Lyme disease and relapsing fever in Mexico: An overview of human and wildlife infections.

Lyme borreliosis and Relapsing fever are considered emerging and re-emerging diseases that cause major public health problems in endemic countries. Epidemiology and geographical distribution of these diseases are documented in the US and in Europe, yet in Mexico, studies are scarce and scattered. The aims of this study were (1) to present the first confirmatory evidence of an endemic case of Lyme disease in Mexico and (2) to analyze the epidemiological trend of these both diseases by compiling all the information published on Borrelia in Mexico. Two databases were compiled, one of human cases and another of wild and domestic animals in the country. The analysis included the evaluation of risk factors for the human population, the diversity of Borrelia species and their geographic distribution. Six Borrelia species were reported in a total of 1,347 reports, of which 398 were of humans. Women and children from rural communities were shown to be more susceptible for both Lyme borreliosis and Relapsing fever. The remaining reports were made in diverse mammalian species and ticks. A total of 17 mammalian species and 14 tick species were recorded as hosts for this bacterial genus. It is noteworthy that records of Borrelia were only made in 18 of the 32 states, mainly in northern and central Mexico. These results highlight the importance of performing further studies in areas where animal cases have been reported, yet no human studies have been done, in order to complete the epidemiological panorama for Lyme borreliosis and Relapsing fever. Finally, the search for Borrelia infections in other vertebrates, such as reptiles and amphibians is recommended to gain a more accurate view of Borrelia species and their distribution. The geographical approach presented herein justifies an intense sampling effort to improve epidemiological knowledge of these diseases to aid vector control and prevention programs.

Introduction

Tick-borne pathogens (TBP) have become a public health problem due to the continuous rise in the incidence of human and animal diseases associated with TBPs [1]. Some TBPs that can affect both humans and animals include several bacterial members of the genus Borrelia [1-3]. This bacterial genus comprises various spirochetal Gram-negative species that are divided into four phylogenetic groups: reptile-associated Borrelia (REP), monotreme-associated Borrelia (MAB), relapsing fever (RF) and Lyme-borreliosis (LB) [4-6]. The pathogenic species for humans of this bacterial genus are found only in the RF and LB groups [2, 5, 7].

Taxonomically, species of the genus Borrelia were initially considered as part of the genus Spirochaeta, but in 1907 the genus was divided and the genus Borrelia was formally described [8]. For more than a century, there were no important taxonomic changes. However in 2014, phylogenomic and protein studies led to the proposal of creating a new genus for members of the LB group (Borreliella) [9]. Further studies on the percentage of conserved proteins were proposed as a suitable method to delimitate the bacterial genera and the genus Borrelia was again proposed as a monophyletic genus [10]. To date, controversy remains on whether the genus should be divided [11, 12].

The Borrelia species causing RF are mainly transmitted by soft argasid ticks of the genus Ornithodoros and the human body louse Pediculus humanus, even though hard ticks of the genera Ixodes, Amblyomma and Rhipicephalus have also been implicated as potential vectors [13-15]. To date, 27 Borrelia species and two Candidatus species have been described as members of this monophyletic group [3, 15]. Of these, 24 and one Candidatus species have been recognized as pathogens for humans and/or other mammalian orders (Table 1) [3].

Table 1

Pathogenic Borrelia species.

Borrelia group	Species	Region/Country	Disease	References
RF	Borrelia baltazardii	Iran	TBRF (Tick-borne relapsing fever)	[21]
	Borrelia braziliensis	Brazil	TBRF	[15, 22]
	Borrelia caucasica	Caucasus area	TBRF	[23]
	Borrelia coriaceae	Western North America	Bacteremia of deer	[15, 24]
	Borrelia crocidurae	Western and northern Africa	TBRF, mild symptoms	[3, 15, 25]
	Borrelia dugesii	Mexico	TBRF	[26]
	Borrelia duttonii	Central, eastern and southern Africa	TBRF, Neurological signs, neonatal infections	[3, 15, 27]
	Borrelia graingeri	Kenya	Flu-like syndrome	[28, 29]
	Borrelia harveyi	Kenya	Bacteremia of monkeys	[15, 30]
	Borrelia hermsii	Western North USA, Brirish Columbia (Canada)	TBRF	[15, 31, 32]
	Borrelia hispanica	Iberian Peninsula and northern Africa	TBRF	[15, 33]
	Borrelia latyschewii	Central Asia and Middle East	TBRF, Flu-like syndrome	[15, 34]
	Borrelia lonestari	Southern and eastern United States	Bacteremia of deer	[15, 35]
	Borrelia mazzottii	Mexico, Central America and Western USA	TBRF	[15, 26]
	Borrelia microti	Iran	TBRF	[15, 36]
	Borrelia miyamotoi	Europe, Asia and North America	TBRF, Flu-like syndrome	[15, 37]
	Borrelia parkeri	Western USA	TBRF	[15, 32]
	Borrelia persica	Central Asia, Middle East, Egypt and India	TBRF	[15, 38]
	Borrelia queenslandica	Australia	Bacteremia with relapse in mice	[3]
	Borrelia recurrentis	Africa (Global)*	Louse-borne relapsing fever	[3, 39]
	Borrelia theileri	Africa (Global)**	Bovine borreliosis	[15, 40]
	Borrelia turicatae	British Columbia (Canada), Southwestern and south-central United States and Mexico	TBRF	[15, 41]
	Borrelia venezuelensis	Central America and northern South America	TBRF	[3, 42]
	Candidatus Borrelia kalaharica	Africa	TBRF	[43, 44]
LB	Borrelia afzelii	Europe and Asia	Lyme Disease (LD)	[45]
	Borrelia americana	North America	LD	[46]
	Borrelia andersonii	US	LD	[47]
	Borrelia bavariensis	Europe	Lyme borreliosis	[48]
	Borrelia bissettii	North America and Europe	LD	[49]
	Borrelia burgdorferi s.s.	East and West United States and Eastern Europe	LD	[50]
	Borrelia garinii	Europe and Asia	LD	[51]
	Borrelia lusitaniae	Mediterranean basin	LD	[52]
	Borrelia mayonii	Upper midwestern US	Lyme borreliosis	[20]
	Borrelia spielmanii	Europe	LD	[53]
	Borrelia valaisiana	Europe and Japan	LD	[54]

* B. recurrentis human cases have been reported in Ethiopia and Sudan, however a worldwide distribution is suspected.

** B. theileri cases have been reported in Africa, Australia, North and South America, but due to global bovine trade, it is now considered to be globally distributed.

The Borrelia species that cause LB are grouped into 22 species [16], which are clustered into a monophyletic group. Of these, 11 species have been found to be the etiological agents of Lyme borreliosis, also known as Lyme disease (Table 1) [2, 17–20]. The competent vectors of these bacterial species are hard ixodid ticks [2, 17].

In Mexico, information on the diversity of Borrelia species, of wildlife infections and of human cases remains controversial [55-57]. The current information on this genus is poorly scattered and often published in local bulletins lacking diffusion. Furthermore, no confirmatory evidence of endemic human cases of Lyme disease has been shown in Mexico. Therefore, new insights and more solid evidence of human and animal infections with Borrelia are needed to elaborate an actualized map of these bacteria in Mexico.

Thus, the aim of this study was to: A) present to first confirmatory report of an endemic human case of Lyme disease in Mexico, and B) compile all the published records of human and animal infections by Borrelia in Mexico, to give an accurate picture of the current epidemiological situation of the genus Borrelia in the country.

A) Case report

Clinical summary and test procedures

A 67 years-old, unemployed male patient sought medical attention in August 2017. He was born in the coastal state of Veracruz, Mexico, where his family has a cattle farm. He had a previous history of Brucellosis at age 38. Diabetes had been diagnosed 15 years prior to the current office visit and had been irregularly controlled. He was hypertensive and treated with amlodipine, valsartan and hydrochlorothiazide. He had a history of multiple trips to the State of Veracruz, during which he had seen cattle infested with ticks. After visiting the family farm in the northern part of Veracruz in August 2016, he developed a red skin lesion that lasted several weeks, yet the patient did not seek medical attention. He started having diplopia and fatigue in September 2016. This evolved to stabbing headaches, cramps and pain in his limbs, bilateral hypoesthesia in hands and feet (in gloves and socks) and tachycardia. After having lost 15 Kg, he was hospitalized in March 2017, showing distal strength decrease +/+++ in lower limbs and sensitivity decrease in all modalities (exteroceptive and proprioceptive). A lumbar puncture was performed, and the spinal fluid showed xanthochromia, glucose 69%, proteins 305 mg/ml, 98 mononuclear and 2 polymorphic nuclear cells (PMN)/μl. He received treatment with ceftriaxone and prednisolone (PDN) for two weeks. The headache remitted, the remaining symptoms improved by 70% and he was able to walk and climb stairs.

In August 2017, he again sought medical attention because symptoms restarted, he reported fatigue, diplopia and bilateral hypoesthesia in hands and feet (in gloves and socks), that made walking clumsy and difficult, fine tremor in his hands and short-term memory loss. On physical exam there was generalized areflexia, no meningeal signs and diminished strength in both lower limbs. He was again hospitalized and blood (5 ml) was taken in 2 vacutainer tubes, one with and one without ethylenediaminetetraacetic acid (EDTA). The sera samples were centrifuged at 2,000 rpm during 10 min and stored at -20°C until use. DNA of whole blood samples was extracted by columns (DNEasy Blood and Tissue Kit, QIAGEN Inc., DEU), quantified with a spectrophotometer (Nanodrop-1000, Thermo Fisher, USA) and adjusted to a final concentration of 300 ng. Serological analysis was done by Western blotting using anti-Borrelia burgdorferi-WESTERNBLOT IgM and IgG kits (EUROIMMUN, Medizinische Labordiagnostik AG, D-23560 Lübeck, DEU), following instructions of the manufacturer. For molecular detection of Borrelia, a ~280 bp fragment of the flagellin protein gen (fla) was amplified by conventional PCR [58]. The reaction mixture consisted of 12.5 μl GoTaq® Green Master Mix, 2X (Promega Corporation, Madison, WI, USA), 2μM of each pair of primers, 6.5 μl nuclease-free water and 50 ng DNA in a final volume of 25 μl [58]. Negative and positive controls were included. As positive control, DNA from Borrelia previously isolated from Amblyomma dissimile (Colunga-Salas et al. unpublished data, GenBank accession number KY389373) was used. PCR product was visualized in 2% agarose gels with SmartGlow™ Pre-Stain (Accuris Instruments, Edison, NJ, USA) and visualized by UV-transillumination.

A written informed consent was signed by the patient, who was informed of the publication of his case.

Results

The serological analysis by Western blotting was positive for IgG and indeterminate for IgM. The PCR product showed a band of ~280 bp. Sequencing of the PCR product was done at Laboratorio de la Biodiversidad y la Salud, Instituto de Biología, Universidad Nacional Autónoma de México. The sequence was deposited in GenBank with the accession number MN607028. Molecular identification of the patient isolate was done by editing and aligning the sequences manually, including other species of the LB group. Bayesian analysis in MrBayes 3.2.3 [59] was done using the Markov Chain Monte Carlo (MCMC) algorithm with 10,000,000 generations and sampling every 1,000 generations, with a burning of 25% and the substitution model (Hasegawa, Kishino, and Yano model with gamma distribution [HKY+G] [60]) calculated in JModelTest 2 [61] based on the Bayesian Information Criterion. The convergence of the phylogenetic analysis was checked and considered as good when the ESS was higher than 200, in Tracer 1.7.1 [62].

The molecular confirmation by PCR showed that this patient was positive for B. burgdorferi s.s. (Fig 1), with a posterior probability of 0.96. The BLAST analysis showed 100% of identity and e value of 4e-133 with sequences of Borrelia burgdorferi s.s including those belonging to the strain B31 (Accession numbers: CP019767, AE000783, AB035617, X15661, L29200, AF416433 and Y15088) and other North American sequences. This result represents the first confirmed human autochthonous case of Lyme disease and includes the first available Borrelia sequence of Mexico.

Fig 1

Phylogenetic reconstruction for flagellin gene fragment of the Mexican patient with Lyme disease and of several members of the genus Borrelia.

The phylogenetic relationships were inferred by Bayesian Inference based on the HKY+G substitution model with a total of 255 bp. Posterior probabilities >0.5 are indicated at nodes. Number in parentheses are GenBank accession numbers. Scale bar indicates nucleotide substitutions per site. Blue sequence indicates isolate obtained from the recent Mexican patient.

B) Compilation of Borrelia studies in Mexico from published records

Methodology for databases

In addition to the written informed consent signed by the patient for the Case Report, the current study was approved by the Ethics and Research Committee of the Medical Faculty, UNAM (Comisiones de Investigación y de Ética de la División de Investigación de la Facultad de Medicina, UNAM), with approval number FM/DI/088/2017.

An extensive research of the literature was made to compile a database of published studies of Borrelia in human cases, mammals and ticks in Mexico from 1939 to 2020. A combination of keywords: “Borrelia”, “borreliosis”, “mammals”, “Mexico” and “human cases” were used in specialized databases including BioOne, Elsevier, Highwire, Iris, JSTOR, Pubmed, Scopus, SpringerLink, Wiley Online, Web of Science and Zoological Records, as has been previously proposed [63]. Articles reported in those studies were also analyzed by cross-referencing. Studies published in national and international journals were included.

Human database

For the human database, the information was analyzed according to: (i) Borrelia species, (ii) number of human cases, (iii) sex, (iv) age group (newborn [0–2 yo], childhood [3–12 yo], teenager [13–18 yo], adult [19–60 yo] and elderly population [+60 yo]), (v) type of population (rural or urban), (vii) vector species, (viii) year of publication, (ix) detection method and (x) locality.

Additionally, information data from “National Health Information System [Sistema Nacional de Información en Salud] (SINAIS)” published by the Mexican Ministry of Health [Secretaría de Salud] [64] were obtained. This database includes all human borrelia-cases reported between 2000–2013 to the Ministry of Health. All the cases were georeferenced according to the “Catalogue of Keys from the Federal States, Municipalities and Localities” [Catálogo Único de Claves de Áreas Geoestadísticas Estatales, Municipales y Localidades] [65]. The SINAIS database did not include personal information of patients, nor the method of identification of the pathogens, for this reason, these records were only included for the geographical analysis.

Animal database

From each study on mammals and/or ticks, the following information was recorded: (i) Borrelia species, (ii) number of positive animals for each species, (iii) order, family, genus and species of the mammalian host (if available), (iv) tick family, genus and species (if available), (v) year of collection, (vi) detection method and (vii) locality. Wild mammalian taxonomy was updated following the most recent taxonomical review for Mexico [66]. For ticks, a review for each genus was used [67-70].

Database analyses

In order to present the first distribution map of Borrelia species, we generated a colorimetrical map in R, using the open access layers provided by CONABIO [Comisión Nacional para el Conocimiento y Uso de la Biodiversidad http://www.conabio.gob.mx/informacion/gis/] and functions from the R packages viridis [71], tidyverse [72], maps [73], ggrepel [74], mapproj [75] and plotly [76]. Maps were made for human cases, mammal and tick records, as well as a global map of total reports in Mexico, highlighting the zones with the highest number of cases, using the free and open source geographic information system, QGIS 2.18.9 [https://qgis.org/en/site/].

Results of databases for Borrelia studies in Mexico

A total of 1,347 records were obtained from 39 published studies of Borrelia in Mexico. Of the total cases, 29.5% (398/1,347) corresponded to humans and 70.5% (949/1,347) were of other animal species (S1 and S2 Tables). Only one study reported both human and animal infections (S1 Table).

Borrelia species were specified in 54% (727) of the 1,347 cases. In the remaining 46% (620 cases), the etiological agent was identified as a member of the B. burgdorferi s.l. complex or as a member of the RF group. A total of six Borrelia species have been reported in Mexico [B. afzelii, B. burgdorferi s.s., B. duguesii, B. garinii, B. mazzottiii and B. turicatae] (Table 2), of which two are members of the LB group and four of RF.

Table 2

Borrelia species reported in Mexico.

Borrelia group	Borrelia species	No. of records	Type of host
RF	B. duguesii	1	Animal
	B. mazzottii	1	Animal
	B. turicatae	549	Animal
LB	B. afzelii	2	Human
	B. burgdorferi s.s.	128	Human
		36	Animal
	B. garinii	10	Human

The most frequent tests used for Borrelia detection were serological tests (Enzyme-Linked Immunosorbent Assay [ELISA], Western blotting and immunofluorescence assay [IFA]), used in 25 studies. This was followed by molecular tests (PCR) used in 11 studies. Five non-confirmed human cases were diagnosed by clinical manifestations and light microscopy.

Human cases

In Mexico, 398 human cases of Borrelia-infection were recorded between 1939 and 2020. The most frequent diagnosis was LB in 98.7% (393/398) of the cases. RF was only diagnosed in 1.3% (5/398) of the human cases. Of the 393 cases with LB, in 35.6% (140/393) the etiological agent was identified (B. afzelii, B. garrinii and B. burgdorferi s.s.), using specific diagnosis tests (S1 Table). In contrast, no RF cases reported the infecting Borrelia species.

The gender of patient was specified in 231 (58%) of the 398 notified cases (S1 Table). The proportion between sexes was higher in females (134 cases) than males (97 cases). In patients with LB, women were the most frequent group with 58% (131/226), as compared to males showing 42% (95/226) of the cases (S1 Table). The remaining five patients corresponded to RF, which showed an almost equal distribution between sexes, with three cases being females and two cases were males.

The type of community of origin was referred only in 53.5% (213/398) of the cases (S1 Table). Of these 213 cases, 95.7% (204/213) corresponded to urban environments, the remaining 4.3% (9/213) were from rural areas. Human cases of RF showed that 80% (4/5) were reported in rural communities, whereas LB patients were mostly detected in urban communities 97.5% (203/208).

The age of patients was not specified in 94.4% (376/398) of all human cases, yet the remaining 22 cases (17.5%) corresponded mostly to adults 77.2% (17/22).

Animal reports

A total of 949 records of 17 mammalian species (nine wild species, three domesticated species, and two peri-domestic mammals) of six orders were reported as infected by Borrelia sp. in 19 studies from Mexico (Table 3; S2 Table). Four species of Borrelia were identified, three of which were members of the RF group (B. duguesii, B. mazzottii and B. turicatae) and only one from the LB group (B. burgdorferi s.s.) (S2 Table). The RF group was reported in 551 of the 949 records (58%), whereas members of the B. burgdorferi s.l. complex were reported only in 398 records [41.9%] (S2 Table).

Table 3

Mammalian species associated to Borrelia in Mexico.

Mammalian species			Borrelia species
Order	Family	Species [English common name/Spanish common name]
Artiodactyla	Cervidae	Odocoileus virginianus [White-tailed deer/Venado cola blanca]	B. burgdorferi s.l.
	Bovidae	Bos taurus* [Aurochs /Toro]	B. burgdorferi s.l.
Carnivora	Canidae	Canis lupus familiaris [Dog/Perro]	B. burgdorferi s.l.
		Vulpes macrotis* [Kit Fox /Zorra del desierto]	B. burgdorferi s.s.
	Felidae	Panthera onca* [Jaguar/Jaguar]	B. burgdorferi s.l.
	Procyonidae	Bassariscus astutus* [Ringtail/Cacomixtle]	B. burgdorferi s.l.
			B. burgdorferi s.s.
Lagomorpha	Leporidae	Sylvilagus floridanus* [Eastern Cottontail/Conejo]	B. burgdorferi s.s.
			B. burgdorferi s.l.
Perissodactyla	Equidae	Equus caballus [Horse/Caballo]	B. burgdorferi s.l.
Primates	Hominidae	Homo sapiens* [Human/Humano]	B. burgdorferi s.s.
Rodentia	Cricetidae	Microtus mexicanus [Mexican Vole/Meteorito]	B. burgdorferi s.l.
		Neotoma mexicana [Mexican Woodrat/Rata magueyera]	B. burgdorferi s.l.
		Neotoma micropus* [Southern Plains Woodrat/ Rata magueyera]	B. duguesii
		Neotomodon alstoni [Volcano Deermouse/Ratón de los volcanes]	B. burgdorferi s.l.
		Peromyscus leucopus [White-footed Deermouse/Ratón]	B. burgdorferi s.l.
		Peromyscus maniculatus [North American Deermouse/Ratón]	B. burgdorferi s.l.
	Heteromyidae	Heteromys pictus* [Painted Spiny Pocket Mouse/Ratón espinoso]	B. burgdorferi s.l.
	Muridae	Mus musculus [House Mouse/Ratón de casa]	B. burgdorferi s.l.
		Rattus rattus [Roof Rat/Rata negra]	B. burgdorferi s.l.

All wild species were updated according to the last taxonomic review of Ramírez-Pulido et al. [66]. Mammalian English common names were updated according to Wilson and Reeder [77] and Spanish common names according to Ceballos and Oliva [78].

* In these studies, the authors did not include host samples when testing for Borrelia DNA.

The order Rodentia showed the highest number of infected species with nine rodent positive species, followed by carnivores with three (Table 3). In both of these mammalian orders, only the B. burgdorferi s.l. complex was recorded. In vertebrate hosts, the samples most frequently used for detecting Borrelia DNA was blood and/or tissues (305 records). Studies on the 305 mammalian samples only showed infection of an unknown species of the LB group.

Studies on arthropods and potential Borrelia vectors revealed 14 species: three soft ticks of the family Argasidae and 11 species of hard ticks of the family Ixodidae (Table 4), of which I. scapularis was the most common tick species positive for Borrelia DNA (Table 4; S2 Table). Studies on ticks as vectors were done in 570 records. Only 75 records were obtained from ticks retrieved from mammals (S2 Table).

Table 4

Tick species recorded to be associated with Borrelia species in Mexico.

Tick species		Mammalian species	Borrelia species
Family	Species
Argasidae	Ornithodoros turicata	ND	B. turicatae
	Ornithodoros duguesi	Neotoma micropus	B. duguesii
	Ornithodoros talaje	ND	B. mazzottii
Ixodidae	Amblyomma americanum	Homo sapiens sapiens	B. burgdorferi s.s.
	Amblyomma cajennense	Bos Taurus	B. burgdorferi s.s.
		Canis lupus familiaris	B. burgdorferi s.s.
		ND	B. burgdorferi s.s.
	Amblyomma mixtum	Canis lupus familiaris	B. burgdorferi s.l.
	Dermacentor andersoni	ND	B. burgdorferi s.s.
	Dermacentor variabilis	ND	B. burgdorferi s.l.
	Ixodes affinis	Canis lupus familiaris	B. burgdorferi s.l.
	Ixodes kingi	Vulpes macrotis	B. burgdorferi s.s.
	Ixodes scapularis	Heteromys pictus	B. burgdorferi s.l.
		Panthera onca	B. burgdorferi s.l.
		Sylvilagus floridianus	B. burgdorferi s.s.
		Sylvilagus floridianus	B. burgdorferi s.l.
		ND	B. burgdorferi s.l.
	Ixodes spinipalpis	ND	B. burgdorferi s.l.
	Ixodes texanus	Basariscus astutus	B. burgdorferi s.s.
	Ixodes tovari	ND	B. burgdorferi s.l.
	Rhipicephalus sanguineus s.l.	Canis lupus familiaris	B. burgdorferi s.l.

Studies done with free-living ticks (569 records) showed that 96.7% (550/569) contained Borrelia causing RF, whereas only 19 records [3.3%] reported the LB group (S2 Table). The specificity of the Borrelia groups (only reported in ticks) showed that RF members were recovered from argasid tick species, whereas the LB members were only detected in Ixodid tick species.

Geographic analysis

A total of 1,364 cases (both human and animal) were retrieved from published studies (1,347 cases) and from the National Health Information System (17 cases), of which 1,166 (85.4%) were geo-referred (at least at State level). These cases were distributed in 18 of the 32 Mexican states (Fig 2; S1 and S2 Tables). The state with most records was Aguascalientes (409/1,364 = 30%), followed by Nuevo Leon (253/1,364 = 18.5%) and Guanajuato (143/1,364 = 10.4%). The states with no records were Baja California Sur, Campeche, Chiapas, Colima, Durango, Guerrero, Hidalgo, Puebla, Queretaro, Tlaxcala and Zacatecas (Fig 2).

Fig 2

Geographic distribution of the 1,364 geo-referred records of Borrelia in Mexico.

Records include both human cases and animal infections or expositions to Borrelia in Mexico from 1939 to 2020.

The highest diversity of Borrelia species was shown in the central and northeastern regions of the country, being Mexico City, the state with the largest number of species registered (3/6 = 66.7%), followed by Coahuila with two species [2/6 = 33.3%] (Fig 3).

Fig 3

Geographic distribution of the genus Borrelia in Mexico according to species richness.

Colors indicates the number of species of the bacterial genus per State. Records of bacteria defined as B. burgdorferi s.l. were not included, since the species was not specified.

The 1,166 geo-referred cases published both in the literature and by the National Health Information System corresponded mostly to animals 939 (80.5%) and only 19.4% (227) to human cases. Human cases were distributed in northeastern and central Mexico, mostly in the state of Nuevo Leon, where 69 of the 244 geo-referred human cases (28.2%) were reported with regard to their place of origin. This was followed by Tamaulipas with 18.8% (46/244) and Mexico City with 17.2% [42/244] (Fig 4).

Fig 4

Geographic distribution of Borrelia-infected human cases in Mexico.

Darker color represents higher density.

Borrelia-infected animals have been reported in northeastern and northwestern regions, central and southeastern Mexico, with the highest density occurring the state of Aguascalientes, that reported 406 of the 938 animals (43.2% with known place of origin), Nuevo Leon (184/938 = 19.6%) and Guanajuato (142/938 = 15.1%). The lowest density was reported in the central states of Mexico (Michoacan, Coahuila, Jalisco and San Luis Potosi) with less than 1% of the reports (Fig 5).

Fig 5

Geographic distribution of Borrelia records in wild animals from Mexico.

Darker color represents higher density.

Discussion

The first record of Borrelia in Mexico was reported by Brumpt [79], who recorded B. turicatae in specimens of the questing soft tick, O. turicata, collected in the states of Aguascalientes, Guanajuato and San Luis Potosi. The first report of Borrelia in humans was made by Pilz and Mooser [80], who described three cases of RF in Aguascalientes, based on microscopic evidence of spirochetes in thick-film samples and on symptoms of the patients [80].

It was not until the 1990s when the first record of human exposure to LB was published in Mexico by Maradiaga-Ceceña et al. [81], who reported 32 humans seropositive to strains from the LB group in Sinaloa, yet these studies did not identify the infecting species.

The first report of Borrelia burgdorferi s.l. in animals was made by Salinas-Meléndez et al. [82] in DNA obtained from blood of an infected dog. Thus, publications on Lyme disease in Mexico started in the decade between 1990–1999. During this period, the Medical Research Unit of Infectious and Parasitic Diseases of the Mexican Social Security Institute [Unidad de Investigación Médica de Enfermedades Infecciosas y Parasitarias, Centro Médico Nacional SXXI, Instituto Mexicano del Seguro Social] began to study Lyme disease in Mexico. Further studies were done in the states of Nuevo Leon, Sinaloa and Mexico City, that reported human and animal seropositivity throughout the country [81-85].

The introduction of confirmatory tests based on PCR and Western blotting allowed a more accurate diagnosis, as compared to traditional tests (thick blood smear and microscopy) [82, 85]. Yet it was not until the early 2010s, that interest in Borrelia research intensified and the numbers of publications increased dramatically. Different research centers began to study the distribution of Borrelia in animals and human cases [86-88]. More animal species were screened for Borrelia DNA and veterinarians started to perform epidemiological surveys in domestic and wild animals [89, 90].

Thus, studies on Lyme disease in Mexico are recent and focus mainly on comparing LB with the other Borrelia groups, both in human cases as well as in animals [6, 88, 91]. Historically, LB has been identified in the majority of human cases (almost 97%) in Mexico, as compared to RF. Yet, considering the drastic increase of human cases of borreliosis in countries where the disease is endemic [19, 92, 93], in Mexico an enhanced effort to diagnose and confirm the infection by species of the LB group still needs to be accomplished. Is important to highlight that human cases of LB are mostly reported in urban communities, however, considering the life cycle of ixodid ticks and the transmission cycle of B. burgdorferi s.l., it is unlikely that infections originated in these urban areas, since tick larvae and nymphs feed mainly on wildlife [2, 94]. Therefore, it is more likely that humans become infected after incursions into forest areas, where they are exposed to ticks.

Currently, it is not possible to establish the origin of RF infections, although the available data seem to indicate that rural communities are the main origin of the infections, yet further studies are required to show a more complete epidemiological panorama. Since RF is regarded a forgotten and neglected tropical disease [15, 95], and given the scarce number of cases with RF reported by the Mexican Ministry of Health [Sistema Nacional de Información en Salud, Secretaría de Salud], it is very likely that many of the patients that are currently reported as having “fever of unknown origin”, lacking identification of the etiological agent, are actually patients with RF [64]. It is therefore imperative to consider RF as a differential diagnosis in these types of cases, especially in rural communities, where most of the cases of RF have occurred in Mexico and where a higher risk of contracting the disease exists, as compared to urban communities [15, 95].

Taken together, the current lack of data on both diseases prevent an accurate epidemiological analysis to be made, nor can risk factors for LB or RF be established in Mexico. However, with the information obtained so far, women appear to be more susceptible to Borrelia infections than men, both for LB as for RF. This tendency is similar to data reported in Europe and the US [15, 19, 96].

When analyzing the clinical manifestations reported by patients with suspected Lyme disease in Mexico, including the confirmed case report of this study, the general manifestations include fatigue, fever, arthralgia, paresthesia and myalgias [83, 87, 88, 97, 98]. Chronic Lyme disease often is accompanied by neurological symptoms of neuroborreliosis, including symmetric paresthesia with ascending distribution in all four limbs, meningo-polyradiculoneuropathy (motor and sensory), arthritis [86, 99] and facial palsy, mainly in children [98]. Dermal lesions include irregular and regular erythema migrans with reddish edges, pink center, with a clear mononuclear cell infiltrate in the superficial and deep dermis. Additionally, borrelial lymphocytoma lesions with dense nodular lymphocytic infiltrates in the reticular dermis and well-delineated lymphoid follicles can be found. However skin lesions such as acrodermatitis chronica atrophicans are rare [83, 86, 100]. Taking into account the symptoms of the currently reported case, which include diplopia and bilateral hypoesthesia in both upper and lower limbs, tremors in the arms and short-term memory loss, we suggest that these should also be considered as possible symptoms for Lyme disease in Mexican patients.

On the other hand, clinical manifestations reported for RF in Mexican patients differ from those of Lyme disease, since RF patients show fever paroxysms lasting between 2–7 days, which alternate with periods (4–12 days) of apyrexia. The fevers oscillate between 38.5°C and 40.8°C, preceded by intense chills. The most common manifestations are headache, exanthems and weakness (found in three of the cases), as well as splenomegaly, hepatomegaly, diaphoresis, epistaxis and photophobia [80, 101]. Blood counts are characterized by eosinophilia, increased platelet counts and moderate leukocytosis, with 80% polynucleated cells [80].

The analysis of Borrelia hosts and vectors in Mexico has shown that most of the Borrelia infections in animals have been studied in the order Rodentia, which is considered a potential host for Borrelia species. This is in accordance with the literature, where this order has been implicated as one of the most important hosts, for both the LB and the RF groups [2, 15, 19]. Thus, several species of genera Peromyscus and Neotoma have been recognized as reservoirs for many Borrelia species in endemic countries [2, 3, 102, 103]. For the LB species, several mammals (mainly rodents and the white-tailed deer) have also been shown to be hosts in Mexico, in which only three Borrelia species have been reported. This low number contrasts with the number of species reported in countries endemic for Borrelia, such the USA, where nine species of the LB group have been reported [5, 17, 67, 104].

With regard to vector studies done in Mexico, these show that four of the 26 species of the genus Ixodes (I. affinis, I. pacificus, I. scapularis and I. spinipalpis) are confirmed vectors of species of the LB group. In contrast, only three vectors have been confirmed for Borrelia species of the RF group (Ornithodors coriaceus, Ornithodoros turicatae and I. scapularis), which affect several host species (rodents, deer and dogs). The diversity of RF species (three species) reported in Mexico is low, as compared to the eight species reported in the US [3, 15, 67–69]. This highlights the importance of specifying the tick specimens (mainly those recognized as competent vectors) recovered from various hosts, irrespective of whether they have been recognized as reservoirs. Thus, I. scapularis, I. texanus and O. duguesi specimen retrieved from jaguars, cattle, ringtails and rabbits have been shown to test positive for Borrelia (S2 Table). The analysis of diverse wild and domestic animal species is relevant, since they could be playing a role as maintenance hosts for ticks in the ecosystem, as has been evidenced in white-tailed deer [105, 106].

Taken together, the low host and vector diversity reported in Mexico calls for future studies to update the existing historical records [26, 79, 107]. The important difference in the numbers of registered species between Mexico and the US, an endemic and hotspot of the genus Borrelia, is probably due to inadequate sampling in Mexico, but mainly because of the use of serological tests without further confirmation of the bacterial presence. It seems warranted to predict higher numbers of both hosts and vectors in Mexico due to important climatic varieties and diversity of ecosystems that provide ideal habitats and opportunities for sustaining diverse vector and host species of this bacterial genus [67, 70, 78].

Previous reports on the diversity of Borrelia species in central and northeastern Mexico show that areas with the highest number of records overlap with those showing high probabilities of occurrence of ticks of the genus Ixodes [108]. This observation contrasts with the report of Illioldi-Rangel et al., [108] stating that the state of Durango stands out as having a high density of Ixodes, yet no records of Borrelia have been reported. Clearly, more studies need to be conducted in Durango to validate potential distribution maps.

In the case of the RF, the existing records are related to the distribution of their vectors [79, 81]. The importance of analyzing potential distribution of vectors is based on the fact that it not only permits to direct sampling efforts, but is also crucial for knowledge on vector-borne pathogens in sub-sampled areas and for optimizing epidemiological surveys [108, 109].

To the best of our knowledge, there are no associations between human cases with those of animals or vectors in Mexico. Although human cases have been reported the states Morelos, Oaxaca, Quintana Roo, Tabasco, Veracruz and Mexico City, animal studies are lacking. This situation has also been shown for another groups of pathogens in Mexico such as viruses [63]. The human cases reported in Mexico City most likely refer to patients that were transferred from regional health centers to larger hospitals in the city for better diagnosis and treatment. Natural transmission of Borrelia within Mexico City seems highly unlikely. This phenomenon has also been observed for other diseases, in which diagnostic centers are concentrated in larger cities [110]. Sinaloa and Nuevo Leon have become important states, where most of the human Borrelia transmission has been reported in Mexico. Regrettably, many cases have only been reported in local epidemiology reports, in pathology departments of hospitals or clinics, or are submitted to local journals with low accessibility and limited distribution, making the information on Borrelia difficult to obtain, thus generating inaccurate data.

Since several international organizations and centers have recognized the diseases caused by Borrelia as neglected or as a major health threat [1, 93, 95], this now shows the necessity to establish a surveillance program and a specialized reference research center in Mexico, where isolates and Borrelia strains can be collected to facilitate more precise information on these pathogens, as well as to identify more specific antigens that could improve the diagnosis.

We consider that our geographic approach with spatial distribution data will now provide valuable information on Borrelia for human and animal health authorities and may also be relevant for future control and prevention programs, as well as a guide to direct capture efforts for specific animal studies. Creating a universal and open access database of all published records for scientists, entomologists and public health authorities, can help establish linkages among groups working with the genus Borrelia in Mexico. Even though the study of the genus Borrelia in Mexico is currently poorly assessed, new work groups are being formed and existing groups are consolidating, which together will increase the knowledge of this bacterial genus in Mexico and complete the epidemiological panorama.

Borreliosis human cases reported in Mexico.

(DOCX)

Click here for additional data file.

Borrelia detection in Mexican animals.

(DOCX)

Click here for additional data file.

5 May 2020

PONE-D-20-07127

Lyme Borreliosis and Relapsing Fever in humans and wildlife of Mexico

PLOS ONE

Dear Dr Becker,

Thank you very much for submitting your manuscript "Lyme Borreliosis and Relapsing Fever in humans and wildlife of Mexico" (#PONE-D-20-07127) for review by PLOS ONE. As with all papers submitted to the journal, your manuscript was fully evaluated by academic editor (myself) and by independent peer reviewers. The reviewers appreciated the attention to an important health topic, but they raised substantial concerns about the paper that must be addressed before this manuscript can be accurately assessed for meeting the PLOS ONE criteria. Therefore, if you feel these issues can be adequately addressed, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. We can’t, of course, promise publication at that time.

We would appreciate receiving your revised manuscript by Jun 19 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Abdallah M. Samy, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for stating the following in the Acknowledgments Section of your manuscript:

'This work was supported by PAPIIT IN211418. Pablo Colunga-Salas is a doctoral student of Pograma de Doctorado en Ciencias Biomédicas, Universidad Nacional Autónoma de México (UNAM) and has received the CONACyT fellowship with number 463798.'

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

'The funders had no role in study design, data collection and analysis, decision to

publish, or preparation of the manuscript'

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Partly

Reviewer #4: Yes

Reviewer #5: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: N/A

Reviewer #3: N/A

Reviewer #4: Yes

Reviewer #5: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Yes

Reviewer #5: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: No

Reviewer #4: Yes

Reviewer #5: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: (1) The term "borreliosis" for both Lyme disease and relapsing fever is not common usage. This will likely confuse readers. Why not just write about Lyme disease (or Lyme borreliosis) and relapsing fever?

(2) The article is mainly a case report with a review of the literature. It is not a research article. Table 1 is more appropriate for a textbook chapter.

(3) The nucleotide sequence with accession number of MN607028 (line 165) is not publicly available. This is a major problem.

(4) In any case, the examples of "B. burgdorferi" in the tree are not from a recognized reference strain, preferably the type strain for the species, but a short fragment of the flagellin gene from Illinois, a state with a low incidence of Lyme disease.

Reviewer #2: The manuscript is well written and the authors were able to present their study well. The compilation of data presenting the epidemiological trend of Lyme Borreliosis and Tick borne Relapsing fever in Mexico will be helpful for further research in this field. However, I would suggest the authors proof read the manuscript for minor errors. For example: Relapsing Fever (RF) is written as FR in Table 1 under the Borrelia group column. Also, the full from of all abbreviations used in the manuscript needs to be given the first time it is mentioned in the paper.

Reviewer #3: General Comments

The manuscript by Colunga-Salas and colleagues aims to "compile all the information published on Borrelia in Mexico and to present actual epidemiological trends." Although this is a noble goal, the epidemiological data appears to be too sparse and fragmented to achieve this goal. The other feature of the report is the detailed genomic description of the first documented endemic case of Borrelia burgdorferi sensu stricto (Bbss) in Mexico. Reorganization of the manuscript to focus on this case would make sense.

Major Comments

1. The detailed genomic description of the first documented endemic case of Bbss in Mexico is certainly original and should be the major focus of the report. The manuscript should include the actual BLAST sequence from that case to confirm its validity. Starting with this case will show where future studies should go in determining the epidemiology of tick-borne disease in Mexico. In addition, a detailed travel history should be given because the patient may have acquired his infection outside of Mexico.

2. The epidemiology of Borrelia burgdorferi (Bb) and relapsing fever Borrelia (RFB) in Mexico is certainly of interest, but the available data was limited to 18 states, thereby introducing significant selection bias into the study results. Presentation of this review data could be done in a more organized and concise format with less speculation about the implications of the incomplete data.

3. A benefit of separating out the case report from the epidemiology is that the case can be presented in a more organized fashion, with clinical features, test methodology, results and conclusions. Right now the clinical and epidemiology aspects are mixed together, and it is a mess.

4. Page 4, line 84: "The competent vectors of this bacterial species are hard ticks of the Ixodes ricinus complex". Ixodes ricinus is mainly found in Europe, so better to say that Bb is transmitted by hard ixodid ticks. The authors should also mention soft argasid ticks that transmit RFB (Fesler et al, Healthcare 2020;8:97).

5. For future review, it would be helpful to separate the Tables from the text. Much easier to follow the bouncing ball that way.

6. Page 15, line 221: Isn't it surprising that Bb was reported mostly in urban communities? The number of recognized RFB cases (5) was too small to draw geographical conclusions.

7. Numerous spelling and grammatical errors need to be corrected. Examples (comments): prompts to include both diseases as possible causes of reports on “fever of unknow origin” (awkward sentence and sp), disperse (sp), incriminated (implicated), widely dispersed (just the opposite: not disseminated), a red skin lesion after visiting the family farm that lasted several weeks (the lesion, not the visit), sensibility (sensitivity), short time (short term), starting performing (?), BL(LB?), sensorial (sensory), sub-sampling (inadequate sampling)

Minor Comments

1. Page 22, line 331: REP and MAB sentence is hard to understand

2. Reference 41 is incomplete

Reviewer #4: General Comments

This study attempted to document published information on Borrelia in Mexico, with reference to risk factors for the human population, the diversity of Borrelia species and their geographic distribution.

The author could improve the manuscript by citing references from the actual work that reported the Borrelia species, rather than utilising single review article (Reference 3 and 10), that does not refer to the work done on the pathogen by initial authors. This is especially relevant to the tables.

Abstract

Line 31

Insert full stop after human and start a new sentence with Women : species were reported in a total of 1,347 reports, of which 398 were of humans. Women and children from rural communities appear to be……

Line 36

only made from 18 states out of how many states ?

Introduction

Table 1. Pathogenic Borrelia species:

The first group on table 1 is RF not FR.

The proper references for Candidatus Borrelia kalaharica should be:

1. Fingerle V, Pritsch et al. 2016. “Candidatus Borrelia kalaharica” detected from a febrile traveller returning to Germany from vacation in southern Africa. PLoS Negl Trop Dis 10:e0004559. https://doi.org/10.1371/journal.pntd.0004559.

2. Cutler S.J., Ahmed A.O., et al, 2018. Ornithodoros savingyi – the tick vector of Candidatus Borrelia kalaharica in Nigeria. Journal of Clinical Microbiology. 56(9): e00532-18. https://jcm.asm.org/content/jcm/56/9/e00532-18.full.pdf

Methods

Line 104: include year of coverage of studies 1939 and 2020

Line103-110 refers to the methodology used for literature search for mammals, human cases and ticks in Mexico. What is line117-123 meant to infer? Are they additional database for human studies?

Line 149: DNA was extracted from? Blood or Sera? Please clarify and include in the sentence

Results

Table 2: Include a first column for LB and RF groups:

Group Borrelia species No. of records Type of host

LB

Discussion

Line 305: Brumpt what year?

Line 308: Pilz and Mooser what year?

Line 315: Salinas-Meléndez et al.include the year

Line 336: Did you mean BL or LB?

The discussion is realistic with findings.

Reviewer #5: In the manuscript entitled Lyme Borreliosis and Relapsing fever if humans and wildlife of Mexico by Colunga-Salas et. al. have gathered information of distribution, diversity and density of Borrelia species in different parts of Mexico. They found in total 17 different mammalian 14 different tick species hosting borrelia spirochetes. Authors also describe the first endemic case of Lyme borreliosis in Mexico verified by sequence analysis of the causative strain. The manuscript is interesting and increases knowledge of very important pathogens, Lyme disease and relapsing fever borrelia. There are very few points which might need clarification.

In the table 1 the authors have gathered information using one manual of systematics and some case studies and articles. Is the list trying to be exhaustive? At least I know some species, e.g. Borrelia finlandensis, which according to some references should be a species of its own and it is not mentioned in the table. Thus, a wider description of how species were chosen and if the list is covering all pathogenic species might be useful addition. Also in the introduction it might be good to tell the readers about latest development in Borrelia -systematics, e.g, division of the genus into Borrelia and Borreliella. Also term Borreliella might be useful to add as keyword in database search.

As not all readers are familiar with zoology, it might be aid readability and be educational if existing common names of animal species could be added to the table 3.

In the map figures the figure legends and numbers in the actual figures are not very informative. It might be not clear to reader what is meant “records of borrelia” for example in the figure 2. Does it mean “amount of borrelia findings from humans and animals isolated during 20xx-20xx” or something else? The figure legends should be carefully checked and more informative.

In the beginning of discussion it would be interesting to know, when the first borrelia findings were made.

Minor points:

- Instead of “sex” maybe gender could be used (page 15, line 213)

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Akhila Poruri

Reviewer #3: No

Reviewer #4: No

Reviewer #5: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: 20.docx

Click here for additional data file.

23 Jun 2020

Response to Reviewers

We thank the reviewers for their comments and have now addressed all their points making the pertinent changes throughout the manuscript. The detailed response are included below.

REVIEWER #1

(1) The term "borreliosis" for both Lyme disease and relapsing fever is not common usage. This will likely confuse readers. Why not just write about Lyme disease (or Lyme borreliosis) and relapsing fever?

Response: We agree with the reviewer and changed the term “borreliosis” in the abstract. Additionally, we proposed changes in the title and short title, and made changes throughout the manuscript (Lines 63, 108, 112, 243, 248, 363, 420, 470, 490).

(2) The article is mainly a case report with a review of the literature. It is not a research article. Table 1 is more appropriate for a textbook chapter.

Response: One of the aims of the study was to assess the epidemiological situation of borreliosis in Mexico, since most of the studies done so far are not easily available. An epidemiological update is needed to incentivize studies on Lyme borreliosis and Relapsing fever and to consider Relapsing fever as an important differential diagnosis in cases of “Fever of Unknown Origin” in Mexico.

Regarding Table 1, we consider it important to update knowledge on species that are pathogenic for both humans and animals, for readers not familiar with the genus Borrelia.

(3) The nucleotide sequence with accession number of MN607028 (line 165) is not publicly available. This is a major problem.

Response: We are aware of this situation, however, when submitting the sequence to GenBank, it was requested that it be released in 2022 or earlier, if the accession number was published. Despite this inconvenience, the publisher asked us for the sequence, which we shared. Since we don’t know whether this document was shared with the reviewer, we include the sequence:

>MexicanPatient

TTCCGATGCAGACAGAGGTTCTATACAAATTGAAATAGAGCAACTTACAGACGAAATTAATAGAATTGCTGATCAAGCTCAATATAACCAAATGCACATGTTATCAAACAAATCTGCTTCTCAAAATGTAAGAACAGCTGAAGAGCTTGGAATGCAGCCTGCAAAAATTAACACACCAGCATCACTTTCAGGGTCTCAAGCGTCTTGGACTTTAAGAGTTCATGTTGGAGCAAACCAAGATGAAGCTATTGCTGT

(4) In any case, the examples of "B. burgdorferi" in the tree are not from a recognized reference strain, preferably the type strain for the species, but a short fragment of the flagellin gene from Illinois, a state with a low incidence of Lyme disease.

Response: We thank the reviewer and have re-analyzed the set of sequences. Three B31 sequences were included (Figure 1). Accession numbers: AE000783 and CP019767.

Furthermore, changes were made in methods and figure legend 1, since new substitution model analyses was required, and a different substitution model was obtained from the new alignment (Lines 163-164, 168, 176).

REVIEWER #2

The manuscript is well written, and the authors were able to present their study well. The compilation of data presenting the epidemiological trend of Lyme Borreliosis and Tick borne Relapsing fever in Mexico will be helpful for further research in this field. However, I would suggest the authors proof read the manuscript for minor errors. For example: Relapsing Fever (RF) is written as FR in Table 1 under the Borrelia group column. Also, the full from of all abbreviations used in the manuscript needs to be given the first time it is mentioned in the paper.

Response: We thank the reviewer and have carefully revised the abbreviations throughout the manuscript and made sure that the first time any abbreviation was used, it was fully written. Changes were done throughout the manuscript (Lines 162-163, 215-216, 237). We also corrected the error (changing FR to RF) in Table 1.

REVIEWER #3

(1) General Comments

The manuscript by Colunga-Salas and colleagues aims to "compile all the information published on Borrelia in Mexico and to present actual epidemiological trends." Although this is a noble goal, the epidemiological data appears to be too sparse and fragmented to achieve this goal. The other feature of the report is the detailed genomic description of the first documented endemic case of Borrelia burgdorferi sensu stricto (Bbss) in Mexico. Reorganization of the manuscript to focus on this case would make sense.

Response: We appreciate the recommendation and have now re-organized the manuscript into sections (A), related to the case report and section (B) related to review of the literature. The case report is now separated and fully presented after the introduction (Lines 114-180).

Regarding the epidemiological panorama, we are aware of the limited data available, however, we consider that an actualized panorama alerts on this gap of knowledge and helps to incentivize future research to bring data on human infections up to date in sites where animal infections have been recorded, and vice versa. Furthermore, our effort has now evidenced that it is important to consider Relapsing Fever as a differential diagnosis in cases currently diagnosed as “Fever of Unknown Origin” in Mexico.

(2) Major Comments:

1. The detailed genomic description of the first documented endemic case of Bbss in Mexico is certainly original and should be the major focus of the report. The manuscript should include the actual BLAST sequence from that case to confirm its validity. Starting with this case will show where future studies should go in determining the epidemiology of tick-borne disease in Mexico. In addition, a detailed travel history should be given because the patient may have acquired his infection outside of Mexico.

Response: We now include travel information, as detailed as the patient reported it (Lines 119-123). We were careful to assess whether he had made trips outside of Mexico, yet he only reported local trips within the state of Veracruz. We agree that this case sheds some light as to where future epidemiological studies should go and which can be enriched by the most complete information to date on the current epidemiological panorama of Borreliosis in Mexico, that we now present.

We now include the BLAST sequence in the manuscript to confirm the validity of the case (Lines 168-173

(3) The epidemiology of Borrelia burgdorferi (Bb) and relapsing fever Borrelia (RFB) in Mexico is certainly of interest, but the available data was limited to 18 states, thereby introducing significant selection bias into the study results. Presentation of this review data could be done in a more organized and concise format with less speculation about the implications of the incomplete data.

Response: We thank the reviewer and have now re-organized the manuscript into sections (A), related to the case report and section (B) related to review of the literature. The case report is now separated and fully presented after the introduction (Lines 114-180).

The epidemiological panorama is more organized, and less speculation is made about the incomplete epidemiological panorama of borreliosis in Mexico. We also discuss this point (Lines 374-379, 380-383, 446)

(4) A benefit of separating out the case report from the epidemiology is that the case can be presented in a more organized fashion, with clinical features, test methodology, results and conclusions. Right now the clinical and epidemiology aspects are mixed together, and it is a mess.

Response: After the reviewer's assertive comment of placing the case report as the center of attention, we consider that the case report and the epidemiological panorama of borreliosis are now more understandable.

(5) Page 4, line 84: "The competent vectors of this bacterial species are hard ticks of the Ixodes ricinus complex". Ixodes ricinus is mainly found in Europe, so better to say that Bb is transmitted by hard ixodid ticks. The authors should also mention soft argasid ticks that transmit RFB (Fesler et al, Healthcare 2020;8:97).

Response: We made the pertinent change about the Ixodes ricinus complex (Lines 94-95). Concerning to RF vectors, the information about that soft ticks are the main vectors are present in Lines 85-87.

(6) For future review, it would be helpful to separate the Tables from the text. Much easier to follow the bouncing ball that way.

Response: We agree, however, the format of PLoS ONE indicates that tables must be placed next to the paragraph where they were referred for the first time.

(7) Page 15, line 221: Isn't it surprising that Bb was reported mostly in urban communities? The number of recognized RFB cases (5) was too small to draw geographical conclusions.

Response: We agree that is surprising that LD cases were reported mostly in urban communities. On the other hand, as the reviewer says, the number of RF cases is too small, for this reason, we discuss the most likely reason of this situation (Lines 380-383).

(8) Numerous spelling and grammatical errors need to be corrected. Examples (comments): prompts to include both diseases as possible causes of reports on “fever of unknow origin” (awkward sentence and sp), disperse (sp), incriminated (implicated), widely dispersed (just the opposite: not disseminated), a red skin lesion after visiting the family farm that lasted several weeks (the lesion, not the visit), sensibility (sensitivity), short time (short term), starting performing (?), BL(LB?), sensorial (sensory), sub-sampling (inadequate sampling).

Response: We made the pertinent grammatical and spelling changes as the reviewer suggested (Lines 51, 85, 87, 105, 126, 135, 369, 373, 401, 422, 446, 492-493).

Minor Comments:

(9) Page 22, line 331: REP and MAB sentence is hard to understand

Response: We eliminated the clarification in parenthesis, to make it easier to read (Line 369).

(10) Reference 41 is incomplete

Response: We apologize and completed the reference 67 (Lines 694-696).

75. Guzmán-Cornejo C, Robbins RG. The genus Ixodes (Acari: Ixodidae) in Mexico: adult identification keys, diagnoses, hosts, and distribution. Rev Mex Biodivers. 2010;80: 289–298.

REVIEWER #4

(1) The author could improve the manuscript by citing references from the actual work that reported the Borrelia species, rather than utilising single review article (Reference 3 and 10), that does not refer to the work done on the pathogen by initial authors. This is especially relevant to the tables.

Response: We thank the reviewer and now placed the references of the original descriptions for each species (Table 1).

(2) Abstract

Line 31

Insert full stop after human and start a new sentence with Women: species were reported in a total of 1,347 reports, of which 398 were of humans. Women and children from rural communities appear to be…

Response: We made the suggested changes (Line 34).

(3) Line 36, only made from 18 states out of how many states?

Response: We specified the total number of states (Line 39).

(4) Introduction

Table 1. Pathogenic Borrelia species:

The first group on table 1 is RF not FR.

Response: We apologize and corrected the error on Table 1.

(5) On the Relapsing fever transmitted by ticks in Transcaucasia

The proper references for Candidatus Borrelia kalaharica should be:

1. Fingerle V, Pritsch et al. 2016. “Candidatus Borrelia kalaharica” detected from a febrile traveller returning to Germany from vacation in southern Africa. PLoS Negl Trop Dis 10:e0004559. https://doi.org/10.1371/journal.pntd.0004559.

2. Cutler S.J., Ahmed A.O., et al, 2018. Ornithodoros savingyi – the tick vector of Candidatus Borrelia kalaharica in Nigeria. Journal of Clinical Microbiology. 56(9): e00532-18. https://jcm.asm.org/content/jcm/56/9/e00532-18.full.pdf

Response: We thank the reviewer and now include both references (Table 1).

(6) Methods

Line 104: include year of coverage of studies 1939 and 2020

Response: We made the pertinent changes (Lines 184-185).

(7) Line103-110 refers to the methodology used for literature search for mammals, human cases and ticks in Mexico. What is line117-123 meant to infer? Are they additional database for human studies?

Response: Since notification of borreliosis is not mandatory in Mexico, some published case reports and serological surveys of the human Mexican population has been published without being included in the official databases. The opposite also holds true, where some hospitals and clinics voluntarily notify cases of Lyme disease, yet this information is not necessarily published in scientific journals and therefore do not include symptoms nor detailed information. For this reason, we only included them in the geographic analyses. To make clarify this situation, we included this statement in the manuscript (Lines 197-200, 204-205).

(8) Line 149: DNA was extracted from? Blood or Sera? Please clarify and include in the sentence

Response: We made the clarification (Lines 140).

(9) Results

Table 2: Include a first column for LB and RF groups:

Group Borrelia species No. of records Type of host

LB

Response: We accept and made the pertinent changes (Table 2).

(10) Discussion

Line 305: Brumpt what year?

Line 308: Pilz and Mooser what year?

Line 315: Salinas-Meléndez et al.include the year

Response: We followed the instructions of the journal reference style that only cites the author(s), without including the year.

(11) Line 336: Did you mean BL or LB?

Response: We apologize for the error. The correct abbreviation must be LB, which is now changed (Line 373).

(12) The discussion is realistic with findings.

Response: We really appreciate your comment

REVIEWER #5

There are very few points which might need clarification.

(1) In the table 1 the authors have gathered information using one manual of systematics and some case studies and articles. Is the list trying to be exhaustive? At least I know some species, e.g. Borrelia finlandensis, which according to some references should be a species of its own and it is not mentioned in the table. Thus, a wider description of how species were chosen and if the list is covering all pathogenic species might be useful addition. Also in the introduction it might be good to tell the readers about latest development in Borrelia -systematics, e.g, division of the genus into Borrelia and Borreliella. Also term Borreliella might be useful to add as keyword in database search.

Response: In Table 1 we did not intend to report an exhaustive search on all Borrelia species of the literature. The intention was to only include Borrelia species that are pathogenic for humans and/or animals, and therefore many species are not listed. We specified this in the text (Lines 87-95) stating that 25 of the RF group and 11 of the LB group were capable of causing diseases in human or animal populations. To avoid confusion, we change and referred to the original description articles, where the pathogenic species were firstly described, according to Reviewer 4.

We appreciate the recommendation to inform to the reader on the latest taxonomic updates of this genus. We therefore included a paragraph in the introduction regarding this point (Lines 77-84). Additionally, we followed the recommendation and included “Borreliella” as a keyword.

(2) As not all readers are familiar with zoology, it might be aid readability and be educational if existing common names of animal species could be added to the table 3.

Response: We are grateful for your recommendation. We now included English and Spanish common names in Table 3.

(3) In the map figures the figure legends and numbers in the actual figures are not very informative. It might be not clear to reader what is meant “records of borrelia” for example in the figure 2. Does it mean “amount of borrelia findings from humans and animals isolated during 20xx-20xx” or something else? The figure legends should be carefully checked and more informative.

Response: We reviewed all Figure legends, and modified those of Figures 2 and 3.

(4) In the beginning of discussion it would be interesting to know, when the first borrelia findings were made.

Response: The first record of Borrelia in Mexico, as well as the first human case and animal exposure are detailed in the first paragraph of the Discussion. Possibly the misunderstanding arose because we erroneously stated “case” instead if “record”, which was now modified (Line 342).

(5) Minor points:

- Instead of “sex” maybe gender could be used (page 15, line 213)

Response: We replaced “sex” by “gender” (Line 249).

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

16 Jul 2020

PONE-D-20-07127R1

Lyme disease and Relapsing fever in Mexico: an overview of human and wildlife infections

PLOS ONE

Dear Dr. Becker,

Thank you very much for submitting your manuscript "Lyme disease and Relapsing fever in Mexico: an overview of human and wildlife infections" for consideration at PLOS ONE. As with all papers reviewed by the journal, your manuscript was reviewed by members of the editorial board and by several independent reviewers. In light of the reviews (below this email), we would like to invite the resubmission of a significantly-revised version that takes into account the reviewers' comments.

Please submit your revised manuscript by Aug 30 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

We look forward to receiving your revised manuscript.

Kind regards,

Abdallah M. Samy, PhD

Academic Editor

PLOS ONE

Journal Requirements:

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #3: N/A

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #3: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #3: The authors have done an excellent job of revising the manuscript as suggested by the reviewers. Several remaining spelling and grammatical errors need to be corrected:

1. Lines 28-30: "The aims of this study were (1) to present the first confirmatory evidence of an endemic case of Lyme disease in Mexico and (2) to analyze the epidemiological trend of these xxx diseases...."

2. Lines 35, 61: "...were shown to be..."

3. Line 40: "...of performing..."

4. Lines 42-43: "Finally, the search for Borrelia...is recommended..."

5. Line 115: "in August 2017"

6. Line 416: "apyrexia"

7. Line 418: "exanthems"

8. Line 422: "The analysis of Borrelia...has shown..."

9. Line 437: "... which affect several host species (rodents, deer and dogs)."

10. The Case Report heading on Line 114 should have a subheading of "Clinical Summary and Test Procedures" to match the "Results" subheading on Line 157. Line 132 should be a new paragraph.

11. In addition, the authors should add one recent reference that supports their observations:

Fesler MC, Shah JS, Middelveen MJ, Burrascano JJ, Stricker RB. Lyme disease: diversity of Borrelia species in California and Mexico based on a novel immunoblot assay. Healthcare (Basel) 2020;8:97.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #3: Yes: Raphael B. Stricker, MD

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

29 Jul 2020

Response to Reviewers

We thank reviewer #3 for the comments and have addressed all the points making the pertinent changes throughout the manuscript. The detailed responses are included below.

REVIEWER #3

General comment

The authors have done an excellent job of revising the manuscript as suggested by the reviewers. Several remaining spelling and grammatical errors need to be corrected.

Response: We are very thankful with your comment.

1. Lines 28-30: "The aims of this study were (1) to present the first confirmatory evidence of an endemic case of Lyme disease in Mexico and (2) to analyze the epidemiological trend of these xxx diseases...."

Response: We made the pertinent changes (Lines 28-29).

2. Lines 35, 61: "...were shown to be..."

Response: We accept and made the changes (Lines 35, 61).

3. Line 40: "...of performing..."

Response: We made the pertinent change (Line 40).

4. Lines 42-43: "Finally, the search for Borrelia...is recommended..."

Response: We modify the sentence as proposed by the reviewer (Line 44).

5. Line 115: "in August 2017"

Response: We made the pertinent change (Line 117).

6. Line 416: "apyrexia"

Response: We accept and made the change (Line 415).

7. Line 418: "exanthems"

Response: We corrected the spelling (Line 417).

8. Line 422: "The analysis of Borrelia...has shown..."

Response: We made the pertinent change (Line 421).

9. Line 437: "... which affect several host species (rodents, deer and dogs)."

Response: We accepted and made the pertinent changes (Line 436).

10. The Case Report heading on Line 114 should have a subheading of "Clinical Summary and Test Procedures" to match the "Results" subheading on Line 157. Line 132 should be a new paragraph.

Response: We agree with the suggestions of the reviewer and made the pertinent changes (Lines 115, 135).

11. In addition, the authors should add one recent reference that supports their observations:

Fesler MC, Shah JS, Middelveen MJ, Burrascano JJ, Stricker RB. Lyme disease: diversity of Borrelia species in California and Mexico based on a novel immunoblot assay. Healthcare (Basel) 2020; 8:97.

Response: We were aware of this publication. However, we had decided not to include it because the study was not done in Mexico. We only included studies done in Mexico, as was established in the methods (Lines 184-186). Additionally, since the study did not report the place from where the Mexican patients had come, they could not be included in the geographical analysis of our work. Both these points were the reasons for not having considered this reference in our current study.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

19 Aug 2020

Lyme disease and Relapsing fever in Mexico: an overview of human and wildlife infections

PONE-D-20-07127R2

Dear Dr. Becker,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Abdallah M. Samy, PhD

Academic Editor

PLOS ONE

9 Sep 2020

PONE-D-20-07127R2

Lyme disease and Relapsing fever in Mexico: an overview of human and wildlife infections

Dear Dr. Becker:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Abdallah M. Samy

Academic Editor

PLOS ONE