Literature DB >> 27258021

Prevalence of Virulence/Stress Genes in Campylobacter jejuni from Chicken Meat Sold in Qatari Retail Outlets.

Marawan Abu-Madi1, Jerzy M Behnke2, Aarti Sharma1, Rebecca Bearden1, Nadia Al-Banna3.   

Abstract

Chicken meat from the shelves of supermarkets in Qatar was tested for the presence of Campylobacter spp. and the presence of five virulence genes (htrB, cdtB, clpP, cadF and ciaB) was assessed in isolates. Forty eight percent of the chickens provided for supermarkets by Saudi (53%) and Qatari (45.9%) producers were found to be contaminated and the most important factor affecting the overall prevalence of contaminated chickens was the store from which chicken samples originated. Variation in prevalence of Campylobacter in chicken meat from different stores was evident even when the same producer supplied the three stores in our survey. Differences in the prevalence and in the combinations of virulence genes in isolates that can and cannot grow in a classic maintenance medium (Karmali) were identified, providing a starting point for linking presence/absence of particular virulence genes with actual in vivo virulence and pathogenicity. Because of the relatively low infective doses of Campylobacter that are required to initiate infection in humans, it will be important to explore further the relationships we identified between certain Campylobacter virulence genes and their capacity for survival in poultry meat, and hence their contribution to the incidence of campylobacteriosis.

Entities:  

Mesh:

Substances:

Year:  2016        PMID: 27258021      PMCID: PMC4892673          DOI: 10.1371/journal.pone.0156938

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Campylobacter is the leading cause of bacterial gastroenteritis in the world [1]. Infection is generally manifested as self-limiting diarrhoea that lasts 3–5 days, but in some cases it may progress to bloody diarrhoea and have life-threatening consequences. Campylobacter is suspected of causing disease via cytotoxin production [2], intestinal cell invasion [3] and extra-intestinal adherence and translocation [4]. Several genes have been linked to Campylobacter virulence but the most important are Campylobacter invasion protein B (ciaB), which is vital for invasion, cytolethal distending toxin B (cdtB), which disrupts mucosal barriers by causing host cell death, Campylobacter adhesin to fibronectin F (cadF), and the heat survival and stress response proteins htrB and clpP, which are important for survival [5,6]. Most human campylobacteriosis cases are caused by a single species, Campylobacter jejuni, which makes it clinically and microbiologically the most relevant species. Campylobacter is ubiquitous and has been isolated from water, milk, and beef. The main sources of contamination are via the handling and consumption of fresh and undercooked poultry products, in domestic settings, restaurants and in commercial facilities [7]. An Iranian study found that Campylobacter contamination was more commonly found among raw chicken meat than beef collected at retail stores in Tehran [8]. The percentage of contaminated poultry carcasses varies from country to country, it can be as low as 15%, as in Iceland [9], and as high as 90%, as in the USA [10]. Several studies have emphasized the direct role that poultry consumption plays in the spread of Campylobacter. During the early summer of 1999, the dioxin crisis started in Europe when the carcinogenic substance was found in the feed of poultry. A ban was issued and all poultry products were withdrawn and banned from the market. During this period there was a 40% reduction in the number of reported C. jejuni infections [11]. Another line of evidence comes from Iceland which, prior to 1996, had a low incidence of C. jejuni infections [9]. However, after 1996, fresh poultry products were introduced into the markets, and the incidence of C. jejuni confirmed cases increased from only 38 cases per 100,000 to reach a peak of 116 cases per 100,000 in 1999. Upon investigation, it was found that 62% of broiler carcasses were contaminated with C. jejuni [9]. As a preventive measure, birds from poultry flocks testing positive were frozen and only birds from C. jejuni-free flocks were sold fresh, and subsequently, there was a drop of 16% in the availability of fresh chicken carcasses contaminated with C. jejuni. The corresponding drop in human cases was significant, with only 33 cases per 100,000 in 2000 [9]. These two examples indicate that poultry products are responsible for a significant proportion of human infections. The data collected through a Campylobacter screening study in The Netherlands further supports the hypothesis that poultry is a critical risk factor for Campylobacter infection. This study estimated that 20–40% of laboratory-confirmed C. jejuni cases were linked to poultry consumption or handling [12]. Although campylobacteriosis is a well-recognized problem in Qatar [13] and other countries of the Gulf Cooperation Council, there are no surveillance programs for Campylobacter in the region [14]. While many developed countries have routine procedures for the inspection of poultry products for the presence of Campylobacter no such procedures have been implemented in Qatar. Therefore, in this study, we collected fresh whole chickens of variable weight and from a range of producers and retailers in Qatar. We then assessed the degree to which these three factors (producer, retailer and weight of carcass) affect the prevalence of the bacterium on chicken carcasses. We also determined the percentage of C. jejuni isolates having virulence factors that might contribute to human infection and colonization of chickens. The availability of such information should allow for better local policy drafting by food safety and public health officials and will increase awareness of this medically and economically important bacterium in Qatar and more widely in the Middle East.

Materials and Methods

Isolation and identification of Campylobacter spp.

Ethical approval was obtained from the Institutional Animal Care and Use Committee of Qatar University with number QU-IACUC 002/2011, and this required anonymity being maintained with respect to the identity of the sources of chickens for the study. For this reason, in the analyses that follow we used numbers to distinguish between companies and stores. The sampled chickens were raised by eight different producers, numbered 1–8, and were purchased from three stores in Qatar. One of the producers was based in Qatar (company no. 1). Five of the other companies were identified as being based in Saudi Arabia but for two (no. 7 and 8) we were not able to trace where their chickens were raised. A total of 400 packages were purchased over a period of one year. Purchased samples were transported in an icebox to maintain the temperature at +4°C. Samples were processed within 1 hour of purchase to ensure maximum recovery of Campylobacter. Upon arrival in the laboratory, samples were opened aseptically and 25 skin samples were collected from the neck, breast and back areas, avoiding the fat. The skin was rinsed with 100ml of ice-cold buffered peptone water (BPW) (Difco, Sparks, MD, USA) and placed along with the BPW, for an enrichment step, in a sterile filter Stomacher plastic bag. The bag was vigorously pounded on its outer surfaces by paddles at 250rpm for 90s before discarding the filter along with the skin. A gas mixture (85% N2, 10% CO2, 5% O2) was infused to create microaerophilic conditions inside the bag, which was finally sealed with a thermo-sealer and incubated for 48 hrs at 42°C. The rinse was centrifuged, re-suspended, and a sample of 25μl was plated on Karmali Campylobacter agar (Oxoid Cat# CM0935) at 42°C under microaerophilic conditions for 48 hrs. Growing colonies were subsequently confirmed to be Campylobacter by Real Time (RT)-PCR (below). For each RT-PCR batch, a confirmed C. jejuni strain (ATCC 33560) was used as a positive control. A subculture from each positive sample was grown to provide material for the identification of virulence genes and this was stored at -70°C until needed.

DNA extraction

DNA was extracted from freshly grown colonies on Karmali plates using Mericon DNA Bacteria Kits (Qiagen, D-40724 Hilden, Germany). In brief, colonies from Karmali agar plates were suspended in 1000μl of water and centrifuged at 13000 × g for 5min. The pellet was suspended in 400μl of lysis buffer (provided in the kit), vortexed and incubated at 95°C for 10 min. Samples were allowed to cool, centrifuged at 13000 × g for 5min and then 100μl of each sample was transferred to 1.5ml microcentrifuge tubes and stored for future use at -20°C. The quality and quantity of the DNA was determined using Nanodrop (Qiagen, Germany). The same procedure was also used to extract DNA from BPW enrichment media.

Real Time (RT)-PCR detection

RT-PCR was performed using the following primers Forward 5’ CTATAACAACTGCACCTACTAT 3’, Reverse 5’ATGAAATTTTTGCCAGTGGTG 3’ and Probe 5’ FAM/CTTAATAGCCGTCACCCCAC 3 for C. jejuni detection and Fwd 5’ GGTATGAAAACTACAAAGCGAG3’, Rvs 5’ ATATTTAGACTATCGTCGCGT3’ for C. Coli identification. The primers were tested on C. jejuni (ATCC 33560) and C. coli (ATCC 33559) to confirm their efficacy. A total of 7μl of Syberselect (Life Technologies) master mixture was used in each reaction along with 0.3μl primer mixture, 2.5μl sample DNA and 10.2μl of molecular grade water. RT-PCR consisted of incubating for 2 min at 95°C followed by 40 cycles of 95°C for 15s, 55.5°C for 35s and 72°C for 1min. Samples were confirmed as positive by comparing to the standard curve of the positive control.

Potential virulence factors genes

RT-PCR was used to detect the presence of five genes (ciaB, cadF, cdtB, htrB and clpP), which are involved mainly in adhesion and invasion [15]. These five genes will be referred to as virulence factors from this point onwards. The primers used and the RT-PCR protocol, were as described in our previous work with Campylobacter [13]. Samples having positive Ct values were confirmed initially by agarose gel electrophoresis for each of the genes targeted in this study. Specimens were run in duplicates.

Statistical analysis

Altogether 400 chicken carcasses obtained from supermarket stores in Qatar were sampled, and the overall prevalence is based on this number. However, statistical analyses of C. jejuni were based on n = 382. Some companies were eliminated from the analysis if the sample sizes for the suppliers were small (Company no. 5, n = 3 and Company no. 8, n = 5) or if information regarding the country in which the chickens were produced proved to be unreliable (Company no. 7, n = 10 and Company no. 8). The sampled chickens weighed between 500 and 1300 g. For convenience they were allocated to three weight classes as follows (weight class 1 = 500 to 800g; weight class 2 = >800 to 1000g; weight class 3 = >1000 to 1300g). The results are presented as percentages with 95% confidence limits (CL95), calculated with bespoke software based on the tables of Rohlf and Sokal [16]. For analysis we used maximum likelihood techniques based on log linear analysis of contingency tables in the software package IBM SPSS Statistics Version 21 (IBM Corporation). Initially, full factorial models were fitted, incorporating as factors COMPANY (5 levels), STORE (3 levels), and WEIGHT CLASS (3 levels). The presence / absence of Campylobacter (INFECTION) was fitted as a binary factor. These explanatory factors were fitted initially to all models that were evaluated. For each level of analysis in turn, beginning with the most complex model, involving all possible main effects and interactions, those combinations that did not contribute significantly to explaining variation in the data were eliminated in a stepwise fashion beginning with the highest level interaction (backward selection procedure). A minimum sufficient model was then obtained, for which the likelihood ratio of χ2 was not significant, indicating that the model was sufficient in explaining the data. The importance of each term (i.e. interactions involving INFECTION) in the final model was assessed by the probability that its exclusion would alter the model significantly and these values relating to interactions that included INFECTION are given in the text. Where complex three way interactions were retained as significant in the final model, we explored these in figures, and also assessed the importance of each of the main effects in turn, fitting simpler models based only on INFECTION and the factor in question (referred to as single factor model). For analysis of numeric scale data, we used the Mann-Whitney U test.

Results

Prevalence of C. jejuni among chicken skin sampled from Qatari Markets

We investigated the prevalence of the bacterium on 400 chicken carcasses. Skin samples of 400 chickens were subjected to the BPW enrichment step then extracted and cultured on Karmali plates. Of the 400 chickens tested, samples from 36.5% (CL95 = 30.76–42.61, n = 146) generated colonies in Karmali agar. DNA was extracted from grown colonies (i.e. “Karmali-agar positive samples”). Identification of C. jejuni was confirmed by RT-PCR. Of the chickens tested, 80.1% (CL95 = 72.68–86.11, n = 117) of the Karmali-agar positive samples were confirmed as C. jejuni by specific RT-PCR. Only one of the chickens was found to be contaminated with C. coli and this was a mixed contamination since C. jejuni was also found on this chicken. DNA extracted from the BPW enrichment media of 24 of the 29 C. jejuni negative samples was also tested for C. jejuni with the specific PCR probe and all proved negative. In addition, 254 chicken skin extracts that did not produce colonies in Karmali agar were then tested for evidence of C. jejuni in the DNA extracted from the BPW enrichment media. Seventy-five samples were positive for C. jejuni DNA (29.5%, CL95 = 25.25–34.17). The samples that were positive for C. jejuni from the Karmali agar plates were combined with the additional 75 that proved positive by DNA extracted directly from the BPW enrichment media to give a total of 192 chickens positive for C. jejuni (48.0%, CL95 = 41.86–54.13). The results from the analysis of the 400 chicken samples are summarized in Fig 1.
Fig 1

Schematic diagram of the stages in the analysis of samples.

The number of samples at each stage are shown.

Schematic diagram of the stages in the analysis of samples.

The number of samples at each stage are shown.

Factors affecting the prevalence of Campylobacter spp.

Further statistical analysis was confined to 382 samples (from companies 1,2,3,4 and 6) since, as explained in the Materials and Methods section, for three producer companies (ref. numbers 5,7 and 8) we had either small sample sizes or unknown locations of producers or both. Analysis by a full factorial model revealed two interesting interactions between factors and these are illustrated in Fig 2. There was significant variation in the percentage of contaminated chickens purchased between the three stores but derived from the same producing company (Fig 2A; producer company x store x INFECTION χ28 = 31.4, P < 0.001; See for example store 3). There was also significant variation between the producers in the percentage of contaminated chickens among the three weight classes (Fig 2B; producer company x weight class x INFECTION χ28 = 21.2, P = 0.007). The percentage of contaminated chickens in different weight classes from Producer Company 1 for example, was similar, whereas for Producer Company 3 the percentage of contaminated chickens increased significantly with weight, and Producer Company 4 supplied most contaminated chickens in the lightest weight class.
Fig 2

Factors affecting the percentage of contaminated chickens.

(A) Variation in the percentage of contaminated chickens from producer companies detected at three stores; (B) Variation in the percentage of contaminated chickens among the three weight classes from the various producer companies.

Factors affecting the percentage of contaminated chickens.

(A) Variation in the percentage of contaminated chickens from producer companies detected at three stores; (B) Variation in the percentage of contaminated chickens among the three weight classes from the various producer companies. Table 1 shows the percentage of chicken carcasses contaminated with C. jejuni by country in which the poultry producer was based, company producing the chickens, store providing the chicken, and weight class of chicken. When tested in single factor models, only one of these main effects was associated with significant variation in the percentage of contaminated chickens (Table 1, stores differed significantly in the percentage of contaminated chickens they supplied).
Table 1

Prevalence (%) of C. jejuni by country in which the producer was based, the company providing chickens, the store selling the chickens and the weight class of samples chickens.

FactorLevel*N%CL95DoFχ2P
CountryQatar14953.044.54–61.29
Saudi Arabia23345.941.24–50.6111.830.176
Company114953.044.54–61.29
211551.343.85–58.76
35339.630.10–49.86
44348.832.63–65.42
62227.312.61–50.0047.400.116
Store114858.149.67–66.22
26847.135.96–58.54
316632.3532.35–49.9429.330.009
Weight class111754.747.19–62.00
210541.935.00–49.05
316048.839.95–57.5723.640.162

The sample size was n = 382

* See Materials and methods for further information about each of the factor levels.

The sample size was n = 382 * See Materials and methods for further information about each of the factor levels.

Virulence factors

The percentage of isolates that grew on Karmali agar plates possessing the five virulence factors is shown in Table 2. Data are included for both the C. jejuni PCR-positive and -negative samples. As can be seen, all five virulence factors were present in both C. jejuni-positive and negative isolates. In positive cultures a prevalence of more than 94% was recorded in each case, whereas in the C. jejuni-negative cultures prevalence was lower. Testing by 2 x 2 Chi Squared indicated that in four cases prevalence was significantly higher in the positive cultures, however, the gene ciaB was universally detected in all isolates. These data were fitted into a multifactorial model and only two of the virulence factors retained significance (htrB χ21 = 3.86, P = 0.049 and clpP χ21 = 7.43, P = 0.006).
Table 2

Presence of 5 virulence factors in colonies grown in Karmali medium that were either positive or negative for C. jejuni, and combined.

Virulence factorPercentage (CL95)
C. jejuni +ve (n = 117)C. jejuni -ve (n = 29)Combined (n = 146)
htrB94.9 (90.50–97.34)75.9 (57.00–88.46)*91.1 (85.06–94.89)
cdtB94.9 (90.50–97.34)72.4 (53.50–86.39)**90.4 (84.35–94.38)
clpP99.2 (96.33–99.86)82.8 (64.05–92.95)***95.9 (91.17–98.27)
cadF96.6 (92.71–98.53)75.9 (57.00–88.46)****92.5 (86.73–95.89)
ciaB100 (97.81–100)100 (88.47–100)100 (97.27–100)

* χ21 = 8.74, P = 0.0031

** χ21 = 11.73, P = 0.0006

*** χ21 = 12.11, P = 0.0005

**** χ21 = 12.23, P = 0.0005

* χ21 = 8.74, P = 0.0031 ** χ21 = 11.73, P = 0.0006 *** χ21 = 12.11, P = 0.0005 **** χ21 = 12.23, P = 0.0005 However, the model revealed interesting and significant interactions between some of the virulence factors, and these are summarised in Table 3. Cultures that were positive for cadF were almost universally also positive for clpP, and those positive for cdtB showed a high prevalence also of clpP and htrB.
Table 3

Significant interactions among virulence factors in isolates that grew in Karmali medium (n = 146).

%CL95χ2P
cadF negativeclpP = 54.5(26.46–80.04)
cadF positiveclpP = 99.3(96.21–99.90)23.1<0.001
cdtB negativeclpP = 64.3(37.11–84.72)
cdtB positiveclpP = 99.2(96.23–99.89)15.6<0.001
cdtB negativehtrB = 42.9(20.61–68.28)
cdtB positivehtrB = 96.2(91.91–98.40)21.6<0.001

Almost all the C. jejuni-positive colonies possessed all five virulence factors (104/117 = 88.9%) and there was just one colony that had a single virulence factor (ciaB). In contrast, only 17/29 C. jejuni-negative colonies (58.6%) had all five virulent factors and 3 had just one (again ciaB in each case).

Almost all the C. jejuni-positive colonies possessed all five virulence factors (104/117 = 88.9%) and there was just one colony that had a single virulence factor (ciaB). In contrast, only 17/29 C. jejuni-negative colonies (58.6%) had all five virulent factors and 3 had just one (again ciaB in each case).

Karmali-negative samples and analysis of BPW enrichment media isolates

Among the 75 samples that were positive for C. jejuni DNA (29.5%), each of the virulence factors was detected far less frequently than in the samples that grew successfully in Karmali medium (Table 4). Only 5/75 (6.7%) of DNA samples had all 5 virulence factors, while 43 (57.3%) had none and 17 (22.7%) just one of the five.
Table 4

Presence (%) of 5 virulence factors in DNA samples from BPW enrichment media of chickens that failed to produce colonies in Karmali medium.

Virulence factor%(CL95)
htrB12.0(6.12–21.86)
cdtB6.7(2.57–15.38)
clpP30.7(20.66–42.63)
cadF26.7(17.27–38.36)
ciaB8.0(3.27–17.07)

Comparison of the number of virulence factors in samples that were positive and negative for C. jejuni in Karmali medium and positive for C. jejuni in the BPW enrichment medium

The mean number of virulence factors detected in samples grown in Karmali medium that were positive for C. jejuni was 4.86 ± 0.046 (n = 117), and those that were negative 4.07 ± 0.258 (n = 29; Combined = 4.7 ± 0.07, n = 146). Although the mean difference is small, nevertheless it was highly significant (Mann-Whitney U test, z = 4.1, P < 0.001). These values compare with a mean of just 0.84 ± 0.155 (n = 75) among the C. jejuni-positive DNAs extracted from the BPW enrichment media of those chickens that failed to produce colonies in Karmali medium. The difference in the number of virulence factors detected in the DNA of C. jejuni-positive colonies in Karmali medium and the DNA from BPW enrichment media of those chickens that failed to provide colonies, but were positive for C. jejuni by PCR, was hugely significant (Mann-Whitney U test, z = 12.0, P < 0.001).

Comparison of the number of virulence factors in chickens supplied by Qatari and Saudi Arabian producers

Table 5 shows the prevalence of the virulence factors in samples from chickens obtained from Qatari and Saudi Arabian producers. The data include typing for virulence factors on bacteria grown on Karmali medium that were positive for C. jejuni by PCR, and those that were not, and also on DNA obtained from BPW enrichment media. It can be seen that the prevalence of the virulence factors cdtB and clpP was lower in isolates obtained from Saudi Arabian producers, but there were no other significant differences between isolates derived from chickens from the two countries.
Table 5

Comparison of prevalence (%) of virulence factors on chickens supplied by Qatari and Saudi Arabian producers.

FactorSourcePCR for CjQatar % (CL95)Saudi Arabia %(CL95)χ2*P*
htrBKarmali+ve92.6 (85.24–96.57)96.8 (90.39–99.19)1.0780.299
htrBKarmali-ve80.0 (34.26–98.97)75.0 (54.24–88.50)0.0580.809
htrBKarmalicombined91.5 (83.51–96.04)90.8 (80.48–96.16)0.0230.880
cdtBKarmali+ve98.1 (92.74–99.70)92.1 (83.85–96.52)2.4430.118
cdtBKarmali-ve80.0 (34.26–98.97)70.8 (50.00–86.08)0.1840.668
cdtBKarmalicombined96.6 (90.37–99.05)86.2 (74.66–93.01)4.9840.026
clpPKarmali+ve100 (95.95–100)98.4 (92.61–99.80)1.2450.264
clpPKarmali-ve100 (50.00–100)79.2 (58.49–91.41)2.0990.147
clpPKarmalicombined100 (95.58–100)93.1 (83.38–97.55)6.3860.012
cadFKarmali+ve96.3 (90.28–98.83)96.8 (90.39–99.19)0.0250.875
cadFKarmali-ve60.0 (18.93–92.35)79.2 (58.49–91.41)0.7610.383
cadFKarmalicombined93.2 (85.75–97.01)92.0 (82.04–96.93)0.0820.775
htrBBPW+ve8.0 (1.45–25.59)10.9 (3.55–26.31)0.1550.694
cdtBBPW+ve4.0 (0.21–19.56)6.5 (1.31–20.39)0.2040.651
clpPBPW+ve36.0 (19.57–56.08)26.1 (13.32–43.48)0.7530.386
cadFBPW+ve20.0 (8.23–39.84)28.3 (15.11–45.68)0.5990.439
ciaBBPW+ve8.0 (1.45–25.59)6.5 (1.31–20.39)0.0530.818

For Karmali isolates for +ve, -ve and combined isolates from Qatar the sample sizes were 54, 5 and 59, and for Saudi Arabia 63, 24 and 87, respectively.

For DNA isolated from BPW enrichment media, all positive for C. jejuni, the sample sizes were 25 from Qatar and 46 from Saudi Arabia

* Significant outcomes are emphasized in bold. All tests have one degree of freedom.

For Karmali isolates for +ve, -ve and combined isolates from Qatar the sample sizes were 54, 5 and 59, and for Saudi Arabia 63, 24 and 87, respectively. For DNA isolated from BPW enrichment media, all positive for C. jejuni, the sample sizes were 25 from Qatar and 46 from Saudi Arabia * Significant outcomes are emphasized in bold. All tests have one degree of freedom.

Discussion

Campylobacter has been established as the leading cause of bacterial gastroenteritis worldwide, and with an estimated 2–28% of diarrhoeal cases attributed to these bacteria in the Arabian Gulf countries [17, 18, 19, 20]. The most common route of transmission is via consumption of contaminated poultry products and our data show clearly that a significant percentage (48%) of the chickens available on the shelves of supermarkets in Qatar carry these bacteria. This is consistent with other studies on the contamination of chicken carcasses with C. jejuni in the region: for example 52.25% of chickens in Saudi Arabia [21], 57% from a study in Bahrain [22], and between 36.5%-76% from various studies in different parts of Iran [8, 23, 24, 25, 26]. Worldwide C. jejuni is responsible for 85% of cases of human campylobacteriosis and is the most frequently isolated Campylobacter species recovered from poultry [26, 27, 28], while the remaining cases are primarily attributed to C. coli [29]. This is despite over 30 species being known to exist, most of the other species being parasites of other warm-blooded animals [30, 31]. In our study, only one sample proved to be C. coli based on specific primers that we used, and this is consistent with other studies [32]. In the present study, the chickens came from both Saudi and Qatari producers but the prevalence of C. jejuni was similar, 53% and 45.9%, respectively. While relatively consistent across Middle-Eastern countries, the prevalence of Campylobacter spp. in chickens in the region is still quite different to values reported from the USA where prevalences exceeding 90% have been reported on chicken carcasses [10]. In the current work, 36.5% of the 400 samples that were tested showed good colony growth on selective Karmali agar, indicating that these could be Campylobacter spp., and 80.1% of these were confirmed as C. jejuni by PCR. However, some colonies grown on Karmali plates were not amplified using our C. jejuni or C. coli-specific PCR probes and therefore could not be confirmed as either of these two species. This may be due in part to the fact that Karmali agar, although developed for the isolation of Campylobacter spp., can give a positive red colouring for other non-Campylobacter strains [33, 34]. It is also possible that the negative PCR results can be attributable to genetic variations in these isolates, such as point mutations in the regions complementary to our primer sequence, thereby altering binding by our primers and preventing amplification. This is an important limitation of the molecular methods employed here, which rely entirely on the amplification of the targeted region. In order to increase the accuracy of our approach, our strategy also comprised detection of Campylobacter in the BPW enriched media for the 254 samples that did not produce colonies on Karmali agar, as BPW has been shown to yield higher detection rates for Campylobacter in PCR [35]. Among these samples, we found evidence for the presence of C. jejuni in a further 29.5% of chickens. The fact that we detected C. jejuni DNA in such samples may reflect the capacity of Campylobacter to survive in cold environments for long periods of time (e.g. +4°C on the skin of chickens), resulting in the final poultry products that are sold to the consumer being contaminated with the bacteria, despite refrigeration. When subjected to unfavourable conditions, such as cold exposure, Campylobacter spp. have been shown to enter a viable but non-culturable (VBNC) state, in which the bacteria are not able to grow in classic media that normally support their growth [36]. However, they remain viable and may revert to virulence when introduced into the gastrointestinal tract of hosts [37, 38]. RT-PCR methods, using propidium monoazide, have been described for the quantification of viable Campylobacter, including those in the VBNC state [39], and thus DNA can be detected in colony-negative samples. Variation in the prevalence of Campylobacter spp. was analysed statistically to identify any interactions between the producer and retailer of the samples under investigations (Table 1) and the size of the chicken carcasses. The most important factor affecting the overall prevalence was the store from which chicken samples originated, and variation in prevalence between stores was evident even when the same producer supplied the three stores in our survey. This suggests that local conditions at the supermarkets are an important contributory factor, either enhancing or inhibiting contamination with Campylobacter during preparation, storage, or display of chicken carcasses in the sale halls of supermarkets. Temperature may also be a crucial factor underlying variability between stores as some store may be freezing the chickens before their display for purchase by consumers. Pre-packaged chickens prepared for sale in stores contain moisture trapped in the packaging, which creates an environment that permits the survival of Campylobacter for several weeks at low temperatures [40]. Variation between stores at these stages of the route from the primary producers to consumers could therefore play a key role in the risk of infection for the public. We also investigated the prevalence of Campylobacter virulence factor genes in the DNA of the C. jejuni isolates from fresh poultry in relation to their growth capacity. Multiple virulence factors linked to adherence, invasion capabilities and toxin production have been implicated in the ability of Campylobacter to colonize and cause disease, and the virulence genes selected for investigation in this study are all significantly linked to disease pathogenesis [41] As expected, ciaB was universally detected in all PCR-positive samples and all 5 virulence factors were present in 88.9% of the colonies on Karmali plates that proved to be C. jejuni. C. jejuni is known to utilize heat-shock proteins, including the ATP-dependent protease clpP, which repairs and prevents the damage caused by an accumulation of unfolded proteins [42, 43]. Its high prevalence among our isolates may be accounted for by the utility of this gene in helping C. jejuni survive through the high temperatures encountered during the summer time in the Arabian Gulf countries. We detected high prevalence of cadF and cdtB in agreement with several studies that found it in nearly all of the Campylobacter isolates [44, 45, 46, 47]. All five virulence factors were expressed in a higher percentage when the sample was both Karmali culture-positive and PCR-positive for C. jejuni. Another interesting finding was that virulence factors were expressed much more rarely in the C. jejuni DNA isolated from BPW-enriched media from chickens that did not produce colonies capable of growing on Karmali plates. This contrasts with the almost universal prevalence of some of the virulence factors in isolates that did grow successfully, highlighting the role of virulence factors in the fitness of Campylobacter isolates, and may well be linked to their ability to grow off the host. It is conceivable that the PCR-positive samples from BPW enriched media that failed to grow in Karmali plates were largely unable to do so because of the absence of the critical virulence factors that we screened for, and perhaps other as yet unknown genes that may also have been absent from these bacteria. The low prevalence of the virulence genes in the culture negative- PCR positives may be attributable also to these being other Campylobacter species or possibly other members of the Campylobacterales that lacked these genes but were nevertheless successfully detected by our PCR probes. The presence of multiple virulence genes is considered to enhance the invasiveness of Campylobacter but exactly how presence/absence of combinations of, or indeed any single, factor/s may be linked to in vivo virulence and pathogenicity in humans is still uncertain. We found significant associations among the virulence factors identified on the Karmali-positive cultures. Positive cultures with cadF were almost always also positive for clpP, while cdtB-positive cultures had a high prevalence of clpP and htrB. Another study has shown increased invasiveness for a combination of cdtB and ciaB [48] but although we did not find a statistically significant interaction between these factors, all isolates were positive for ciaB, and since 94.9% also had the cdtB gene, there were very few isolates without this combination (only 5.1%). If the different combinations of virulence factors among C. jejuni isolates are linked to different potentials for causing disease, this may explain strain-specific difference in virulence [49] and some of the variation reported between studies. In future, it will be of interest to establish the in vivo pathogenicity of such strains circulating in Qatar, since this may be influenced by the host genetic composition and local environmental factors [5]. Finally, the detection of Campylobacter from skin samples of chickens has shown that the products being sold in Qatar have a high degree of contamination. It is pertinent also that these bacteria can control transcription of virulence genes that are necessary for survival under stressful conditions [50]. Thus, the detection of Campylobacter by culture may give false negative results if there are viable but non-culturable bacteria within the sample being investigated, and so the prevalence of C. jejuni can be easily underestimated. The failure of diagnostic procedures relying solely on culture methods to detect all Campylobacter means there is an increased chance of consumer exposure even if there is a screening program based on culture in place. To the best of our knowledge, there is no current screening for Campylobacter in Qatar and because C. jejuni is the most common cause of bacterial gastroenteritis, it is crucial to instigate a thorough and reliable monitoring program to reduce the availability of contaminated products sold in the supermarkets in Qatar. Our work has provided data for the first time on the prevalence of five virulence genes in the contaminated poultry sold in Qatar and has identified differences in the prevalence and in combinations of virulence genes in isolates that can and cannot grow in classic maintenance media. This may well provide a starting point for linking presence/absence of particular virulence genes with actual in vivo virulence and pathogenicity. Because of the relatively low infective doses of Campylobacter that are required to initiate infection in humans, it will be important to explore the relationships identified above between certain Campylobacter virulence genes and their ability to survive in poultry meat and hence contribute to the incidence of campylobacteriosis.

Summary of the data used during this analysis.

(XLSB) Click here for additional data file.
  43 in total

1.  Campylobacter spp. in Icelandic poultry operations and human disease.

Authors:  N J Stern; K L Hiett; G A Alfredsson; K G Kristinsson; J Reiersen; H Hardardottir; H Briem; E Gunnarsson; F Georgsson; R Lowman; E Berndtson; A M Lammerding; G M Paoli; M T Musgrove
Journal:  Epidemiol Infect       Date:  2003-02       Impact factor: 2.451

2.  Prevalence of Arcobacter and Campylobacter on broiler carcasses during processing.

Authors:  Insook Son; Mark D Englen; Mark E Berrang; Paula J Fedorka-Cray; Mark A Harrison
Journal:  Int J Food Microbiol       Date:  2006-09-18       Impact factor: 5.277

3.  Evaluation of cytotoxic activity in fecal filtrates from patients with Campylobacter jejuni or Campylobacter coli enteritis.

Authors:  T L Cover; G I Perez-Perez; M J Blaser
Journal:  FEMS Microbiol Lett       Date:  1990-08       Impact factor: 2.742

4.  Whole genome comparison of Campylobacter jejuni human isolates using a low-cost microarray reveals extensive genetic diversity.

Authors:  N Dorrell; J A Mangan; K G Laing; J Hinds; D Linton; H Al-Ghusein; B G Barrell; J Parkhill; N G Stoker; A V Karlyshev; P D Butcher; B W Wren
Journal:  Genome Res       Date:  2001-10       Impact factor: 9.043

5.  Aetiology of gastroenteritis at a major referral centre in Saudi Arabia.

Authors:  J Akhter; J M Burdette; S M Qadri; S H Myint
Journal:  J Int Med Res       Date:  1994 Jan-Feb       Impact factor: 1.671

6.  Prevalence and risk factors associated with campylobacter infections in broiler flocks in Shiraz, southern Iran.

Authors:  Maryam Ansari-Lari; Saeid Hosseinzadeh; S Shahram Shekarforoush; Mostafa Abdollahi; Enayat Berizi
Journal:  Int J Food Microbiol       Date:  2010-11-13       Impact factor: 5.277

7.  Prevalence of potential virulence markers in Polish Campylobacter jejuni and Campylobacter coli isolates obtained from hospitalized children and from chicken carcasses.

Authors:  Elzbieta Rozynek; Katarzyna Dzierzanowska-Fangrat; Paulina Jozwiak; Janusz Popowski; Dorota Korsak; Danuta Dzierzanowska
Journal:  J Med Microbiol       Date:  2005-07       Impact factor: 2.472

8.  Physiological characterization of Campylobacter jejuni under cold stresses conditions: its potential for public threat.

Authors:  Warangkhana Chaisowwong; Akiko Kusumoto; Miho Hashimoto; Toshihiko Harada; Khuanwalai Maklon; Keiko Kawamoto
Journal:  J Vet Med Sci       Date:  2011-09-02       Impact factor: 1.267

9.  Invasive capabilities of Campylobacter jejuni strains isolated in Bahrain: molecular and phenotypic characterization.

Authors:  Sana A Al-Shaikh; Abiola C Senok; Abdulrahman Y Ismaeel; G A Botta
Journal:  Acta Microbiol Immunol Hung       Date:  2007-06       Impact factor: 2.048

Review 10.  Host-pathogen interactions in Campylobacter infections: the host perspective.

Authors:  Riny Janssen; Karen A Krogfelt; Shaun A Cawthraw; Wilfrid van Pelt; Jaap A Wagenaar; Robert J Owen
Journal:  Clin Microbiol Rev       Date:  2008-07       Impact factor: 26.132

View more
  9 in total

1.  Diversity of bacterial pathogens and their antimicrobial resistance profile among commensal rodents in Qatar.

Authors:  Md Mazharul Islam; Elmoubashar Farag; Mohammad Mahmudul Hassan; Khalid A Enan; K V Mohammad Sabeel; Maryam Mohammed Alhaddad; Maria K Smatti; Abdulla Mohammad Al-Marri; Abdul Azia Al-Zeyara; Hamad Al-Romaihi; Hadi M Yassine; Ali A Sultan; Devendra Bansal; Zilungile Mkhize-Kwitshana
Journal:  Vet Res Commun       Date:  2022-01-27       Impact factor: 2.459

2.  Prevalence, molecular detection, and virulence gene profiles of Campylobacter species in humans and foods of animal origin.

Authors:  Ashraf M A Barakat; Khaled A Abd El-Razik; Hassan A Elfadaly; Nagwa S Rabie; Sabry A S Sadek; Abdulaziz M Almuzaini
Journal:  Vet World       Date:  2020-07-24

3.  Genetic diversity, antimicrobial resistance, and virulence genes of thermophilic Campylobacter isolated from broiler production chain.

Authors:  Tassiana Ramires; Mauricéia Greici de Oliveira; Natalie Rauber Kleinubing; Simone de Fátima Rauber Würfel; Marcia Magalhães Mata; Mariana Almeida Iglesias; Graciela Volz Lopes; Odir Antônio Dellagostin; Wladimir Padilha da Silva
Journal:  Braz J Microbiol       Date:  2020-06-09       Impact factor: 2.476

4.  Molecular characterization of Campylobacter causing human clinical infection using whole-genome sequencing: Virulence, antimicrobial resistance and phylogeny in Ireland.

Authors:  Natalia Redondo; Anne Carroll; Eleanor McNamara
Journal:  PLoS One       Date:  2019-07-10       Impact factor: 3.240

5.  Campylobacteriosis Agents in Meat Carcasses Collected from Two District Municipalities in the Eastern Cape Province, South Africa.

Authors:  Aboi Igwaran; Anthony I Okoh
Journal:  Foods       Date:  2020-02-16

6.  Genetic Diversity of Campylobacter jejuni Isolated From Avian and Human Sources in Egypt.

Authors:  Marwa I Abd El-Hamid; Norhan K Abd El-Aziz; Mohamed Samir; El-Sayed Y El-Naenaeey; Etab M Abo Remela; Rasha A Mosbah; Mahmoud M Bendary
Journal:  Front Microbiol       Date:  2019-10-18       Impact factor: 5.640

7.  Socio-demographic influences on the prevalence of intestinal parasitic infections among workers in Qatar.

Authors:  Nadin Younes; Jerzy M Behnke; Ahmed Ismail; Marawan A Abu-Madi
Journal:  Parasit Vectors       Date:  2021-01-20       Impact factor: 3.876

8.  Seasonal Prevalence and Molecular Identification of Thermophilic Campylobacter from Chicken, Cattle, and Respective Drinking Water in Kajiado County, Kenya.

Authors:  Daniel W Wanja; Paul G Mbuthia; Gabriel O Aboge; Lilly C Bebora
Journal:  Int J Microbiol       Date:  2022-09-27

9.  Rodent-Related Zoonotic Pathogens at the Human-Animal-Environment Interface in Qatar: A Systematic Review and Meta-Analysis.

Authors:  Md Mazharul Islam; Elmoubashar Farag; Ahmad Mahmoudi; Mohammad Mahmudul Hassan; Ehsan Mostafavi; Khalid A Enan; Hamad Al-Romaihi; Muzzamil Atta; Abdel Rahim M El Hussein; Zilungile Mkhize-Kwitshana
Journal:  Int J Environ Res Public Health       Date:  2021-05-31       Impact factor: 3.390

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.