloodstream forms of T. brucei

The pan class="Species">mammalian selenoprotein T (SELT, SELENOT) is an ER-resident enzyme whose Sec-containing redox domain is believed to regulate various post-translational modifications that require protein disulfide bond formation in the ER including chaperones and also contributing to Ca2+ homeostasis [31]. Thus, we sought to evaluate whether this enzyme is essential in T. brucei. Tetracycline-induced TbSELENOT-RNAi resulted in 96% reduction of TbSELENOT mRNA in PCF T. brucei as measured by qPCR, with no significant growth defect compared to non-induced cells (Fig 6A and 6C). In BSF T. brucei, a slight growth defect was observed for tetracycline-induced cells (Fig 6B and 6D) with around 91% mRNA level reduction.

Fig 6

TbSELENOT is dispensable for both procyclic and bloodstream T. brucei.

Growth curves of representative TbSELENOT-RNAi procyclic (PCF) and bloodstream (BSF) T. brucei cultures. A- and C- PCF and B- and D- BSF T. brucei cells induced (black) and non-induced (grey) with tetracycline and real-time qPCR analysis relative to TERT as a normalization standard, respectively.

Growth curves of representative Tbpan class="Gene">SELENOT-RNAi procyclic (PCF) and bloodstream (BSF) T. brucei cultures. A- and C- PCF and B- and D- BSF T. brucei cells induced (black) and non-induced (grey) with tetracycline and real-time qPCR analysis relative to TERT as a normalization standard, respectively.

We further evaluated the pan class="Gene">SELENOT response to ER stress upon DTT and TN treatment. Interestingly, TbSELENOT-RNAi-induced PCF cells were only sensitive to intermediate concentrations of DTT (1.0 nM) and TN (10 μM) (Fig 7A and 7C, respectively). On the other hand, no significant concentration-dependent effect was observed for TbSELENOT-RNAi-BSF T. brucei in the presence of DTT or TN. (Fig 7B and 7D, respectively). Moreover, stable tetracycline-induced TbSELENOLT-RNAi cell lines did not show any increase in BiP expression in either PCF or BSF T. brucei (Fig 7E and 7F, respectively).

Fig 7

TbSELENOT-RNAi T. brucei cells sensitivity to DTT and tunicamycin.

Tetracycline non-induced (black) and induced (grey) T. brucei cells were treated with various concentrations of DTT and tunicamycin. The plots show cell concentration relative to untreated control after a 24h-incubation at 28°C and 37°C for procyclic (PCF) and bloodstream (BSF) T. brucei, respectively. Bars represent the average of 3 independent experiments including standard deviations of experiments proceeded in A- and C- PCF T. brucei cells, and B- and D- BSF T. brucei cells. Asterisks: PCF T. brucei, 1.0 mM DTT: * P = 0.010; 10μg/mL tunicamycin: * P = 0.033; two-tailed Student’s t test. Western blot analysis of BiP in whole cell extracts of E- PCF and F- BSF TbSPS2 RNAi T. brucei cells (12% SDS-PAGE; α-tubulin as a normalization standard).

pan class="Chemical">Tetracycline non-induced (black) and induced (grey) T. brucei cells were treated with various concentrations of DTT and tunicamycin. The plots show cell concentration relative to untreated control after a 24h-incubation at 28°C and 37°C for procyclic (PCF) and bloodstream (BSF) T. brucei, respectively. Bars represent the average of 3 independent experiments including standard deviations of experiments proceeded in A- and C- PCF T. brucei cells, and B- and D- BSF T. brucei cells. Asterisks: PCF T. brucei, 1.0 mM DTT: * P = 0.010; 10μg/mL tunicamycin: * P = 0.033; two-tailed Student’s t test. Western blot analysis of BiP in whole cell extracts of E- PCF and F- BSF TbSPS2 RNAi T. brucei cells (12% SDS-PAGE; α-tubulin as a normalization standard).

Additionally, we sought to test if lack of pan class="Gene">SELENOT alters the sensitivity of T. brucei to hydrogen peroxide. Treatment with different concentrations of hydrogen peroxide did not affect the growth of any of the T. brucei forms upon SELENOT depletion (Fig 8A and 8B), ruling out a putative SELENOT role in oxidative stress protection in T. brucei.

Fig 8

TbSELENOT knockdown does not affect procyclic and bloodstream T. brucei sensitivity to H2O2.

Tetracycline non-induced (black) and induced (grey) T. brucei cells were treated with various concentrations of DTT and tunicamycin. The plots show cell concentration relative to untreated control after a 24h-incubation at 28°C and 37°C for procyclic (PCF) and bloodstream (BSF) T. brucei, respectively. TbSELENOT-RNAi A- PCF and B- BSF T. brucei cells were also treated with various concentrations of H202. Bars show the cell concentration relative to untreated controls after an 18h-incubation at 28°C and 37°C for PCF and BSF T. brucei, respectively. The average of 3 independent experiments is shown together with the respective standard deviation.

pan class="Chemical">Tetracycline non-induced (black) and induced (grey) T. brucei cells were treated with various concentrations of DTT and tunicamycin. The plots show cell concentration relative to untreated control after a 24h-incubation at 28°C and 37°C for procyclic (PCF) and bloodstream (BSF) T. brucei, respectively. TbSELENOT-RNAi A- PCF and B- BSF T. brucei cells were also treated with various concentrations of H202. Bars show the cell concentration relative to untreated controls after an 18h-incubation at 28°C and 37°C for PCF and BSF T. brucei, respectively. The average of 3 independent experiments is shown together with the respective standard deviation.

Discussion

pan class="Species">T.brucei, T. cruzi and L. major belong to the Trypanosomatidae family that is evolutionarily distant from the most commonly studied eukaryotes (H. sapiens, mouse, Drosophila melanogaster, Caenorhabitits elegans and Saccharomyces cerevisiae) [1,11], representing useful eukaryotic models to explore the evolution of cellular molecular processes. In fact, most of our knowledge of the eukaryotic selenocysteine pathway comes from studies of the mammalian machinery [14]. In this paper, we focused on the trypanosomatid selenophosphate synthetase, a key enzyme in the selenocysteine pathway that is responsible for catalyzing the formation of the biological form of selenium, selenophosphate, for selenocysteine biosynthesis [14,22,38,39]. We determined the crystal structure of an N-terminally truncated selenophosphate synthetase from L. major (ΔN-LmSEPHS2) consisting of an AIRS-like fold also conserved in E. coli [39], A. aeolicus [38,42] and H. sapiens [22] orthologs. This result shows that the selenophosphate synthetase fold is an important determinant for its function throughout domains of life.

We further showed that the pan class="Species">trypanosomatid selenophosphate synthetase is active as a dimer in solution. Our dimeric model of LmSEPHS2 contains two equivalent unbound active sites in an open conformation prior to ATP and metal binding, similar to what is observed in the apo E. coli [39] and A. aeolicus [38,42] SEPHS structures. Although partially disordered, the LmSEPHS2 ATP-binding site contains conserved basic amino acid residues that lie in an extended pocket formed between the two amino acid chains of the heterodimer, explaining the need for dimerization of the full-length protein for ATPase activity. A comparison between the apo selenophosphate synthetase crystal structures (EcSEPHS [39] and AaSEPHS [38,42] and LmSEPHS2) and the substrate-bound ones (AMPCPP-AaSEPHS [38], ADP-HsSEPHS1 [22] and AMPcP-HsSEPHS1[22]) suggests that the N-terminal region of the protein, where the catalytic residues are conserved, becomes more ordered upon substrate binding. While the N-terminus of EcSEPHS [39] was observed far from the open ATP-binding site, our crystal structure lacks such a flexible N-terminal region but keeps ATP-binding residues in a similar position. On the other hand, A. aeolicus [38] and H. sapiens [22] substrate-bound structures of SEPHS showed that the N-terminal region forms a long molecular tunnel suggested to preserve putative cytotoxic Se-containing intermediates from the cytoplasm.

We showed that the crystallized construct (ΔN-pan class="Chemical">LmSEPHS2) does not complement selenoprotein biosynthesis in SEPHS deficient E. coli WL400(DE3) strain, as expected due to the lack of catalytic residues. However, a residual ATPase activity was measured in vitro in the absence of selenide. This curious result is likely due to the preservation of the ATP-binding site being in the truncated construct. N-terminally truncated constructs of TbSEPHS2 corroborate the data obtained for LmSePHS2. In addition, a comparison between ΔN(25)-TbSEPHS2 and ΔN(70)-TbSEPHS2 functional complementation assays and ATPase activities argues that its first 25 amino acid residues are not essential for selenophosphate synthetase activity in the selenocysteine pathway, but do interfere with ATPase activity. Together, our crystallographic and functional data suggest that ATP-binding is not dependent on the N-terminal region of the protein, although ATPase activity is affected by the presence of such a region.

Interestingly, we previously reported that the disordered N-terminus of pan class="Species">E. coli SEPHS is involved in the physical interaction between selenophosphate synthetase and selenocysteine synthase and is necessary for selenoprotein biosynthesis [41]. Besides, Itoh et al [38] suggested that the flexibility of the N-terminal Gly-rich loop in selenophosphate synthetase and the perselenide-carrying loop of selenocysteine lyase (SCLY) would allow the direct transfer of selenide between them. The eukaryotic selenocysteine lyase is a pyridoxal 5′-phosphate (PLP)-dependent enzyme that catalyzes the decomposition of selenocysteine into L-alanine and elemental selenium [19,20,45]. In fact, the homologous E. coli NifS-like proteins support in vitro selenophosphate synthesis by SEPHS in the presence of selenocysteine [46]. However, their physical interaction had not been previously established. We demonstrate by SEC-MALS, ITC and fluorescence spectroscopy that TbSEPHS2 indeed binds to TbSCLY in vitro in the absence of tRNA[Ser]Sec. The SCLY active site containing PLP is obstructed in the binary complex. We further showed that both TbSEPHS2 and TbSCLY co-purify with each other from T. brucei procyclic cells and we observed that such interaction is dependent on the TbSEPHS2 N-terminal region. Together, our data suggest that both trypanosomatid selenoprotein biosynthesis and selenocysteine recycling are coupled through the SCLY-SEPHS2 direct interaction (Fig 4A), likely warranting the efficient usage of biological selenium in the cell.

Furthermore, Oudouhou et al [47] also demonstpan class="Species">rated that human SEPHS1 and SEPHS2 bind transiently to selenocysteine synthase (SEPSECS) in vivo. We observed that PTP-tagged selenocysteine synthase localize to the cytoplasm of PCF T. brucei. Interestingly, TbPSTK-PTP co-purified TbSEPSECS and tRNA[Ser]Sec, demonstrating the formation of a stable ternary complex between them. However, TbSEPSECS-PTP did not co-purify with any molecule, indicating that its C-terminal PTP-tag might present a steric hindrance for its interaction with TbPSTK. Furthermore, neither TbSEPHS2 nor TbSCLY were observed in other stable complexes involved in selenocysteine biosynthesis and incorporation in selenoproteins (Fig 4A), although a report described that selenophosphate synthetase homologs are present in higher order complexes, involved in the selenoprotein biosynthesis pathway in humans [44]. Therefore, our data do not exclude the formation of higher order transient complexes in the Sec pathway in trypanosomatids.

In addition, we showed that 80S ribosomes and polysomes involved in the synthesis of pan class="Gene">selenoproteins in PCF T. brucei contain TbeEFSec that is dissociated in the presence of a chelating agent. TbeEFSec was also detected in the ribosome-free form. These data suggest that TbeEFSec interaction with the ribosome is either dependent on selenoprotein mRNA or take place after 80S ribosome assembly. On the other hand, TbSCLY-SEPHS2 was not detected as associated to ribosomes. Similarly, TbPSTK and TbSEPSECS are mostly detected as ribosome-free complexes. Taken together, our biochemical data indicate that trypanosomatid selenocysteine biosynthesis occurs in a hierarchical process via coordinate action of protein complexes. We hypothesize that, after tRNA[Ser]Sec aminoacylation by SerRS, Ser-tRNA[Ser]Sec may be either specifically transferred to a PSTK-SEPSECS binary complex or to PSTK alone, which phosphorylates Ser-tRNA[Ser]Sec and subsequently associates with SEPSECS to form a stable complex. In archaea, PSTK distinguishes the characteristic D-arm of tRNA[Ser]Sec over tRNASer [48,49] while human SEPSECS specifically recognizes its 3′-CCA end, TΨC and the variable arm [50]. Hence, Ser-tRNA[Ser]Sec is discriminated from Ser-tRNASer and mischarged tRNA[Ser]Sec is avoided. Furthermore, selenophosphate is a toxic compound that is directly delivered to selenocysteine synthase by selenophosphate synthetase via a transient interaction [38,41]. In fact, TbSEPSECS was not copurified with TbSEPHS2 under the conditions tested. In contrast, a stable TbSEPHS2-TbSCLY binary complex was obtained. Since selenocysteine synthase (SEPSECS) is not specific to selenium compounds [38,51,52], selenophosphate synthetase-selenocysteine lyase complex formation represents another level of fidelity in UGASec codon recoding.

Curiously, pan class="Chemical">selenophosphate synthetase has been described as non-essential for T. brucei viability [11]. SEPSECS knockout experiments further established that there is no significant contribution of selenoproteins to redox homeostasis in trypanosomatids [11,13,27,28]. Indeed, we further show that TbSELENOT knockdown does not significantly impact PCF and BSF T. brucei viability. On the other hand, our group previously demonstrated that TbSEPHS2 is important for oxidative stress response in PCF and BSF T. brucei [29]. Accumulation of reactive oxygen species, a common characteristic of oxidative stress, can induce apoptotic cell death in T. brucei [53,54]. In addition, the formation of disulfide bonds in ER proteins requires oxidizing power, which has been related to ER oxidoreductin-1 (Ero1) in mammals [55,56,57], a conserved but poorly studied protein in trypanosomatids [58]. Interestingly, protein disulfide isomerase (PDI) and thioredoxin mRNA levels increase in PCF T. brucei due to higher mRNA stability under DTT treatment [59]. DTT is thought to interfere with disulfide bond formation leading to accumulation of misfolded proteins in the ER [59]. Besides DTT, chemical ER stress is also commonly achieved with tunicamycin (TN), known to negatively affect N-glycosylation in the ER of T. brucei [60]. Here, we demonstrated that ER stress with DTT and TN upon TbSEPHS2 ablation leads to growth defects in PCF T. brucei, while only DTT showed a negative effect in BSF T. brucei cells expressing TbSEPHS2 RNAi. Together, our data indicate a role for TbSEPHS2 in the ER redox stress response.

Maintaining ER redox is also important for pan class="Chemical">Ca2+-dependent cell signaling and homeostasis, which is itself key for mitochondrial homeostasis [61]. In mammals, the ER-resident selenoproteins S, N, K, M and T are believed to regulate the ER redox state, ER stress responses and Ca2+ signaling [62]. Among those, SELENOK and SELENOT are conserved in trypanosomatids [12,63]. Interestingly, mammalian SELENOT is localized to the ER and seems to have a thioredoxin-like activity to maintain ER redox homeostasis [64]. SELENOT knockout led to early rat embryonic lethality and its knockdown in corticotrope cells promoted ER stress and unfolded protein response (UPR) [64]. The TrypTAG database [65] contains subcellular localization data for a GFP-tagged TbSELENOT as reticulated in the cytoplasm of the procyclic T. brucei, which is consistent with an ER localization. It will be interesting to evaluate its co-localization with ER markers. TbSELENOT-RNAi PCF, but not BSF T. brucei cells were only marginally sensitive to DTT and TN at intermediate concentrations. We also verified that both TbSELENOT-RNAi PCF and BSF T. brucei cells were not sensitive to increasing levels of hydrogen peroxide. The absence of a strong negative effect of ER stressors in SELENOT-RNAi PCF and BSF T. brucei is intriguing. In mammals, SELENOT was identified as necessary for efficient processing of glycosylphosphatidylinositol (GPI) anchoring of proteins [64]. The ER function is particularly necessary for efficient production of GPI-anchored procyclins that coat PCF T. brucei cells and of variant surface glycoprotein (VSG) proteins that protects BSF T. brucei surface from effectors of the host immune system [66, 67]. However, little is known about the exact role of the ER in T. brucei developmental differentiation.

Apart from pan class="Gene">SELENOT, mammalian SELENOK has been associated with ER homeostasis by promoting calcium flux [68]. However, we were unable to generate a stable SELENOK-RNAi T. brucei cell line. It will be informative to evaluate its subcellular localization and function in T. brucei since our results from ER stress in selenophosphate synthetase knockdown PCF and BSF T. brucei indicate a putative function for the selenocysteine biosynthesis pathway in T. brucei ER stress. On the other hand, it is also possible that the only selenophosphate synthetase isoform observed in trypanosomatids (TbSPSH2) has a more direct role in redox homeostasis in the cell as suggested for the mammalian SEPHS1 [69].

Moreover, we did not obpan class="Chemical">serve any alteration in BiP expression upon TbSEPHS2 or TbSELENOT ablation in PCF and BSF T. brucei. The presence of UPR is debated in T. brucei [32–36, 70]. Goldshmidt et al [59] proposed that a UPR-like pathway is triggered by chemical ER stress in trypanosomatids to reduce the load of proteins to be translocated and enhance degradation of misfolded proteins. Lack of BiP up-regulation upon chemical ER stress in T. brucei and L. donovani was also observed by Koumandou et al [71], Izquierdo et al [72], Tiengwe et al [32] and Abhishek et al [73], arguing that a UPR-like response based on BiP is inactive in trypanosomatids. On the other hand, these parasites also conserve PKR-like endoplasmic reticulum kinase (PERK) [73], a protein that regulates protein translation by phosphorylating eIF2a, in another mechanism of UPR response in mammals [74]. It is not expected that BSF T. brucei could compensate for correct folding of VSGs in the absence of a UPR-like mechanism [66]. New experiments are required to more fully address the molecular response to chemical ER stressors in T. brucei.

Although the exact role of the pan class="Chemical">selenocysteine pathway in trypanosomatids is still not clear, we provide new insights into this machinery in these protist parasites. The highly conserved structure of selenophosphate synthetase is essential for selenoprotein biosynthesis across domains of life. Although selenophosphate is not essential for the viability of T. brucei [11] and L. donovani [13] under laboratory-controlled conditions [11], and some selenoproteins may not be essential as well, as we have shown for selenoprotein T, our data show a role for the selenophosphate synthetase in the ER redox stress protection in both the insect stage (procyclic) and the clinically relevant stage (bloodstream) of T. brucei. This result is consistent with the global effect of SEPHS2 on the synthesis of selenocysteine and therefore the translation of all selenoproteins. Furthermore, our data stress the need for further investigation of the exact molecular processes involved in T. brucei developmental differentiation and upon redox stress, and pH and temperature variation observed in their hosts.

Materials and methods

Amino-acid sequence analysis

Amino acid sequences of pan class="Chemical">selenophosphate homologs were retrieved from NCBI [75]: Aquifex aeolicus (Aa, WP_010880640.1), Escherichia coli (Ec, KPO98227.1), Pseudomonas savastanoi (Ps, EFW86617.1), Phytophthora infestans (Pi, EEY58478.1), Trypanosoma cruzi (Tc, PBJ75389.1), Trypanosoma brucei (Tb, EAN78336.1), Leishmania major (Lm, XP_001687128.1), Drosophila melanogaster (Dm_1, AAB88790.1; Dm_2, NP_477478.4), Mus musculus (Mm_1, AAH66037.1; Mm_2, AAC53024.2), and Homo sapiens (Hs_1, AAH00941.1; Hs_2, AAC50958.2). Amino sequence alignment was generated using Clustal Omega [76].

Cloning

pan class="Chemical">TbSEPHS2 (Tb927.10.9410), LmSEPHS2 (LmjF.36.5410) and ΔN(69)-LmSEPHS2 cloning was reported previously [36]. ΔN(25)-TbSEPHS2, amino acid residues 26–393, and ΔN(70)-TbSEPHS2, residues 71–393, were cloned into the pET20b expression vector (Novagen) using the following pairs of oligonucleotides: 5’-AGCATATGGGTCTACCGGAAGAGTTTACCT TAACTGAC-3’ and 5´- AGCTCGAGAATAATCTTATCATTTACCTTCGCTCCCACCTC-3´, and 5´-AGCATATGGATTGCAGCATTGTGAAACTGCAG-3´and 5´-AGCTCGAGAATAATCTTATCATTTACCTTCGCTCCCACCTC-3´, respectively. TbSCLY (Tb927.9.12930) was cloned into the pET32a expression vector (Novagen) using the following pairs of oligonucleotides: 5’-GGATCCATGTGTAGCATTGAGGGCCCG-3’ and 5’-CTCGAGTTACTAAAACTCACCGAACTGTTGC-3’. For the PTP (Protein A-TEV site-Protein C) tagged protein constructs, the ORFs were amplified using the following primers that contained ApaI and EagI restriction sites: TbSEPHS2 5’-GGGCCCGTCTCAAATGATCCGTCCAACAG-3’ and 5’-CGGCCGAATAATCTTATCATTTACCTTC-3’, TbeEFSec (Tb927.4.1820) 5’-GGGCCCCATCACGTTTGAATGCCCTTC-3’ and 5’-CGGCCGCTGCTGAAGCTGACTGTGGAG-3’, TbSEPSECS (Tb927.11.13070) 5’-GGGCCCGCCGCCATTCGACTGGGTCGTG-3’ and 5’-CGGCCGTACCCCCTCGACCGGCCAAAC-3’, TbPSTK (Tb927.10.9290) 5’-CGGCCGATGACAGTTTGTCTTGTTCTAC-3’ and 5’-GGGCCCCTCGCCAAACACTTCGACTTC-3’, TbSCLY 5’-GGGCCCCTATTGATGACCTCGTGAAAC-3’ and 5’-CGGCCGAAACTCACCGAACTGTTGCAC-3’. Constructs were designed for homologous expression of C-terminally PTP-tagged protein, with exception of TbPSTK, which was cloned into PN-PTP plasmid. Prior to transfection, the constructs were linearized with the BsmI, AflII, NsiI, XcmI and XcmI restriction enzymes, respectively. TbSEPHS2-RNAi silencing was carried out with the construct described by Costa et al. [29] and TbSELENOT-RNAi was achieved with a specific fragment PCR-amplified from PCF T. brucei genomic DNA using gene-specific primers 5’- CCGATTTGTTCGCATCTCATTTTC-3’ and 5’- ACCAGAGATAATTTGGCGCAG -3’ and cloned into a modified p2T7TAblue with phleomycin resistance.

Recombinant protein purification

pan class="Chemical">TbSEPHS2, ΔN(25)-TbSEPHS2, ΔN(70)-TbSEPHS2, LmSEPHS2 and ΔN-LmSEPHS2 were expressed in E. coli and purified as described previously [36]. TbSCLY (Tb927.9.12930) expression was induced by IPTG in E. coli BL21(DE3) for 16 hours at 18°C. Cells were harvested and sonicated in lysis buffer (50 mM HEPES pH 7.5, 300 mM NaCl, 2% glycerol, 10 mM imidazole, 5 mM DTT, 1X cOmplete Protease Inhibitor Cocktail (Roche)) supplemented with 10 μM PLP. The lysate was centrifuged at 40,000 X g for 20 min at 4°C and the supernatant was applied to a 5 ml Ni-NTA Superflow Cartridge (Qiagen) in ÄKTA Purifier 10 (GE). The product was dialyzed against the same buffer in the absence of imidazole, incubated with 1 mM PLP on ice and subsequently washed 5 times with the same buffer. The product was applied to a Superdex 200 10/300 column (GE) and concentrated using an Amicon ultracentrifugal filter.

In vitro activity assay

Recombinant pan class="Chemical">selenophosphate synthetase constructs at 30 μM final concentration were added independently to a reaction mixture (100 μl) containing 50 mM Tris-HCl pH 7.5, 50 mM KCl, 5 mM MgCl2, 5 mM DTT, 1 mM ATP and incubated at 26°C. The reaction was blocked by incubation at 75°C for 10 minutes and the solution was centrifuged at 16,000 x g for 45 minutes. The nucleotides present in the supernatant were separated by high-pressure liquid chromatography (HPLC) using a Waters Alliance 2695 HPLC with a C18 reversed-phase column (5 μm, 15 cm x 4.6 mm inside diameter, SUPELCOSIL LC-18-S; Sigma Aldrich) equipped with a guard column at a flow rate of 1 ml/min. The mobile phase consisted of buffer A (50 mM potassium phosphate buffer (KH2PO4/K2HPO4), pH 4.0) and a gradient of buffer B (20% methanol vol/vol in buffer A). The gradient conditions were: 5 min—100% buffer A at 1.0 ml/min; 10 min—100% buffer A at 0.1 ml/min; 1 min—100% buffer B at 0.5 ml/min; 1 min—100% buffer B at 1.0 ml/min; 1 min 100% buffer B at 1.0 ml/min. Nucleotide peaks were detected, and the peak area for ATP (maximum absorbance at 254 nm) was calculated relative to the respective control (enzyme absence). Raw data are available in S2 Table.

Functional complementation assay in Escherichia coli

Functional complementation experiments were conducted according to Sculaccio et al [26] for N-terminally truncated pan class="Chemical">selenophosphate synthetase constructs. Briefly, E. coli WL400(DE3) was transformed with the full-length and truncated constructs of both T. brucei and L. major SEPHS2 and the cells were analyzed for the presence of active selenoprotein formate dehydrogenase H (FDH H) using the benzyl viologen assay under anaerobic conditions at 30°C for 48 hours.

Native gel electrophoresis

Recombinant pan class="Chemical">TbSEPHS2, ΔN(25)-TbSEPHS2, ΔN(70)-TbSEPHS2, LmSEPHS2 and ΔN-LmSEPHS2 were applied to a PhastGel gradient 8–25% (GE) at 1 mg/mL at room temperature.

Analytical ultracentrifugation (AUC)

pan class="Chemical">TbSEPHS2 and LmSEPSH2 at 0.15, 0.30, 0.45, 0.60 and 0.80 mg/mL in 25 mM Tris pH 8.0, 50 mM NaCl, 1mM β-mercaptoethanol were subjected to velocity sedimentation at 30,000 rpm at 20°C in an An60Ti rotor using a OptimaTM XL-A analytical ultracentrifuge (Beckmann). The data were analyzed with SEDFIT [77] using a c(s) distribution model. The partial-specific volumes (v-bar), solvent density and viscosity were calculated using SEDNTERP (Dr Thomas Laue, University of New Hampshire). Raw data are available in S2 Table. To determine the tetramer-dimer equilibrium dissociation, 110 μL of protein at concentrations of 0.5, 0.75 and 1.0 mg/mL were loaded in 12 mm 6-sector cells and centrifuged at 8,000, 10,000 and 12,000 rpm at 4°C until equilibrium had been reached. Data were processed and analyzed using SEDPHAT [77].

Size exclusion chromatography with multi angle light scattering (SEC-MALS)

The molecular mass distribution of pan class="Chemical">TbSCLY (40 μM), TbSEPHS2 (40 μM) and TbSCLY-TbSEPHS2 (40 μM:40 μM) in solution was determined using SEC-MALS. A 1:1 TbSCLY-TbSEPHS2 mixture was incubated in 50 mM HEPES pH 7.5, 300 mM NaCl, 2% glycerol, 10 mM imidazole, 5 mM DTT at 25°C for 30 minutes and 60 minutes on ice previous to the SEC-MALS analysis. 40 μl of each sample was loaded onto a WTC-030N5 (Wyatt) column running at 0.3 ml/min coupled to a mini-DAWN TREOS equipped with an Optilab rEX detector (Wyatt). Data was analyzed using Astra 7.0.1.24 (Wyatt). Raw data are available in S2 Table. Experiments were performed at room temperature.

Isothermal titration calorimetry (ITC)

Ipan class="Species">TC measurements were performed at 25°C in a VP-ITC calorimeter (Microcal) using 50 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1 mM DTT buffer. Samples of TbSCLY at 10 nM in the calorimeter cell were titrated with TbSEPHS2 at 200 μM from the syringe using 29 injections of 2 μL preceded by a 0.5 μL injection. The resulting excess heats associated with the injections were integrated and normalized using the measured concentrations of protein from UV absorbance, corrected for the background heat of dilution of TbSEPHS2 and the binding data were fitted to a two-species hetero-association model using Microcal ORIGIN software (Microcal). Raw data are available in S2 Table. We were unable to perform the potentially informative reverse titration, with TbSCLY in the syringe, because of its limited stability at high concentration at 25°C.

Fluorescence spectroscopy

Fluorescence spectpan class="Chemical">roscopy of the pyridoxal phosphate (PLP) group bound to TbSCLY excited at 450 nm was performed in an ISS-PC spectrofluorometer (ISS). Varying concentrations of TbSEPHS2 (1:0.5, 1:0.75, 1:1, 1:1.5) were incubated in 50 mM HEPES pH 7.5, 300 mM NaCl, 2% glycerol, 10 mM imidazole, 5 mM DTT with 20 μM TbSCLY at 25°C for 30 minutes and 60 minutes on ice. Fluorescence spectroscopy was then performed at room temperature. Raw data are available in S2 Table.

Circular dichroism (CD) spectroscopy

Purified pan class="Chemical">TbSEPHS2, LmSEPHS2 and their truncated constructs were dialyzed against 25 mM Tris pH 8.0, 50 mM NaCl, 1mM β-mercaptoethanol at 4°C overnight and adjusted to a concentration of 0.2 mg/mL. Purified TbSCLY at 0.2 mg/mL was kept in the same buffer. Far-UV CD spectra at 5°C were measured using a Jasco J-815 spectropolarimeter (JASCO) (0,1 nm resolution, 100 nm/min, quartz 0.5 cm cuvette).

X-ray crystallography

X-ray diffraction data collection and analysis were previously reported for both pan class="Chemical">TbSEPHS2 and ΔN-LmSEPHS2 crystals. Although the data was not sufficient for TbSEPHS2 structure determination, ΔN-LmSEPHS2 final model was completed by molecular replacement with PHASER [78] using H. sapiens SEPHS1 [22] structure coordinates as search model (PDB code 3FD5). Model building and refinement were performed using PHENIX [79] and COOT [80]. Structure visualization was performed in PyMOL. ConSurf [81] was used for conservation analysis.

RNAi experiments

pan class="Species">Trypanosoma brucei procyclic RNAi 29–13 cell line (derived from strain 427) was grown in Cunningham’s culture media [82] supplemented with 10% tetracyclin-free fetal bovine serum (FBS) (Atlanta Biologicals) in the presence of G418 (15 μg/mL) and hygromycin (50 μg/mL) to maintain the integrated genes for T7 RNA polymerase and tetracycline repressor, respectively. T. brucei bloodstream form 221 (Variant Antigen Type expressing VSG, from strain 427), was cultured in HMI-9 media supplemented with 10% tetracycline-free FBS, supplemented with G418 (15 μg/mL).

The Tbpan class="Gene">SELENOT RNAi construct was obtained using a fragment between the positions 9 to 754 according to Costa et al. 2011. Stable TbSEPHS2 RNAi cell lines were transfected using the constructs described by Costa et al. 2011. Clonal populations of transfected cells were obtained by limiting dilutions and selected with 2.5 μg/mL of phleomycin (Sigma). To monitor the growth of RNAi cells, dsRNA synthesis was induced with 1 μg/mL of tetracycline. The cells were counted daily and diluted to a concentration of 2 x105 cells/mL.

For bloodstream pan class="Species">T. brucei transfection, we used the protocol described by Burkard et al. 2011 [83]. In summary, 10 μg of NotI-linearized DNA were used per 6×107 cells in 100μl homemade Tb-BSF buffer (90mM sodium phosphate, 5mM potassium chloride, 0.15mM calcium chloride, 50mM HEPES, pH 7.3). Electroporation was performed using 2mm gap cuvettes (BTX, Harvard apparatus) with program X-001 of the Amaxa Nucleofector (Lonza). Following each transfection, stable transformants were selected for 6 days with 2.5 μg/mL pheomycin as a pool culture in 125 ml HMI-9 medium containing 10% tetracycline-free FBS.

Mid-log phase pan class="Species">T. brucei procyclic form (5 x 105 cells/mL) and T. brucei bloodstream form (1 x 105 cells/mL) were treated with tetracycline for 48 and 24 hours, respectively, aimed to induce the RNAi. These cells were incubated with various DTT and tunicamycin concentrations for 4 hours or H2O2 for 8 hours and cell viability was confirmed by staining with fluorescein diacetate. Raw data are available in S2 Table.

Real time RT-PCR (qPCR)

RNA from 1 to 2x107 trypanosomes bloodstream and procyclic forms, respectively, were isolated with NucleoSpin RNA II Kit, (Macherey-Nagel), and 1.2 μg of RNA were reverse transcribed by SuperScript III Reverse Transcriptase (Life Technologies). To quantify levels of specific mRNA transcripts in individual samples, 1 μl of each cDNA sample was amplified with gene-specific primers in iQ SYBR Green Supermix (Bio-Rad) according to the manufacturer’s protocol, using a C1000 thermocycler fitted with a CFX96 real-time system (Bio-Rad Labopan class="Species">ratories). Three technical and three biological replicates of each reaction were performed. Every test gene was normalized to the mRNAs encoding TERT, which is known to be expressed constitutively [84]. The tempepan class="Species">rature profile was: 95°C, 3min [(95°C, 15 s; 55.5°C, 1 min; data collection) 40°C].

Polysomal profile analysis

For polysome profile analysis, 500 mL of each PTP-TAP pan class="Species">T. brucei culture were grown overnight at 28°C to mid-log phase and cells were treated with cyclohexamide 100 μg/mL for 5 minutes. The cultures were immediately chilled on ice and collected by centrifugation at 3,000 X g at 4°C for 7 minutes. Cells were washed twice with ice-cold Salts buffer (Tris-HCl 10 mM pH 7,5; KCl 30 mM; MgCl2; 10 mM; DTT 1 mM; cyclohexamide 100 μg/mL), pellet volume was estimated and suspended with the same volume of Lysis buffer (Tris-HCl 10 mM pH 7,5; KCl 30 mM; MgCl2; 10 mM; DTT 1 mM; cyclohexamide 100 μg/mL; 1,2% Triton), supplemented with 1X Protease cOmplete inhibitor cocktail (Roche). Lysates were clarified by centrifugation at 17,000 X g for 15 minutes. Eight hundred micrograms equivalent of OD260 units was loaded on a 7–47% sucrose gradient prepared in Salts buffer and centrifuged at 39,000 RPM for 2 hours at 4°C in a Beckman SW41Ti rotor. The gradients were fractionated by upward displacement with 60% (w/v) sucrose using a gradient fractionator ISCO UA-6 UV Vis with Type 11 optical unit at 254 nm and fractions were collected manually for subsequent western blotting analysis. Subunit profile analysis was performed as described before with modifications; lysis buffer was supplemented with 50 mM of EDTA and lysed was centrifuged on a 5–25% sucrose gradient for 4 hours.

PTP-tag TAP and mass spectrometry

PTP-tagged protein expression was demonstpan class="Species">rated by immunoblotting with a polyclonal rabbit anti-protein A antibody (SIGMA) as described previously [13]. Tandem affinity purification (TAP) was performed according to a standard PTP purification protocol [42]. Briefly, 4.5 L of procyclic PTP-transfected T. brucei culture was grown until mid-log phase, which corresponded to approximately 5–7 x 106 cells/mL. The cell pellet obtained by centrifugation at 3.000 X g was washed twice with cold Tryps wash buffer (20mM Tris-HCl pH 7,5, 100mM NaCl, 3mM MgCl2), and once with cold Transcription buffer (20 mM HEPES/KOH pH 7.7, 150 mM sucrose, 20 mM potassium L-glutamate, 3 mM MgCl2), and its volume was estimated and re-suspended with the same volume of cold Transcription buffer supplemented with 1 mM DTT and a tablet of protease inhibitor cocktail mini cOmplete (Roche). The cells were lysed in a FRENCH Press system (ThermoFisher scientific) at 20,000 psi, alternating 1 min under pressure and 1 min on ice, for 6 cycles. The lysate was mixed with 1/10 v/v Extraction buffer (20 mM TRIS/HCl pH 7.7, 150 mM KCl, 3 mM MgCl2, 0.5 mM DTT and 1% v/v Tween20), incubated for 20 min on ice, centrifuged at 21,000 X g, 4°C and the soluble fraction was submitted to IgG Sepharose 6 Fast Flow chromatography purification (GE), using resin previous equilibrated with PA-150 buffer (20 mM TRIS/HCl pH 7.7, 150 mM KCl, 3 mM MgCl2, 0.5 mM DTT and 0.1% v/v Tween 20). After washes, the tagged proteins were eluted with TEV protease (300 U, Promega) in 4 mL PC-150 buffer (20 mM TRIS/HCl pH 7.7, 150 mM KCl, 3 mM MgCl2, 1 mM CaCl2, 0.5 mM DTT and 0.1% v/v Tween 20) supplemented with cOmplete (Roche) protease inhibitor cocktail. A second chromatography step was carried out in an Anti-Protein C Affinity Matrix (Roche) pre-equilibrated with PC-150 buffer and co-purified proteins were recovered with Elution buffer (5 mM TRIS/HCl pH 7.7, 10 mM EGTA, 5 mM EDTA and 0.01 mg/mL leupeptin). 15μL of StrataClean resin (Stratagene) was added to 1.8 mL of eluate, centrifuged at 3,000 X g and the sample was separated in 12% SDS-PAGE stained with SYPRO Ruby (Invitrogen).

For protein identification, bands were excised from the gel, de-stained with 50% pan class="Chemical">methanol and 5% acetic acid for 5 minutes, dehydrated with 100% acetonitrile for another 5 minutes and reduced with 5 mM DTT for 30 min at room temperature, following alkylation with 14 mM of iodoacetamide in the dark for 30 min. Protein digests were carried out with 0.75 μg of trypsin (SIGMA) for 16 h at 4°C at 900 rpm, and reactions were stopped with 5% formic acid and bands dried in vacuum. Digestion products were desalted using ZipTipC18 (Merck) according to the manufacturer’s instructions. Peptides were suspended in 0.1% formic acid and injected in an in-house made 5 cm reversed phase pre-column (inner diameter 100 μm, filled with a 10 μm C18 Jupiter resins -Phenomenex) coupled to a nano-HPLC (NanoLC-1DPlus, Proxeon) online to an LTQ-Orbitrap Velos (ThermoFisher Scientific). The peptide fractionation was carried out in an in-house 10 cm reversed phase capillary emitter column (inner diameter 75 μm, filled with 5 μm C18 Aqua resins-Phenomenex) with a gradient of 2–35% of acetonitrile in 0.1% formic acid for 52 min followed by a gradient of 35–95% for 5 min at a flow rate of 300 ml/min. The mass spectrometry was operated in a data-dependent acquisition mode at 1.9 kV and 200°C. MS/MS spectra were acquired at normalized collision energy of 35% with FT scans from m/z 200 to 2000 and mass resolution of 3 kDa. Raw data were processed in Proteome Discovery 1.3 using MASCOT as a search engine and the complete database of T. brucei obtained from TriTrypDB [32].

RNA analysis

Reverse transcription (RT)-PCR experiments were used to monitor the presence of tRNA[pan class="Chemical">Ser]Sec in selenocysteine protein complexes. 100 μl cell extracts were incubated with 30 μl of IgG sepharose 6 fast flow (GE) beads, equilibrated with PA-150 buffer. After five washes, total RNA was extracted by TRIzol reagent (GE) and the first strand synthesized by SuperScript III reverse transcriptase (Invitrogen) with random hexamers primers (ThermoFisher scientific). PCR was performed with tRNA[Ser]Sec sense (5’-GCGCCACGATGAGCTCAGCTG-3’) and tRNA[Ser]Sec antisense (5’-CACCACAAAGGCCGAATCGAAC-3’) oligonucleotides.

Fluorescence microscopy

pan class="Species">T. brucei cell lines expressing PTP-tagged proteins were used for immunolocalization assays. Briefly, 5 × 106 cells were washed with PBS buffer pH 7.4 (SIGMA), fixed with 2% v/v paraformaldehyde for 20 min at 4°C, permeabilized with 0.3% v/v Triton X-100 for 3 min at 4°C. Cells were blocked with 3% w/v BSA and incubated with 1:16,000 v/v rabbit anti-protein A antibody (SIGMA) for 1 h at room temperature. After washes, cells were incubated with 1:400 (v/v) Alexa Fluor 594-conjugated (Invitrogen) and 10 μg/mL DAPI (SIGMA) at room temperature. The coverslips were mounted on glass slides with Vectashield mounting medium (Vector Laboratories) and images obtained with Olympus IX-71 (Olympus) inverted microscope coupled Photometrix CoolSnapHQ CCD camera were further deconvoluted using DeltaVision (Applied Precision) software.

Multiple amino acid sequence alignment.

Conpan class="Chemical">served residues are highlighted (catalytic Cys/Sec in yellow and Lys in green, and ATP binding amino acids in red). Secondary structures are also shown (arrow: α-helix; rectangle: β-strand). Amino acid sequences: Lm–L. major (XP_001687128.1), Tb–T. brucei (EAN78336.1), Tc–T. cruzi (PBJ75389.1), Pi–Phytophthora infestans (EEY58478.1), Dm—Drosophila melanogaster (Dm_1: AAB88790.1, Dm_2: NP_477478.4), Mm—Mus musculus (Mm_1: AAH66037.1, Mm_2: AAC53024.2), Hs–Homo sapiens (Hs_1: AAH00941.1, Hs_2: AAC50958.2), Ps—Pseudomonas savastanoi (EFW86617.1), Aa–Aquifex aeolicus (WP_010880640.1), Ec—Escherichia coli (KPO98227.1).

(TIF)

Click here for additional data file.

Electrophoresis.

A- Coomassie blue-stained native gel electrophoresis of pan class="Species">T. brucei and L. major selenophosphate synthetase constructs: 1- TbSEPHS2, 2- ΔN(70)-TbSEPHS2, 3- ΔN(25)-TbSEPHS2, 4- LmSEPHS2, and 5- ΔN(69)-LmSEPHS2. Major bands correspond to dimers. The second most abundant species in each lane corresponds to the respective tetramer. B- Coomassie blue-stained SDS-PAGE of T. brucei selenocysteine lyase.

(TIF)

Click here for additional data file.

Sedimentation equilibrium analytical ultracentrifugation (SE-AUC).

Multi-speed and multi-concentpan class="Species">ration global fitting for a dimer-tetramer self-association system of A- TbSEPHS2 (Kd = 161 ± 10 μM) and B- LmSEPHS2 (Kd = 178 ± 10 μM). Fitting residuals are shown as insets.

(TIF)

Click here for additional data file.

Circular dichroism (CD) spectroscopy.

CD spectra for A- pan class="Chemical">selenophosphate synthetase constructs (TbSEPHS2, ΔN(25)-TbSEPHS2, ΔN(70)-TbSEPHS2, LmSEPHS2 and ΔN-LmSEPHS2, and B- T. brucei selenocysteine lyase (TbSCLY).

(TIF)

Click here for additional data file.

ITC.

A- Ipan class="Species">TC data for SCLY-buffer (circle), buffer-SEPHS2 (triangle) and SEPHS2-SCLY (star), and B- SCLY-ΔN(70)-SEPHS2 titration experiments using VP-ITC calorimeter and analyzed in NITPIC.

(TIF)

Click here for additional data file.

Selenocysteine pathway machinery localization in procyclic T. brucei cells.

PTP-tagged proteins immunolocalized using anti-protein A antibody (red). pan class="Chemical">DAPI (blue) is used as a nuclear/kinetoplast marker. Untransfected procyclic pan class="Species">T. brucei 427 cells were used as negative controls.

(TIF)

Click here for additional data file.

Mass spectrometry identification of co-eluted proteins with selenocysteine machinery components.

(XLSX)

Click here for additional data file.

Raw data.

(XLSX)

Click here for additional data file.

29 Apr 2020

Dear Dr Thiemann,

Thank you very much for submitting your manuscript "pan class="Species">Trypanosomatid selenophosphate synthetase structure, function and interaction with selenocysteine lyase" for consideration at PLOS Neglected Tropical Diseases. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments. The reviewers raised major concerns regarding the presentation and interpretation of results and the Discussion section.

We cannot make any decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is also likely to be sent to reviewers for further evaluation.

When you are ready to resubmit, please upload the following:

[1] A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

[2] Two versions of the revised manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).

Important additional instructions are given below your reviewer comments.

Please prepare and submit your revised manuscript within 60 days. If you anticipate any delay, please let us know the expected resubmission date by replying to this email. Please note that revised manuscripts received after the 60-day due date may require evaluation and peer review similar to newly submitted manuscripts.

Thank you again for your submission. We hope that our editorial process has been constructive so far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Igor C. Almeida

Associate Editor

PLOS Neglected Tropical Diseases

Hans-Peter Fuehrer

Deputy Editor

PLOS Neglected Tropical Diseases

***********************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: Methodology is generally sound.

For minor issues, see section 'Editorial and Data Presentation Modifications'.

Reviewer #2: The objectives and methodological design of the study are clear and suited to adress the first.

Some concerns are outlined in the sections below.

Reviewer #3: (No Response)

--------------------

Results

-Does the analysis presented mapan class="Species">tch the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: The analysis mapan class="Species">tches the analysis plan. The results are in general clear and completely presented, and the figures are clear besides some minor issues.

For detailed, minor issues, see section 'Editorial and Data Presentation Modifications'.

Reviewer #2: The results mapan class="Species">tch the analysis plan however some results are not properly presented (see comments below). Figures and images are well presented (see minor comments in Section Data Presentation Modifications).

- the truncated form of pan class="Gene">SEPHS2 was cryztallized as a monomer, however, in solution, the protein appears to display a dimeric arrangement. May the author comment whether the N-terminal portion of SEPHS2 contributes to protein dimerization?, another question, is wether the disordered N-terminal region of SEPHS2 may contribute to an anomalous behavior of the protein in solution; May the autors add to the Table from Fig. 1G the theoretical sedimentation coefficient expected for a SEPHS2 monomer?

- please indicate in the legend of Fig 3C the concentpan class="Species">ration of each protein species used for the titpan class="Species">ration as well as the corresponding mass centers of the spectrum for each condition tested. protein

- please indicate whether single clones or whole population of pan class="Gene">SEPHS2- and pan class="Gene">SELENOT-RNAi T. bruce were subjected to phenotypic analysis.

- please check the following text because the references to Figs appears to be missquoted "Interestingly, pan class="Gene">SELENOT-RNAi-induced pan class="Chemical">PCF cells were more sensitive to TN

than pan class="Chemical">DTT (Figures 6F and 6H). On the other hand, sensitivity to different concentrations of DTT

varied in pan class="Gene">SELENOT-RNAi- BSF pan class="Species">T. brucei, with induced cells being more sensitive to 350-400 uM

pan class="Chemical">DTT. No significant effect was observed in the presence of TN (Figure 6E-H)." BSF T. brucei depleted in SELENOT did not show any significant sensitivity towards DTT or TN, when compared to non-induced parasites.

- for the following sentence: "Treatment with different concentpan class="Species">rations of hydrogen peroxide did not affect T. brucei growth (Figure 6J-K),", please highlight that such conclusion is valid for both parasite life stages: PCF and BSF.

Reviewer #3: (No Response)

--------------------

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: The conclusions drawn from the data are in general warranted. The Discussion is detailed, appropriate and places the result in the biological context.

For detailed, minor issues, see section 'Editorial and Data Presentation Modifications'.

Reviewer #2: Most conclusions are correct, except for some related to the biological results obtained with different RNAi cell lines. For instance, some conclusions related to the sensitivity of the RNAi cell lines towards pan class="Chemical">DTT or pan class="Chemical">tunicamycin are somehow (and likely unvoluntary) missleading.

The limitations of the present study and the ppan class="Chemical">rospective for new assays demanded to solve some questions are well identified by the authors.

For instance, in the Synopsis and in the Conclusions it is pan class="Disease">stressed the concept that "Our results also show how the interaction of different proteins leads to the protection of the cell against the toxic effects of seleium compounds during selenocysteine synthesis". I disagree wit this statement since depletion of SEPHS, which should lead to an accumulation of toxic selenium, proved not to entail any detrimental effect on procyclic and bloodstream T. brucei (Ref. 11 and 27). Even for both parasite stages of T. brucei, the KO of SEPSECS, which should lead to an accumulation of toxic selenium metabolites, did not render a defective phenotype in vitro and in vivo (Ref. 11, 27, 28). Instead, may it be possible that the SEPHS2/SCLY complex warrants an efficient recycling of the trace element Selenium?

- Please revise the following statement "Here, we demonstpan class="Species">rated that ER pan class="Disease">stress

with pan class="Chemical">DTT and TN upon TbSEPHS2 ablation leads to growth defects in both PCF and BSF T. brucei,

indicating a role for pan class="Chemical">TbSEPHS2 in the ER pan class="Disease">stress response.", because the experimental data presented for BSF and TN do not support such conclusion.

- Please revise the following statement "Indeed, we obpan class="Chemical">served that SELENOT knockdown PCF and BSF T. brucei cells were also sensitive to ER stress using DTT,...". This is not true because data presented in Fig. 6 shows that BSF depleted in SELENOT are fully insensitive to TN and DTT treatment, and PCF showed a marginal sensitivity towards these stressors at single (out of three) concentrations tested. Thus, the behavior was not concentration-dependent and thus, probably irrelevant. If the authors agree with that, then, they should reconsider not to stress, along the text, a role for SELENOT in ER redox homeostasis, as their data are not fully conclusive in this respect.

- There is not direct evidence from the biological data produced in this study to support the following statement "Our data suggests that ER N-glycosylation of proteins is strictly regulated in pan class="Species">trypanosomatids." First, because non of the protein studied in this work was shown to be localized at the ER; second, because the impact on N-glycosylation of downregulating Sel-metabolism in pan class="Species">T. brucei has not been addressed in this study.

Reviewer #3: (No Response)

--------------------

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: A general comment: Next time, please number pages and/or lines to make the work of reviewers a bit easier.

Scientific issues:

1. Abstract, line 1: The description ‘early-branching eukaryotes’ is outdated since it is known, since about two decades, that they did not branch early from a common eukaryotic phylogenetic trunk as previously thought. The current view is that different superphyla originated already at the beginning of the eukaryotic evolution (LECA) and n class="Species">trypanosomatids belong to a different superphylum (Excavata) than vertebrates/fungi (Opisthokonta).

2. Abstract, line 17: Should the sentence not state ‘only pan class="Gene">SELENOT-RNAi procyclic T. brucei cells were sensitive’ (as opposed to bloodstream cells)? Nonetheless, I am not convinced by the conclusion, because the effect of DTT between induced and non-induced cells seems only significant for one DTT concentration used, not for the other two (see also related comments below).

3. Introduction, end of 4th paragraph: Mention if the pan class="Chemical">TbSEPHS2 RNAi experiments were done with both pan class="Chemical">PCF and BSF cells.

4. Introduction, 6th paragraph, line13: Same as above: I am not convinced by the conclusion, because the effect of pan class="Chemical">DTT between induced and non-induced cells seems only significant for one pan class="Chemical">DTT concentration used.

5. Results, Section 1 (The L. major pan class="Chemical">selenophosphate synthetase ..), end of paragraph 2: What is the basis for the conclusion that ‘Our crystal structure suggests that the conserved AIRS-like fold of selenophosphate synthetases is necessary for their enzymatic mechanism.’? Or did the authors meant to conclude: ‘Our finding that the AIRS-like fold of selenophosphate synthetases is also conserved in our Leishmania crystal structure suggests its necessity for the enzymatic mechanism.’?

6. Results, Section 1, last sentence: I suppose a pan class="Chemical">sulfate ion was identified in the crystal structure. Could it be highlighted in the cartoon representation (with its mentioning in the legend)? Moreover, it seems relevant to add the information also in the legend of Fig. S1.

7. Results Section 4 (pan class="Chemical">TbSEPHS2 RNAi-induced …..) and Fig. 5: The observation that low concentrations (0.15-0.30 mM) of DTT affect growth in TbSEPHS2 RNAi-induced BSF cells, but a higher concentration (0.45 mM) not (and all concentrations do in PCF cells) is intriguing and may deserve further discussion.

8. Results Section 5 (pan class="Gene">Selenoprotein T (SELENOT)): The second part of this section is not easy to follow. I have the impression that, both in the text and the legend, the labelling of panels E – H has been mixed up. My understanding is that panels E and G are about PCF cells and F and G about BSF cells (= similar organization of panels as in Figure 5).

In that case, the text should probably changed as follows:

line 11: ‘(Figures 6E and 6G)’ to ‘(Figures 6E – 6H)’

line 12: ‘(Figures 6F and 6H)’ to ‘(Figures 6E and 6G)’

line 14: add ‘(Figure 6E-H)’ after ‘pan class="Chemical">DTT’

line 14: ‘(Figure 6E-H)’ to ‘(Figure 6F and 6H)’

and the following change in the legend, line 8:

‘E- and F- pan class="Chemical">PCF T. brucei cells’ to ‘E- and G- PCF T. brucei cells’

‘G- and H- BSF pan class="Species">T. brucei cells’ to ‘F- and H- BSF pan class="Species">T. brucei cells’

Furthermore, I am puzzled by two issues in this section:

(1) The conclusion mentioned in the Abstract and the end of the Introduction about the sensitivity of RNAi-ablated pan class="Chemical">PCF cells for pan class="Chemical">DTT (although only significant at one concentration) is surprisingly not addressed in this section.

(2) I don’t see how to conclude from Fig. 6 (panel F?) that ‘On the other hand, sensitivity to different concentpan class="Species">rations of DTT varied in SELENOT-RNAi- BSF T. brucei, with induced cells being more sensitive to 350-400 uM’. First, there seem no significant difference between induced and non-induced cells. Second, the figure mentioned 0.60 mM, not 0.40 mM.

9. Discussion: The sentence ‘Here, we demonstpan class="Species">rated that ER stress with DTT and TN upon TbSEPHS2 ablation leads to growth defects in both PCF and BSF T. brucei, indicating a role for TbSEPHS2 in the ER stress response.’ is not entirely accurate. As demonstrated in Fig. 5D (and correctly mentioned elsewhere in the manuscript), TN does not have such effect in BSF trypanosomes.

10. Discussion: About the sentence ‘Indeed, we obpan class="Chemical">served that SELENOT knockdown PCF and BSF T. brucei cells were also sensitive to ER stress using DTT, ….’, see my comments above (for PCF cells only significant at one concentration (Fig 6E), for BSF cells results seem not convincing at all (Fig. 6F)).

11. Figure 1: in the various cartoons a loop is highlighted with X. Please explain in the legend.

Minor comments on the biological nomenclature used:

1. Synopsis, lines 3 and 6 and Introduction line 1: Replace the old, incorrect word ‘protozoa’ by ‘protists’ (‘parasitic protists’ or ‘protist parasites’).

2. Introduction, line 1 of 5th paragraph: Change old taxonomic name ‘Kinetoplastida’ to the correct ‘Kinetoplastea’.

3. Introduction, 6th paragraph, lines 1 and 2: no upper case E for the (English) word eukaryotes.

4. M&M, RNAi experiments: ‘host strain 29-13’. 29-13 is not a strain but a cell line derived from strain 427.

5. M&M, RNAi experiments: ‘strain 221’. 221 is not a strain but a VAT (Variant Antigen Type expressing VSG no 221) from strain 427.

Minor comments on the presentation:

1. Abstract, line 2: Add s to parasite to give parasites.

2. Abstract, lines 12-13: Sentence not very clear. Is meant: ‘….. phosphopan class="Chemical">seryltRNA Sec kinase (PSTK)-Sec-tRNASec synthase (SEPSECS) complex and the tRNASec-specific elongation factor (eEFSec)-ribosome complex’? If so add ‘complex’ (2x).

3. Abstract line 13: add h to ‘pan class="Chemical">ditiothreitol’ to give ‘pan class="Chemical">dithiothreitol’

4. Introduction, end 2nd paragraph: Change ‘a detailed …. network and … mechanism … remain poorly understood’ to ‘details of …. remain poorly understood’.

5. Introduction, 5th paragraph, line 12: change ‘result’ to ‘results’.

6. Introduction, 5th paragraph, line 17: add ‘of’ to give ‘decrease of mitochondrial’

7. Introduction, 6th paragraph, line5: Add ‘The to give ‘pan class="Chemical">TbSEPHS2 crystal structure ….’

8. Results, Section 1 (The L. major pan class="Chemical">selenophosphate synthetase ..), line 6: Change A to Å.

9. Results, Section 1, line 27: Fig. 1H is not found.

10. Results, Section 3 (pan class="Species">T. brucei SEPHS2 binds …), line 8: add, after ITC: ‘(not shown)’

11. Results, Section 3, line 12: Why ‘Remarkably’ which suggests some surprise? Would ‘Importantly’, or ‘Noteworthy’ not be better?

12. Results, Section 3,lines 26 and 27: Are (Figure 3E) in line 26 and (Figure 3D) in line 27 not swapped?

13. Results, Section 3, line 37: Change ‘present pan class="Species">mammalian in’ to ‘present in pan class="Species">mammalian’

14. Results, Section 3, line 39: (Figure 4C) should be (Figure 4D), whereas in line 41 (Figure 4D) should be (Figure 4E)

15. Legend Fig 1, line 9: Correct ‘sedmentation’ to ‘sedimentation’

16. Legend Fig 1, line 11: Change ‘inpan class="Chemical">sert’ to ‘inset’.

17. Legend Fig 2, line 4: Correct ‘defficient’ to ‘deficient’

18. Legend Fig 4, line 3: Correct ‘riobosome’ to ‘ribosome’

19. Legend Fig 6, line 13: Change 0 in pan class="Chemical">H202 to O

20. M&M, at several places: ‘xx mM de pan class="Chemical">HEPES’. What is de meaning of ‘de’? (see sections: Recombinant protein purification, Size exclusion chromatography, Fluorescence spectpan class="Chemical">roscopy)

21. M&M, RNAi experiments: SM-9? Should this not be pan class="Chemical">SM-79 (the medium described for PCF T. brucei by Brun & Schonenberger, Acta Trop, 1979).

22. M&M, RNAi experiments, line 10: Change ‘it was used the protocol described’ to ‘the protocol used has been described’

23. M&M, RNAi experiments, line 11: Change ‘sum’ to ‘summary’

24. M&M, RNAi experiments, line 3 from end: Delete d from ‘induced’

25. M&M, PTP-tag TAP, line 7: Change ‘digest’ to its plural form

26. Legend Fig. S1: Mention the indications for secondary structures

27. Legend Fig. S3, line 4: Change ‘inpan class="Chemical">sert’ to ‘inset’

Reviewer #2: Rephrase the following sentences, all of which are confusing:

- "pan class="Chemical">TbSEPHS2 crystal structure we determined demonstrates that a conserved fold is important for its function."

-

Figure 1D is not quoted in the main text. It may removed, or, instead, the B-factors can be shown in the structure shown in Fig1A.

- Fig. S5 should be quoted in the following sentence: "Additionally, we obpan class="Chemical">served that ΔN(70)-TbSEPHS2 does not bind TbSCLY as measured by ITC, indicating that the N-terminal region is necessary for in vitro interaction,..."

- In the following sentence, "... for TbeEFSec-PTP (Figure 3E). RT-PCR analysis revealed that tRNA[pan class="Chemical">Ser]Sec co-precipitates with the TbPSTK-PSEPSECS complex and with TbeEFSec (Figure 3D).", swap the quotation to Fig3E and Fig3D, and in the legend of Fig3E, please explain what does input mean.

- In teh following sentence "Besides, they are representatives of the pan class="Species">Trypanosomatidae

family that is evolutionarily distant from the most...", the word "representative" may be replaced by "belong to".

- "SELNOT" should be replaced by "pan class="Gene">SELENOT" in the following sentence "Interestingly, SELNOT knockout led to early rat embryonic lethality and its knockdown in corticotrope"

Reviewer #3: (No Response)

--------------------

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: The manuscript by Thiemann and coworkers provides a lot of new information about proteins involved in pan class="Chemical">selenocysteine biosynthesis in Leishmania and Trypanosoma, especially about the selenophosphate synthetase of these parasitic protists. The work builds upon previous research by this group. The information is novel and interesting. The research has been well performed and the results are discussed in great detail and placed in context. The manuscript has been well written. Nonetheless, I have a number of comments, questions and suggestions concerning the scientific content, and identified a number of minor issues about the presentation.

Reviewer #2: The study by da Silva et al. addresses structural, biochemical and biological aspects of several components of the n class="Chemical">selenocysteine metabolism of African trypanosomes. Following the sucessfull crystallization of the selenophosphate synthase, they solve and describe the 3D structure of an N-terminally truncated for of this protein. They investigated the quaternary arrangement of the protein by means of ultracentrifugation and gel filtration approaches, and showed in vitro and in cell the formation of an heterocomplex between the selenophosphate synthase, with selenocystein synthase. Using heterologous-complementation assays, they also demonstrate the residues and regions functionally relevant for selenophosphate synthase activity. Finally, they addressed a potential role of the selenophosphate synthase and the selenocysteine-containing protein SELENOT in the response to reductive stress.

Overall, the methodological stpan class="Species">rategy and results are consistent with most of the conclusions elaborated. At some point the authors should make clear why this metabolism deserves interest, taking into account that it has been shown not to be indispensable for the in vitro and in vivo survival of the clinically relevant stage of African trypanosomes (as well as for the insect stage). Is there any possibility that this metabolism may play a role during parasite differentiation?

At several part of the Result and Discussion sections there is redundancy in the presentation and discussion of the results. I would recommend that the authors make an effort to limit themselves to simply describe and interpret the results without major framework discussion.

Reviewer #3: (No Response)

--------------------

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this chopan class="Chemical">ice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Paul Michels

Reviewer #2: No

Reviewer #3: No

Figure Files:

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (pan class="Chemical">PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.

Data Requirements:

Please note that, as a condition of publication, PLOS' data policy requires that you make available all data used to draw the conclusions outlined in your manuscript. Data must be deposited in an appropriate repository, included within the body of the manuscript, or uploaded as supporting information. This includes all numerical values that were used to genepan class="Species">rate graphs, histograms epan class="Species">tc.. For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5.

Reproducibility:

To enhance the reproducibility of your results, PLOS recommends that you deposit labopan class="Species">ratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see https://journals.plos.org/plosntds/s/submission-guidelines#loc-methods

Submitted filename: renamed_cca5f.docx

Click here for additional data file.

29 Jun 2020

Submitted filename: PNTD_D_19_02165_Response.docx

Click here for additional data file.

3 Aug 2020

Dear Dr Thiemann,

We are pleased to inform you that your manuscript 'pan class="Species">Trypanosomatid selenophosphate synthetase structure, function and interaction with selenocysteine lyase' has been provisionally accepted for publication in PLOS Neglected Tropical Diseases.

Before your manuscript can be formally accepted you will need to complete some formatting changes, which you will receive in a follow up email. A member of our team will be in touch with a set of requests.

Please note that your manuscript will not be scheduled for publication until you have made the required changes, so a swift response is appreciated.

IMPORTANT: The editorial review process is now complete. PLOS will only permit corrections to spelling, formatting or significant scientific errors from this point onwards. Requests for major changes, or any which affect the scientific understanding of your work, will cause delays to the publication date of your manuscript.

Should you, your institution's press offpan class="Chemical">ice or the journal offpan class="Chemical">ice choose to press release your paper, you will automatically be opted out of early publication. We ask that you notify us now if you or your institution is planning to press release the article. All press must be co-ordinated with PLOS.

Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Igor C. Almeida

Associate Editor

PLOS Neglected Tropical Diseases

Hans-Peter Fuehrer

Deputy Editor

PLOS Neglected Tropical Diseases

***********************************************************

Reviewer's Responses to Questions

Key Review Criteria Required for Acceptance?

As you describe the new analyses required for acceptance, please consider the following:

Methods

-Are the objectives of the study clearly articulated with a clear testable hypothesis stated?

-Is the study design appropriate to address the stated objectives?

-Is the population clearly described and appropriate for the hypothesis being tested?

-Is the sample size sufficient to ensure adequate power to address the hypothesis being tested?

-Were correct statistical analysis used to support conclusions?

-Are there concerns about ethical or regulatory requirements being met?

Reviewer #1: OK

Reviewer #2: (No Response)

Reviewer #3: (No Response)

**********

Results

-Does the analysis presented mapan class="Species">tch the analysis plan?

-Are the results clearly and completely presented?

-Are the figures (Tables, Images) of sufficient quality for clarity?

Reviewer #1: OK

Reviewer #2: (No Response)

Reviewer #3: (No Response)

**********

Conclusions

-Are the conclusions supported by the data presented?

-Are the limitations of analysis clearly described?

-Do the authors discuss how these data can be helpful to advance our understanding of the topic under study?

-Is public health relevance addressed?

Reviewer #1: OK

Reviewer #2: (No Response)

Reviewer #3: (No Response)

**********

Editorial and Data Presentation Modifications?

Use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity. If the only modifications needed are minor and/or editorial, you may wish to recommend “Minor Revision” or “Accept”.

Reviewer #1: OK

Reviewer #2: (No Response)

Reviewer #3: (No Response)

**********

Summary and General Comments

Use this section to provide overall comments, discuss strengths/weaknesses of the study, novelty, significance, general execution and scholarship. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. If requesting major revision, please articulate the new experiments that are needed.

Reviewer #1: The authors have appropriately dealt with all my comments on the original version of their manuscript.

Reviewer #2: The authors proceedded with the requested changes and answered satisfactory all the questions raised in my revision.

There are still present a few typing mistakes that can be identified and corrected upon a carefull reading by the authors.

Reviewer #3: Overall, I was satisfied with the answers to my comments, and in my opinion, the quality of the manuscript has also increased significantly after incorpopan class="Species">rating all the recommendations of other reviewers. In conclusion, the manuscript meets all the criteria for publishing in PLOS Neglected Tropical Diseases.

**********

PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this chopan class="Chemical">ice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Paul Michels

Reviewer #2: Yes: Marcelo A. Comini

Reviewer #3: No

29 Sep 2020

Dear Dr Thiemann,

We are delighted to inform you that your manuscript, "pan class="Species">Trypanosomatid selenophosphate synthetase structure, function and interaction with selenocysteine lyase," has been formally accepted for publication in PLOS Neglected Tropical Diseases.

We have now passed your article onto the PLOS Production Department who will complete the rest of the publication process. All authors will receive a confirmation email upon publication.

The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Editorial, Viewpoint, Symposium, Review, epan class="Species">tc...) are genepan class="Species">rated on a different schedule and may not be made available as quickly.

Soon after your final files are uploaded, the early version of your manuscript will be published online unless you opted out of this process. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.

Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Neglected Tropical Diseases.

Best regards,

Shaden Kamhawi

co-Editor-in-Chief

PLOS Neglected Tropical Diseases

Paul Brindley

co-Editor-in-Chief

PLOS Neglected Tropical Diseases