Literature DB >> 32848321

Prevalence, molecular detection, and virulence gene profiles of Campylobacter species in humans and foods of animal origin.

Ashraf M A Barakat1, Khaled A Abd El-Razik2, Hassan A Elfadaly1, Nagwa S Rabie3, Sabry A S Sadek1, Abdulaziz M Almuzaini4.   

Abstract

BACKGROUND AND AIM: Campylobacteriosis is one of the most well-characterized bacterial foodborne infections worldwide that arise chiefly due to the consumption of foods of animal origin such as poultry, milk, and their products. The disease is caused by numerous species within the genus Campylobacter, but Campylobacter jejuni is the most commonly isolated species from established cases of human campylobacteriosis. This study was conducted to determine the prevalence and virulence of Campylobacter isolates from human, chicken, and milk and milk products in Egypt.
MATERIALS AND METHODS: A total of 1299 samples (547 chicken intestine and liver, 647 milk and milk products, and 105 human stool) were collected and microbiologically investigated, confirmed by multiplex polymerase chain reaction (PCR) targeting the 23S rRNA, hipO, and glyA genes specific for Campylobacter spp., C. jejuni, and Campylobacter Coli, respectively, followed by virulence genes (Campylobacter adhesion to fibronectin F [cadF] and cdtB) detection using PCR.
RESULTS: About 38.09%, 37.84%, and 8.5% of human stool, chicken, and milk and milk product samples, respectively, were bacteriologically positive, with a total of 302 Campylobacter isolates. All isolates were molecularly confirmed as Campylobacter spp. (100%) where 285 isolates (94.37%) were identified as C. jejuni and 17 isolates (5.62%) as C. coli. Regarding the virulence pattern, all isolates (100%) carried cadF gene while cytolethal distending toxin B gene was definite in 284/302 isolates (94%), concisely, 282/285 (98.94%) C. jejuni isolates, and in 2/17 (11.76%) C. coli isolates.
CONCLUSION: The widespread presence of these highly virulent Campylobacter, especially C. jejuni, proofs the urgent need for the implementation of stringent control, public health, and food protection strategies to protect consumers from this zoonotic pathogen. The availability of information about pathogen virulence will enable enhanced local policy drafting by food safety and public health officials. Copyright: © Barakat, et al.

Entities:  

Keywords:  Campylobacter; Egypt; food; human stool; multiplex polymerase chain reaction; virulence genes

Year:  2020        PMID: 32848321      PMCID: PMC7429388          DOI: 10.14202/vetworld.2020.1430-1438

Source DB:  PubMed          Journal:  Vet World        ISSN: 0972-8988


Introduction

Campylobacteriosis is a serious zoonotic gastrointestinal disease worldwide, and most cases are mainly caused by Campylobacter jejuni. Poultry plays an important role in the transmission of campylobacteriosis to humans [1]. C. jejuni colonizes the chicken gut primarily in the cecum and small intestine but also colonizes the liver and spleen [2]. Thus, the intestinal tract of chickens supplies a reservoir of Campylobacter that may spread through fecal material at farms or during processing [3]. Human Campylobacter infection may be due to either the consumption of undercooked meat or the cross-contamination of ready-to-eat food during preparation or storage [4]. Worldwide, C. jejuni is responsible for 85% of foodborne Campylobacter enteritis in humans and is the most frequently isolated Campylobacter species recovered from poultry, while the remaining cases are primarily attributed to Campylobacter coli [5]. Campylobacter species are the main cause of bacterial gastrointestinal disease campylobacteriosis, which causes diarrhea, sometimes dysentery syndrome, and cramps, fever, and pain in developing countries. In particular, C. jejuni and C. coli are accountable for campylobacteriosis [6]. The isolation of campylobacters using the culture method is considered the gold standard for campylobacteriosis disease diagnosis; however, it is time-consuming and laborious because of the fastidious nature of campylobacters [7]. In addition, the differentiation of species using biochemical assays is difficult due to the phylogenetic relatedness of C. jejuni and C. coli species [8]. Thus, molecular-based assays, such as polymerase chain reaction (PCR) and sequencing, can enable easy, rapid, and specific detection and epidemiological applications [9]. For this purpose, various genes have been used [10]. Several genes have been linked to Campylobacter virulence, but the most important are cytolethal distending toxin B (cdtB), which disrupts mucosal ­barriers by causing host cell death, Campylobacter adhesion to fibronectin F (cadF), and the heat survival and stress response proteins htrB and clpP, which are important for survival [10,11]. The disease severity depends on the virulence of the strain and on the host’s immune condition . cadF is one of the reference virulence genes that encode a protein involved in the invasion and adhesion of C. jejuni [12], and this gene is present at a high level in C. jejuni isolates [13]. Despite the increased recovery of Campylobacter as a foodborne pathogen, the specific virulence and pathogenic mechanisms by which microaerophilic Campylobacter species cause infection are still poorly understood [14]. The putative virulence factor for adhesion and invasion of epithelial cells, toxin production, and flagellar motility are thought to be important virulence mechanisms [15]. However, different studies have indicated that different virulence markers play a role in the colonization, adherence, and invasion of Campylobacter spp. in animals and humans [15]. The aim of this study was to investigate the prevalence of Campylobacter spp. using conventional and molecular tools and to determine the virulence gene profile of Campylobacter spp. in humans and foods of animal origin in Egypt.

Materials and Methods

Ethical approval

All aspects of the study were performed in accordance with national ethics regulations and approved by the National Research Ethical Committee, National Research Centre, Giza, Egypt (Ethical Approval no 16220). Written consent was taken from patients before collecting stool samples.

Sample collection

A total of 1299 samples (Table-1) from chickens (n=547), milk and milk products (n=647) from various markets, and human stool (n= 105) were collected randomly from different governorates in Egypt (Cairo, Giza, Fayoum, and Qalyubia) from January 2018 to December 2018. The human stool specimens were collected at random from people with diarrhea who were admitted to different laboratories, people in contact with backyard chickens and slaughterhouses and from diarrheic children admitted to hospitals for kids in Egypt. Ten grams of each sample (chicken intestine and liver, milk and milk products, and human stool) were collected in a sterile sample collection vial and transferred to the laboratory. All samples were immediately stored at 4°C and processed to isolate campylobacters.
Table-1

Samples collected from different localities in Egypt.

Site of samplesNumber of samplesChicken samplesMilk and milk productsHuman stool


IntestineLiverMilkCheeseYoghurt
Giza4001656077404117
Fayoum3191151065524730
Cairo266601065405932
Qalyubia314804767484626
Total1299420127274180193105
Samples collected from different localities in Egypt.

Isolation and identification of Campylobacter

A loop of each sample was homogenized in sterile thioglycollate broth (Oxoid). Broth samples were incubated at 42°C for 48 h in a microaerobic atmosphere using an anaerobic jar with CampyGen sachets, which generates 10% CO2, 5% O2, and 85% N2. A loopful of enrichment broth was streaked onto mCCDA plates (Oxoid) and incubated under microaerobic condition at 42°C for 48 h followed by microscopic examination to examine their characteristic motility utilizing phase contrast microscope after staining by Gram’s stain presenting seagull appearance. All isolates were subjected to biochemical tests, such as catalase, oxidase, urease, nitrate reduction, indole acetate hydrolysis, and hippurate hydrolysis tests and susceptibility tests to cephalothin and nalidixic acid by the disk diffusion method [16].

Molecular characterization of Campylobacter species

DNA extraction

DNA was extracted by the heating and snap chilling method [17]. Two to three colonies of fresh bacterial growth were collected from culture medium, suspended in nuclease-free demonized water, and heated at 95°C for 10 min. The samples were cooled immediately and centrifuged for 5 min at room temperature. The supernatant was separated and 3 μl was used as the DNA template.

Confirmation of Campylobacter spp., C. jejuni, and C. coli isolates by multiplex PCR

A multiplex PCR reaction was used for the confirmation of biochemically identified Campylobacter spp. through targeting 23S rRNA specific for Campylobacter spp., hipO gene specific for C. jejuni, and glyA gene specific for C. coli (Table-2) [18-21]. Primers were utilized in a 25 μl reaction containing 12.5 μl of 2× ViRed Taq Master Mixture (Cat. no. CLMM01, Vivantis Technologies, Malaysia), 1 μl of each primer (20 pmol), 5.5 μl of water, and 3 μl of template. Cycling conditions begin with initial denaturation at 95°C for 6 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 59°C for 30 s, and extension at 72°C for 30 s with a single final extension step at 72°C for 10 min. The PCR products were separated by electrophoresis on 1% agarose gel.
Table-2

Primer sets for PCR amplification of the four target genes of Campylobacter species.

Target genePrimerPrimer sequence (5’→’)Size (in bp)References
Campylobacter spp. 23S rRNACB1 CB2TATACCGGTAAGGAGTGCTGGAG ATCAATTAACC TTCGAGCACCG650[19]
Campylobacter jejuni hipOCJF CJRACTTCTTTATTGCTTGCTGC GCCACAACAAGTAAAGAAGC323[19]
Campylobacter coli glyACCF CCRGTAAAACCAAAGCTTATCGTG TCCAGCAATGTGTGCAATG126[18]
Campylobacter adherence gene (cadF)cad F cad RTTGAAGGTAATTTAGATATG CTAATACCTAAAGTTGAAAC400[20]
Cytolethal distending toxin subunit B gene (cdtB)CdtB-F CdtB-RGTTGGCACTTGGAATTTGCAAGGC GTTAAAATCCCCTGCTATCAACCA495[21]

PCR=Polymerase chain reaction

Primer sets for PCR amplification of the four target genes of Campylobacter species. PCR=Polymerase chain reaction

Virulence gene characterization of Campylobacter isolates

The confirmed isolates of Campylobacter species were characterized for in vitro detection of virulence genes by PCR for two well-known virulence genes encoding the cadF [20] and cdtB genes [14]. The details of the primers for the target virulence genes are described in Table-2. Cycling conditions were as previous with annealing at 45°C for cadF gene and 57°C for cdtB gene.

Phylogenetic tree construction

The positive PCR products targeting the cadF gene of two C. jejuni samples (CJ1 and CJ2) were sequenced by MACROGEN Company (Korea) on 3730XL sequencers (Applied Biosystems, USA). The accuracy of the data was confirmed by two-directional sequencing with the forward and reverse primers used in PCR. The nucleotide sequences obtained in this study were analyzed using the programs BioEdit 7.0.4.1 and Muscle (https://www.ebi.ac.uk/Tools/msa/muscle/). The resulting sequences were aligned with the cadF virulence gene of Campylobacter spp. reference sequences (Table-3) using neighbor-joining analysis of the aligned sequences implemented in the program CLC Genomics Workbench 3.
Table-3

Details of Campylobacter jejuni isolates used in the present study and available in GenBank.

S. No.OrganismStrainHostIsolation sourceCountryAccess. No.
1Campylobacter jejuniCJ1Broiler chickenIntestineEgyptMN103381
2Campylobacter jejuniCJ2Broiler chickenLiverEgyptMN103382
3Campylobacter jejuni subsp . jejuniD42aChickenCaecumUSACP007751
4Campylobacter jejuniRM1285ChickenBreast exudateUSACP012696
5Campylobacter jejuniYQ2210Turkey----USACP017859
6Campylobacter jejuni104Chicken----BrazilCP023343
7Campylobacter jejuniCFSAN032806ChickenBreastUSACP023543
8Campylobacter jejuniFDAARGOS_421ChickenCarcassUSACP023866
9Campylobacter jejuniNCTC 12664Chicken----United KingdomCP028912
10Campylobacter jejuniFORC_083ChickenMeatSouth KoreaCP028933
11Campylobacter jejuni subsp . jejuniCLB104ChickenLiverUnited KingdomCP034393
12Campylobacter jejuni subsp . jejuni00-2425HumanStoolCanadaCP006729
13Campylobacter jejuniCJ074CC443Human----FinlandCP012216
14Campylobacter jejuni subsp . jejuniRM3196Human----South AfricaCP012690
15Campylobacter jejuniFDAARGOS_263HumanStoolUSACP022077
16Campylobacter jejuniFDAARGOS_422Human----USACP023867
17Campylobacter jejuni subsp . jejunihuA17HumanStoolGermanyCP028372
18Campylobacter jejuni subsp . jejuniNCTC10983HumanBloodUnited KingdomLR134511
Details of Campylobacter jejuni isolates used in the present study and available in GenBank.

Results

Identification of Campylobacter species

In this investigation, samples were collected from Giza, Fayoum, Cairo, and Qalyubia in Egypt for the isolation of Campylobacter spp. from chicken, milk, milk products, and human stool. Campylobacter spp. were isolated from 37.84% of chickens, 8.5% of milk and milk product samples, and 38.09% of human stool samples with a total of 302 (23.24%) Campylobacter spp. isolates (Table-4).
Table-4

Prevalence of Campylobacter genus in the examined samples by conventional and molecular methods.

Type of samplesIncidence by conventional methodIncidence of C. jejuni by multiplex PCRIncidence of C. coli by multiplex PCR



n%n%n%
Chickens207/54737.84193/20793.2314/2076.76
Intestine160/42038.09158/16098.752/1601.25
Liver47/1273735/4774.4612/4725.5
Milk and milk products55/6478.555/551000/550
Raw milk14/2745.114/141000/140
Cheese14/1807.7714/141000/140
Yoghurt27/19313.9827/271000/270
Human stool40/10538.0937/4092.53/407.5
Total302/129923.24285/30294.3717/3025.62

C. jejuni=Campylobacter jejuni, C. coli= Campylobacter coli, PCR=Polymerase chain reaction

Prevalence of Campylobacter genus in the examined samples by conventional and molecular methods. C. jejuni=Campylobacter jejuni, C. coli= Campylobacter coli, PCR=Polymerase chain reaction

Confirmation of Campylobacter spp., C. jejuni, and C. coli isolates by multiplex PCR

The 302 biochemically identified Campylobacter isolates were molecularly confirmed by the amplification of 23S rRNA gene of Campylobacter spp., the hipO gene specific to C. jejuni, and the glyA gene specific to C. coli. All the 302 isolates were confirmed as Campylobacter (Figure-1), of which 94.37% as C . jejuni and 5.62% as C. coli (Figures-2 and 3, Table-4).
Figure-1

Amplification of the 23S rRNA gene of Campylobacter spp. positive amplification appeared at 650 bp, lane 1: 100 bp ladder, lane 2: The positive control, lanes 3-7: Positive for Campylobacter spp.

Figure-2

Amplification of the hipO gene of Campylobacter jejuni, positive amplification appeared at 323 bp, lane 1: 100 bp ladder, lane 2: The positive control C. jejuni, lanes 3 and 4: Positive for C. jejuni.

Figure-3

Amplification of the glyA gene of Campylobacter coli, positive amplification appeared at 126 bp, lane 1: 100 bp ladder and lane 2: The positive control C. coli, lanes 4-6: Positive for C. coli.

Amplification of the 23S rRNA gene of Campylobacter spp. positive amplification appeared at 650 bp, lane 1: 100 bp ladder, lane 2: The positive control, lanes 3-7: Positive for Campylobacter spp. Amplification of the hipO gene of Campylobacter jejuni, positive amplification appeared at 323 bp, lane 1: 100 bp ladder, lane 2: The positive control C. jejuni, lanes 3 and 4: Positive for C. jejuni. Amplification of the glyA gene of Campylobacter coli, positive amplification appeared at 126 bp, lane 1: 100 bp ladder and lane 2: The positive control C. coli, lanes 4-6: Positive for C. coli. In detail, 69.35%, 57.5%, and 63.33% of isolates from chicken, milk and milk product, and human stool samples were confirmed as C. jejuni while 6.76% and 5.62 of chicken and human stools samples as C. coli, respectively (Table-4).

Virulence determinants

With regard to the virulence pattern, all isolates carried the virulence associate gene cadF (100%), while cdtB gene was positive in 284 out of the 302 isolates (94%). Briefly, 282 out of 285 (98.94%) of C. jejuni isolates and 2 out of 17 (11.76%) of C. coli isolates were positive for cdtB gene (Figure-4a and b).
Figure-4

Agarose gel electtrophoresis of polymerase chain reaction products obtained with primers for, (a) the cadF gene. Lane 1, 100 bp ladder; 2-10, 400 bp fragment of the cadF gene of Campylobacter jejuni and Campylobacter coli. (b) The cdtB gene. Lane 1, 100 bp ladder; 2-9, 495-bp fragment of the cdtB gene of C. jejuni and C. coli.

Agarose gel electtrophoresis of polymerase chain reaction products obtained with primers for, (a) the cadF gene. Lane 1, 100 bp ladder; 2-10, 400 bp fragment of the cadF gene of Campylobacter jejuni and Campylobacter coli. (b) The cdtB gene. Lane 1, 100 bp ladder; 2-9, 495-bp fragment of the cdtB gene of C. jejuni and C. coli.

Nucleotide sequence accession numbers

Two sequences (C. jejuni cadF gene) used in this study (CJ1 and CJ2) have been deposited in the GenBank database under the accession nos. MN103381-MN103382. Phylogenetic analysis confirmed that the two isolates were C. jejuni with homology results of 99-100%. In the phylogenetic tree, all Egyptian isolates formed two separate clusters (Figure-5). Phylogenetic analysis showed that CJ1 (MN103381) and CJ2 (MN103382), which were isolated from the intestine and liver of chickens, respectively, had typical homology with C. jejuni isolated from either chicken or human (Figure-5).
Figure-5

Phylogenetic relationship of selected strains of Campylobacter jejuni from poultry, milk and milk products, and human; the accession numbers of the isolates used are given.

Phylogenetic relationship of selected strains of Campylobacter jejuni from poultry, milk and milk products, and human; the accession numbers of the isolates used are given.

Discussion

In the current study, Campylobacter spp. were isolated from 37% to 38.09% of the liver and intestine of chickens, respectively. Similar isolation rate (28.3%) from cloacal swabs was reported in Egypt [22]. Comparable isolation rates (31.9% and 39.2%) were reported in Vietnam [23] and Estonia [24], respectively. Reduced isolation rate (16.83%) was reported by Abushahba et al. [25]. The reported prevalence rate of Campylobacter spp. is higher in the previous studies than in this study, for instance, 41.2% and 48.5% in Egypt [22,26] and 58% in Brazil [27]. The aforementioned high isolation rates could be attributed to the extensive type of chicken management that increases the exposure of birds to Campylobacter infection through insects, rodents, contaminated water, and poor housing hygiene [28]. In addition, high isolation rates of 82.9% in Italy and 51.5% in Nigeria from chicken cloacal swabs, respectively, were reported [29,30], which could be a result of using only conventional methods. The variation in the isolation rate of Campylobacter spp. between different studies could be attributed to the age of the examined chickens [31] and the difference in the sanitation levels, while handling and processing chickens, the type and site of the examined samples, the sampling season, the laboratory methodologies employed for isolation, husbandry and management, and the production system have the greatest impact on the prevalence rate of campylobacters [32]. Cattle play an important role in human campylobacteriosis. There are cattle-related outbreaks that indicate that raw milk and dairy products are the second most frequent sources of infection. Direct contamination of milk may occur through feces or as a consequence of mastitis [33]. In the current study, Campylobacter spp. was isolated from 8.5% of milk and milk products samples (5.1%, 7.77%, and 13.98% of raw milk, cheese, and yoghurt samples, respectively). The higher percentage of Campylobacter in milk products than in raw milk is explained by the contamination of milk products because of unhygienic conditions during the preparation of milk products. A similar isolation rate of Campylobacter from raw milk (7.2%) was reported in Turkey [1]. Relatively low prevalence rates of 2.91% and 2.32% were reported [17,34], respectively. In contrast, high prevalence rates of Campylobacter in milk at 17.2%, 20%, and 66.8% were reported [35-37]. Here, Campylobacter spp. were isolated from 7.77% and 13.98% of cheese and yoghurt samples, respectively. Similarly, a prevalence rate of 5.0% from cheese was reported by Giacometti et al. [38]. In the contrary, Campylobacter was absent from milk product samples in some reports [17,39]. This emphasizes the importance of milk and dairy products as a potential source of Campylobacter. In general, Campylobacter is the most common bacterium that induces gastroenteritis in humans globally and can be fatal to young children, geriatric patients, and immunocompromised patients [40]. In the current study, an isolation rate of 38.09% was reported in stool samples from humans. These results were concurrent with the isolation rate (33.33%) detected by Rouby et al. [41] in Egypt but were higher than those (27.5%) detected by Abushahba et al. [25] in Egypt. The high percentage detected in our study could be attributed to the inclusion of stool samples primarily obtained from gastroenteritis-infected individuals rather than investigating the disease in the general population. PCR is still rapid, specific, sensitive, and of substantial interest for the recognition and verification of Campylobacter species. Thus, PCR is a dependable substitute for conventional culture [3,42]. Molecular methods were used to confirm the detected Campylobacter species and to differentiate between C. jejuni and C. coli, as the discrimination of C. jejuni and C. coli is considered difficult because it depends only on a single phenotypic test [8]. Therefore, here, multiplex PCR was used to identify the isolated Campylobacter spp. (302 isolates) by targeting the 23S rRNA specific for Campylobacter spp., hipO gene of C. jejuni, and the glyA gene of C. coli. The multiplex PCR results confirmed all the 302 biochemically identified isolates as Campylobacter spp. of which 285 isolates as C. jejuni (94.37%) and 5.62% as C. coli. A total percentage of 69.35%, 57.5%, and 63.33% of isolates from chicken, milk and milk product, and human stool samples were confirmed as C. jejuni while 6.76% and 5.62 of chicken and human stools samples as C. coli, respectively. One hundred and ninety-three out of 207 Campylobacter isolates (93.23%) recovered from chicken samples were identified as C. jejuni using multiplex PCR. Similar results using PCR, where C. jejuni was the predominant isolate and reached prevalence rates as high as 87.5%, 90%, and 89% in frozen chicken carcasses as reported in Egypt [3], in Great Britain [43], and in Vietnam [23], respectively. The predominance of C. jejuni may be due to its ability to survive high and low temperatures, low pH, and dry conditions [44]. This was contrary to the findings in Egypt [22,26] and in Argentina [45], those reported C. jejuni as the only species isolated and molecularly identified from chickens. Moreover, 14 out of 207 Campylobacter isolates (6.76%) recovered from chicken samples were identified as C. coli using multiplex PCR. Only a few reports are available regarding C. coli as the predominant isolate in Egypt [42] and Greece [46]. This may be due to the type of feed ration because C. jejuni does not frequently colonize birds receiving plant protein-based feed [46]. A total of 55 Campylobacter isolates recovered from milk and milk products were identified as C. jejuni (100%) using multiplex PCR. This was concurrent with the findings in Egypt [17], indicating that this species is distributed widely in the study areas. Similar results reported that C. jejuni was the predominant isolate (85.7%) in Turkey [1]. A total of 37 out of 40 Campylobacter isolates recovered from human stool were identified as C. jejuni (92.5%) and 3 out of 40 isolates as C. coli (7.5%) using multiplex PCR. The isolation rates of C. jejuni that were higher than those of C. coli from Campylobacter-positive stool samples were in relative agreement with that (61.7%) of Sainato et al. [40] and with higher prevalence than those (27.5% and 8.4%) of Abushahba et al. [25] and Omara et al. [47] in Egypt, respectively. The high prevalence observed in our study may be a result of collecting samples from humans originating from villages, where basic hygienic standards and precautions for the contact and handling of live poultry are usually not adopted. This was in contrast with the findings of Rouby et al. [41] who reported that PCR revealed that all isolates were C. jejuni. Moreover, C. coli was the predominant isolate, as high as 1.11% and 3%, as reported in Egypt [25] and in Poland [48], respectively. The minimal infective dose of C. jejuni is very low, which indicates that C. jejuni is highly virulent, and a very small number of bacterial cells could cause infection in humans. The virulence of Campylobacter species is associated with flagellar motility, adhesion, invasion, and production of cytolethal distending toxins [49]. Several genes have been linked to Campylobacter virulence that might contribute to human infection and colonization of chickens [13]. The most important are cdtB, which disrupts mucosal barriers by causing host cell death, and cadF [26]. The detection of the cadF gene in all C. jejuni and C. coli isolates (100%) from chickens was in agreement with the findings from the previous reports [50,51]; similarly, the results of this study were consistent with the previous results regarding the presence of C. coli from humans [51]. However, a higher percentage was identified in this study than in other reports (41.6% and 8%), among all C. jejuni isolates [1,50]. The high prevalence rate (100%) of the cadF gene in the present study shows that many strains originating from poultry, milk and milk products have potential pathogenic properties toward humans, as reported by Frasao et al. [13] and Kalantar et al. [19]. According to Gonzalez-Hein et al. [52], CdtB cytotoxin subunit is encoded by cdtB gene that plays an essential role in exerting a toxic effect on cells. In the present study, Campylobacter cytotoxic factor (cdtB) was confirmed in 98.94% of C. jejuni isolates and 11.76% of C. coli isolates. The occurrence of cdtB from chicken isolates in this study was higher than that of Abu-Madi et al. [50] and ELSayed et al. [26] who reported 6.7% and 0%, respectively, but less than that of Modi et al. [17] that reported the presence of cdtB gene in all isolates from bovine and swine tissue. Our findings confirm the relatively higher prevalence of cdtB gene in C. jejuni in comparison to C. coli. This is in parallel with that of Wysok et al. [53].

Conclusion

Our study demonstrated the widespread existence of highly virulent Campylobacter isolates, especially C. jejuni in chicken, milk and milk product, and human, confirming that this species is a serious infection hazard and public health concern. Moreover, this study emphasizes the urgent need for the implementation of stringent control, public health, and food protection strategies to protect consumers from this zoonotic pathogen. The availability of information about pathogen virulence will enable enhanced local policy drafting by food safety and public health officials and will increase the awareness of this medically and economically important pathogen.

Authors’ Contributions

AMAB and NSR designed the study, conducted the experiments, and revised the manuscript; HAE and SASS conducted bacterial isolation and identification. KAAE and AMA performed the molecular identification and characterization and wrote the manuscript. All authors read and approved the final manuscript for publication.
  33 in total

1.  Four-year monitoring of foodborne pathogens in raw milk sold by vending machines in Italy.

Authors:  Federica Giacometti; Paolo Bonilauri; Andrea Serraino; Angelo Peli; Simonetta Amatiste; Norma Arrigoni; Manila Bianchi; Stefano Bilei; Giuseppe Cascone; Damiano Comin; Paolo Daminelli; Lucia Decastelli; Mattia Fustini; Renzo Mion; Annalisa Petruzzelli; Roberto Rosmini; Gianluca Rugna; Marco Tamba; Franco Tonucci; Giuseppe Bolzoni
Journal:  J Food Prot       Date:  2013-11       Impact factor: 2.077

2.  Effects of diet formulations containing proteins from different sources on intestinal colonization by Campylobacter jejuni in broiler chickens.

Authors:  Roy S Udayamputhoor; Harry Hariharan; Ted A Van Lunen; P Jeffrey Lewis; Susan Heaney; Lawrence Price; David Woodward
Journal:  Can J Vet Res       Date:  2003-07       Impact factor: 1.310

3.  PCR detection of seven virulence and toxin genes of Campylobacter jejuni and Campylobacter coli isolates from Danish pigs and cattle and cytolethal distending toxin production of the isolates.

Authors:  D D Bang; E Møller Nielsen; F Scheutz; K Pedersen; K Handberg; M Madsen
Journal:  J Appl Microbiol       Date:  2003       Impact factor: 3.772

Review 4.  Review of current methodologies to isolate and identify Campylobacter spp. from foods.

Authors:  Gregory Gharst; Omar A Oyarzabal; Syeda K Hussain
Journal:  J Microbiol Methods       Date:  2013-07-27       Impact factor: 2.363

5.  Epidemiology of Campylobacter Infections among Children in Egypt.

Authors:  Rebecca Sainato; Atef ElGendy; Frédéric Poly; Janelle Kuroiwa; Patricia Guerry; Mark S Riddle; Chad K Porter
Journal:  Am J Trop Med Hyg       Date:  2017-12-14       Impact factor: 2.345

6.  Comparative analysis of cultural isolation and PCR based assay for detection of campylobacter jejuni in food and faecal samples.

Authors:  Harkanwaldeep Singh; R S Rathore; Satparkash Singh; Pawanjit Singh Cheema
Journal:  Braz J Microbiol       Date:  2011-01       Impact factor: 2.476

7.  Characterization of antimicrobial resistance patterns and detection of virulence genes in Campylobacter isolates in Italy.

Authors:  Elisabetta Di Giannatale; Gabriella Di Serafino; Katiuscia Zilli; Alessandra Alessiani; Lorena Sacchini; Giuliano Garofolo; Giuseppe Aprea; Francesca Marotta
Journal:  Sensors (Basel)       Date:  2014-02-19       Impact factor: 3.576

Review 8.  The importance of the viable but non-culturable state in human bacterial pathogens.

Authors:  Laam Li; Nilmini Mendis; Hana Trigui; James D Oliver; Sebastien P Faucher
Journal:  Front Microbiol       Date:  2014-06-02       Impact factor: 5.640

9.  In Silico Analysis of the cadF Gene and Development of a Duplex Polymerase Chain Reaction for Species-Specific Identification of Campylobacter jejuni and Campylobacter coli.

Authors:  Saeed Shams; Bita Bakhshi; Tahereh Tohidi Moghadam
Journal:  Jundishapur J Microbiol       Date:  2016-02-09       Impact factor: 0.747

10.  Prevalence of Campylobacter species in milk and milk products, their virulence gene profile and anti-bio gram.

Authors:  Shivani Modi; M N Brahmbhatt; Y A Chatur; J B Nayak
Journal:  Vet World       Date:  2015-01-02
View more
  2 in total

1.  Multiplex PCR: Aid to more-timely and directed therapeutic intervention for patients with infectious gastroenteritis.

Authors:  Karim Montasser; Heba Ahmed Osman; Hanan Abozaid; Haidy S Khalil; Wesam Hatem Amer; Abeer M M Sabry
Journal:  Medicine (Baltimore)       Date:  2022-10-14       Impact factor: 1.817

2.  Chronic exposure to Cytolethal Distending Toxin (CDT) promotes a cGAS-dependent type I interferon response.

Authors:  Benoît J Pons; Aurélie Pettes-Duler; Claire Naylies; Frédéric Taieb; Catherine Bouchenot; Saleha Hashim; Patrick Rouimi; Maxime Deslande; Yannick Lippi; Gladys Mirey; Julien Vignard
Journal:  Cell Mol Life Sci       Date:  2021-07-25       Impact factor: 9.261

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.