Literature DB >> 32730309

Sensing and signaling of immunogenic extracellular RNAs restrain group 2 innate lymphoid cell-driven acute lung inflammation and airway hyperresponsiveness.

Li She1,2, Hamad H Alanazi1, Liping Yan1, Edward G Brooks3, Peter H Dube1, Yan Xiang1, Fushun Zhang1, Yilun Sun1, Yong Liu2, Xin Zhang2, Xiao-Dong Li1.   

Abstract

Repeated exposures to environmental allergens in susceptible individuals drive the development of type 2 inflammatory conditions such as asthma, which have been traditionally considered to be mainly mediated by Th2 cells. However, emerging evidence suggest that a new innate cell type, group 2 innate lymphoid cells (ILC2), plays a central role in initiating and amplifying a type 2 response, even in the absence of adaptive immunity. At present, the regulatory mechanisms for controlling ILC2 activation remain poorly understood. Here we report that respiratory delivery of immunogenic extracellular RNA (exRNAs) derived from RNA- and DNA-virus infected cells, was able to activate a protective response against acute type 2 lung immunopathology and airway hyperresponsiveness (AHR) induced by IL-33 and a fungal allergen, A. flavus, in mice. Mechanistically, we found that the innate immune responses triggered by exRNAs had a potent suppressive effect in vivo on the proliferation and function of ILC2 without the involvement of adaptive immunity. We further provided the loss-of-function genetic evidence that the TLR3- and MAVS-mediated signaling axis is essential for the inhibitory effects of exRNAs in mouse lungs. Thus, our results indicate that the host detection of extracellular immunostimulatory RNAs generated during respiratory viral infections have an important function in the regulation of ILC2-driven acute lung inflammation.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32730309      PMCID: PMC7392318          DOI: 10.1371/journal.pone.0236744

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Asthma places a huge socioeconomic burden on our society and the number of people with asthma has continued to rise globally in recent decades [1-3]. Despite enormous research efforts, the etiology and molecular mechanism of asthma pathogenesis are still poorly understood. Environmental allergen exposure triggers aberrant type 2 immune responses in susceptible individuals, but not in healthy individuals. The underlying mechanisms remain largely undefined, but emerging evidence in recent years supports the ‘hygiene hypothesis’ orginally propoposed by Strachan [4]. Environmental endotoxin has been recently shown to protect against the development of allergy [5, 6], suggesting that humans have evolved protective innate immune pathways to maintain tissue homeostasis by counteracting the development of a polarized type 2 responses through sensing the environment. Allergen recognition through pattern recognition receptors (PRRs) is thought to be the critical step that determines either mucosal homeostasis or the development of inappropriate type 2 inflammation [5, 7–10]. In reality, humans are naturally exposed to environmental allergens that are often in complex forms containing both allergic proteins that are responsible for inducing type 2 inflammatory responses, and microbial substances such as nucleic acids (RNA/DNA), which may act as an immune adjuvant by triggering nucleic acid immunity [11-13]. In the past few years, it has become increasingly appreciated that group 2 innate lymphoid cells (ILC2) play a central role in the initiation and orchestration of type 2 inflammatory diseases such as asthma [14]. ILC2, lacking rearranged antigen receptors, is the innate counterpart of the T helper 2 lymphocyte (Th2) [14-17]. In response to environmental signals, or inducer cytokines such as Interleukin-33 (IL-33), ILC2 can rapidly produce massive amounts of the type 2 cytokines IL-5 and IL-13 [18-21], which facilitate the development of type 2 inflammatory responses characterized by eosinophilia, airway remodeling, mucus hypersecretion, and airway hyperresponsiveness (AHR) [18-21]. The function of ILC2s must be tightly regulated in order to prevent the onset of overzealous type 2 inflammation. In this regard, several elegant studies have recently shown that interferon responses activated by viruses or microbial ligands can inhibit the ILC2-mediated type 2 inflammation [22-25]. Notably, asthmatic patients are often found to have an impaired ability to produce interferons in respopnse to common respiratory viral infections [26-28]. Genetic evidence also highlights the involvement of the interferon pathway in restraining type 2 immunopathology, e.g. single-nucleotide polymorphisms in introns or exons of IFNγ, IFNγR, STAT1 and IRF1 are associated with asthma [29-31]. Thus, it appears that interferon responses might play a negative role in regulating type 2 inflammation via acting on ILC2 cells. Although the innate RNA-sensing pathways are known to activate innate immune responses that result in the production of large amounts of proinflammatory mediators such as IL1β, TNFα and type I intererons, their roles in the regulation of ILC2-driven acute type 2 lung inflammation remain largely unexplored. Here, we report that immune detection of immuostimulatory RNA intermediates (exRNAs) generated from cells infected by common respiratory RNA- or DNA-viruses can activate protective immune responses against IL-33- and a fungal allergen-induced lung inflammation and subsequent airway hyperresponsiveness (AHR). Mechanistically, exRNAs can activate the TLR3-Trif- and MAVS-mediated signaling pathways to suppress the proliferation and function of ILC2.

Materials and methods

Mice

TLR3-/- [32], Trif Lps2 [33], MAVS-/- [34, 35] mice have been described previously. Wild type C57BL/6J, IFNAR1-/- and Rag1-/- mice were purchased from the Jackson Laboratory. The double knockouts TLR3−/−MAVS−/− mice were generated by intercrossing on campus. Briefly, mice were bred and maintained under specific pathogen-free conditions in the animal facility. Mice were housed in the standard conditions and provided with low fat diet, water and a 12-hour shift light/dark cycle. To minimize animal suffering and distress, mice were anesthetized by isoflurane inhalation during intratracheal injections. The mice were monitored daily during intranasal injections and one day after the last injections and their health status was assessed by their behavior, appearance, hydration status, respiration, and presence/absence of any obvious pain. Their health and well-being were monitored daily by facility staff based on their appearance and behavior. At the time of harvest, mice were euthanized by carbon dioxide. All animal works were performed under the strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and the experimental protocols were approved by the Institutional Animal Care and Use Committee of the University of Texas Health San Antonio.

Cells, viruses and reagents

Human cell line HeLa were cultured in D-MEM supplemented with 10% FCS plus antibiotics. BEAS-2B cell (ATCC® CRL-9609™) was cultured in RPMI-1640 medium supplemented with 10% FBS plus antibiotics. All cultured cells were routinely monitored for the mycoplasma contamination. Poly(I:C) LMW (Cat. tlrl-picw) was purchased from InvivoGen. Recombinant murine IL-33 (Cat. 210–33) was purchased from Peprotech. Human rhinovirus 1B (VR-1645) and human adenovirus 5 (VR-5) were obtained from ATCC. Vaccinia virus (VACV, WR strain) and VSV (Indiana strain) have been described previously [34, 35].

Isolation of total RNAs from virus-infected HeLa cells

HeLa cells were infected with various viruses at 1.0 MOI at 80–90% confluence. Depending on the individual virus, it usually took 1–3 days when about half of infected cells were dead. At the time, the total RNA was purified from the attached cells by adding proper amount of TRIzol (Invitrogen).

Detection of dsRNA with dot blot

Spotted RNAs of HeLa cells infected by various viruses as indicated were crosslinked to Amersham Hybond-N+ membrane (GE Health) in a Stratalinker 2400 UV Crosslinker. The membrane was washed with washing buffer (TBST) and blocked in blocking buffer (5% nonfat milk in TBST) with gentle shaking. Incubate the membrane with J2 anti-dsRNA monoclonal antibody (SCICONS) overnight at 4°C with gentle shaking. For detection, AP-conjugated anti-mouse was added at a dilution of 1:5,000.

Transfection, allergen and nucleic acid treatment

Transfection of RNA (1.0 μg/ml) as indicated into cultured BEAS-2B cell was carried out using Lipofectamine 3000 (Invitrogen). For enzyme treatments of nucleic acids, allergen extracts or RNA was treated with various nucleases (Invirtogen) as indicated at 37°C for 0.5h.

Real-time quantitative PCR

Reverse transcription and real-time PCR (qPCR) reactions were carried out using iScript cDNA synthesis kit and iQ SYBR Green Supermix (Bio-Rad). qPCR was performed on a Bio-Rad CFX384 Touch™ Real-Time PCR Detection System using the following primers: Mouse primers (Forward:5’→3’, Reverse: 5’→3’): Rpl19 (AAATCGCCAATGCCAACTC, TCTTCCCTATGCCCATATGC); IL1β (TCTATACCTGTCCTGTGTAATG, GCTTGTGCTCTGCTTGTG); IFIT3 (TGGCCTACATAAAGCACCTAGATGG, CGCAAACTTTTGGCAAACTTGTCT); ISG15 (GAGCTAGAGCCTGCAGCAAT, TTCTGGGCAATCTGCTTCTT); Mx1 (TCTGAGGAGAGCCAGACGAT, ACTCTGGTCCCCAATGACAG); OASL2 (GGATGCCTGGGAGAGAATCG, TCG CCTGCTCTTCGAAACTG); TNFα (CCTCCCTCTCATCAGTTCTATGG, GGCTACAGGCTTGTCACTCG); ZBP1 (GCTATGACGGACAGACGTGG, TGTTGACCG GATTGTGCTGA);. Human Primers: GAPDH (ATGACATCAAGAAGGTGGTG, CATACCAGGAAATGAGCTTG); IFNβ (AGGACAGGATGAACTTTGAC, TGATAGACATTAGCCAGGAG); IFNλ1 (CGCCTTGGAAGAGTCACTCA, GAAGCCTCAGGTCCCAATTC).

In vivo administration and FACS analysis of BALF and lung

Mice were anesthetized by isofluorane inhalation, followed by the intra-tracheal administration with either Poly(I:C) 5 μg) or exRNAs (5 μg), rIL-33 (0.25 μg), or A. flavus protease allergen (10 μg) in 80 μl of PBS. Mice were sacrificed at indicated times and the trachea was catheterized and flushed with 1 ml of ice-cold PBS-EDTA three times. Differential cells in BALF were labeled with antibodies as indicated, then mixed with counting beads (Spherotech) for further FACS analysis on a BD Celesta cell analyzer. Flow cytometry data were analyzed using FlowJo software. The antibodies and reagents for FACS analysis are: SPHERO™ AccuCount Fluorescent Particles (Spherotech, Cat. #ACFP-70-5); Anti-Mouse Siglec-F PE (clone E50-2440) (BD Bioscience, Cat. #552126); Anti-Mouse CD19 Alexa Fluor® 647 (clone 1D3) (BD Bioscience, Cat. #557684); Anti-Mouse CD3ε APC (clone 145-2C11) (BioLegend, Cat. #100322); Anti-Mouse MHC II APC-Cy7 (clone M5/114.15.2) (BioLegend, Cat. #10627); Anti-Mouse CD11c PE-Cy7 (clone N418) (TONBO bioscience, Cat. #60-0114-U100); Anti-Mouse CD11b V450 Rat (clone M1/70) (BD Bioscience, Cat. #560456); Anti-Mouse Ly-6G FITC (clone RB6-8C5) (Invitrogen, Cat. #11-5931-82); Anti-Mouse Fixable Viability Dye eFluor 506 (Invitrogen, Cat. #65-0866-14); Anti-Mouse CD45 APC-Cy7 (clone 30-F11) (BD Bioscience, Cat. #561037).

Identification of lung ILC2

Lung ILC2 identification was performed as described previously [36]. Lung tissues were digested in 8 ml RPMI-1640 containing Liberase (50 μg/ml) and DNase I (1 μg/ml) for about 40 min at 37°C. Cell suspensions were filtered through 70 μm cell strainers and washed once with RPMI-1640. For ILC2 identification, total lung cell suspensions were blocked with 2.4G2 antibodies and stained with lineage cocktail mAbs (CD3ε, CD4, CD8α, CD11c, FceRIα, NK1.1, CD19, TER119, CD5, F4/80, Gr-1, and Ly6G), PE-conjugated T1/ST2, PerCP-Cy5.5-conjugated CD25, V450-conjugated Sca-1, PE-Cy7-conjugated KLRG1, APC-Cy7-conjugated CD45 and eFluor 506 Fixable Viability Dye.

Intranuclear and intracellular staining

Intranuclear staining for Ki-67 and transcription factors was performed with the True-Nuclear™ Transcription Factor Buffer Set kit (BioLegend) according to the manufacturer’s protocol. For intracellular cytokine staining, single-cell suspensions from the lungs of mice were prepared with LiberaseTM and DNase I. 2 x 106 total live nucleated cells were stimulated in 200 μl RPMI-1640 media containing 10% FBS, Penicillin/Streptomycin (P+S), 2-mercaptoethanol (2-ME), brefeldin A (GolgiPlug, BD Biosciences) and PMA (phorbol 12-myeistate 13-acetate) (30 ng/ml) at 37°C for 3 hours. After surface staining, cells were fixed and permeabilized with BioLegend Cytofix/Perm buffer and further stained intracellularly with anti-mouse IL-5 and IL-13. Dead cells were stained with eFluor506 Fixable Viability Dye before fixation and permeabilization and excluded during analysis.

Lung inflammation and pathology

Each mouse was intra-tracheally administered IL-33 or A. flavus on Day 0, 1 and 2 with or without Poly(I:C) or exRNAs on Day -1, 1 and 2 as shown in the relevant experimental diagram. There was an 8 hours interval between two treatments within the same day. Two days after the last challenge (Day 5), lung tissues were taken and fixed in 4% paraformaldehyde, paraffin embedded, cut into 4-μm sections, and stained with hematoxylin and eosin (H&E) and periodic acid-Schiff (PAS). Complete images of control and treated lungs were obtained digitally using the Aperio Scanscope XT (Aperio, Vista, CA). Printed images of lungs from both study groups were graded for disease severity using a panel of standards as previously described [37].

Measurement of pulmonary function

In the IL-33- and A. flavus-induced lung inflammation model, changes in mouse pulmonary function after allergen exposure were determined by invasive measurements using the Flexivent system (Scireq, Montreal, PQ, Canada). On day 5, the trachea was intubated after anesthetization. The lungs were mechanically ventilated. Indicators of airway hyperreactivity (AHR), including airway resistance (R), elastance (E) and compliance (C), were measured after increasing doses (6.25–50 mg/ml) of aerosolized methacholine.

Statistical analysis

The statistical analysis was done using software GraphPad Prism 6. For comparison of two groups, unless otherwise indicated, P values were determined by Mann-Whitney test. For comparison of more than two groups, Two-Way ANOVA was performed. P value<0.05 was considered statistically significant. P values are indicated on plots and in figure legends. (P value ≥0.05 was not considered statistically significant [N.S.], * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001).

Raw data availability

All relevant data are included in the main figure and the associated Supporting Information files. All raw data files are available to readers upon request.

Results

Poly(I:C) inhibits acute type 2 lung inflammation in a dose-dependent manner

Although it has been previously demonstrated that the synthetic dsRNA analogue Poly(I:C) can exacerbate antigen-induced respiratory allergic responses [38-40], its effect in acute models of type 2 lung inflammation remains unknown. To address this issue, we used the recombinant murine protein IL-33 to elicit an acute lung inflammation [18, 41] (). To investigate whether the respiratory delivery of Poly(I:C) at various doses, alone or in combination with IL-33, could cause systemic immune toxicity, we measured the bodyweight of the treated animals (). No significant weight changes were observed in animals treated with PBS or Poly(I:C) at 0.5 or 5 μg/mouse alone or in combination with IL-33, which contrasted to the groups treated with Poly(I:C) at 50 μg/mouse. Next, to examine whether Poly(I:C) could induce an immune response in the lungs, mice were administered with increased doses of Poly(I:C) followed by examination of gene expressions by Real-Time quantitative PCR (RT-qPCR). The expression of multiple ISGs (Mx1, ISG15, OASL2, IFIT3 and ZBP1) were upregulated (). Functionally, Poly(I:C) treatment in a dose-dependent manner led to the dramatic reduction of eosinophils and ILC2 cells in bronchoalveolar lavage fluid (BALF) and lungs ( the FACS gating strategy is shown in ). Since Poly(I:C) at 5 μg/mouse did not cause either systemic toxicity or any apparent up-regulation of two proinflammatory genes IL1β and TNFα, we chose this dose for the subsequent in vivo experiments in combination with IL-33. Taken together, these results suggest that poly(I:C) treatment at a relatively low dose (5 μg/mouse) triggers a protective immune response in mouse lungs that is sufficient to prevent the development of IL-33-driven lung eosinophilia.

Poly(I:C) activates innate immune responses in a dose-dependent manner and inhibits IL-33 induced eosinophilia and ILC2 proliferation.

A. Experimental setup of an acute lung inflammation model that illustrates the animal groups, the corresponding treatment regimen and timeline (upper panel) and weigh changes following treatment as indicated. Error bars represent SEMs. Statistics of the weight changes was determined using the Two-Way ANOVA. The dot lines (animal groups treated with either PBS or increased amount of Poly(I:C) without IL-33, ### p < 0.001, #### p < 0.0001); the sold lines (animal groups treated with PBS or increased amount of Poly(I:C) with IL-33, ** p < 0.01, ****p < 0.0001). B. Transcriptional induction of gene expressions by Poly(I:C) in mouse lungs. C. Groups of mice as indicated were treated with PBS, IL-33 in presence of increased doses of Poly(I:C) as indicated. Bronchoalveolar lavage fluid (BALF) was collected and analyzed for differential immune cell types. The result is a pool of two independent experiments. (n = 3–5 per group as indicated with open circles). D. Administration of Poly(I:C) in a dose-dependent manner reduced the percentage and number of lung-eosinophils after exposure to IL-33. (n = 3–5 per group as indicated with open circles). E. Poly(I:C) treatment decreased the number of lung-ILC2 cells after exposure to IL-33 in a dose-dependent manner. (n = 3–5 per group as indicated with open circles). Unless otherwise indicated, P value was determined using Mann-Whitney test, P value ≥0.05 was not considered statistically significant [N.S.]). * p < 0.05, ** p < 0.01.

Poly(I:C) at a low dose ameliorates both IL-33- and A. flavus-induced induced AHR and lung immunopathology

After determining the optimal effective dose of Poly(I:C), we went on to perform more detailed analysis using two models of acute type 2 lung inflammation. In addition to IL-33, we also included a clinically relevant model of allergic inflammation caused by a fungal allergen, A. flavus, that has been shown to act through the IL-33-mediated pathway [42]. After mice were challenged with either IL-33 or the extract of A. flavus, we found that Poly(I:C) treatment at 5 μg/mouse dramatically improved the lung function evidenced by the reduced AHR, elastance, and improved compliance (Figs ). Consistently, Poly(I:C) treatment ameliorated IL-33- and A. flavus-induced lung pathologies characterized by infiltration of inflammatory cells, mucus overproduction and epithelial cell hyperplasia (Figs ). We also found that markers of IL-33 or A. flavus–driven type 2 inflammation were greatly reduced, as evidenced by the significant decrease in eosinophils in the BALF and lungs of Poly(I:C)-treated mice (Figs ). Thus, these data indicate that Poly(I:C) treatment can activate a protective response to attenuate acute type 2 lung inflammation induced by both the type 2 inducer cytokine IL-33 and a clinically relevant fungal allergen A. flavus.

Poly(I:C) at a low dose inhibits IL-33-induced AHR and acute eosinophilia.

A. Groups of mice as indicated were treated with PBS, IL-33 with or without Poly(I:C) (5 μg/mouse) as indicated. Lung function was examined by Flexivent (Scireq). Airway resistance (R), elastance (E) and compliance (C) were measured after exposure to increasing doses (6.25–50 mg/mL) of aerosolized methacholine. (n = 3–5, P value <0.05 was considered statistically significant, 2way ANOVA, Tukey’s multiple comparisons test, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001). B. Lung pathology was assessed with H&E and PAS staining. Representative images are shown here (scale bars, 100 μm). C. Bronchoalveolar lavage fluid (BALF) was collected and analyzed for differential immune cell types. The result is a pool of two independent experiments. (n = 3–5 per group as indicated with open circles). D. Administration of Poly(I:C) decreased the percentage and number of eosinophils in lungs after exposure to IL-33. (n = 3–5 per group as indicated with open circles).

Poly(I:C) at a low dose inhibits A. flavus induced AHR and acute eosinophilia.

A. Groups of mice as indicated were treated with PBS, Poly(I:C), A. flavus or A. flavus+Poly(I:C). Airway hyperreactivity (AHR) was examined by Flexivent (Scireq). Airway resistance (R), elastance (E) and compliance (C) were measured after exposure to increasing doses (6.25–50 mg/mL) of aerosolized methacholine. (n = 2–5 per group as indicated with open circles, P value <0.05 was considered statistically significant, 2way ANOVA, Tukey's multiple comparisons test, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001). B. Lung pathology was assessed with H&E and PAS staining. Representative images are shown here (scale bars, 100 μm). C. BALF was collected and analyzed for differential immune cell types. The result is a pool of two independent experiments. (n = 2–5 per group as indicated with open circles). D. Administration of Poly(I:C) decreased the percentage and number of eosinophils in lungs after exposure to A. flavus. (n = 2–5 per group as indicated with open circles).

Poly(I:C) at a low dose inhibits the activation and proliferation of lung ILC2

Next, we determined whether Poly(I:C) could affect the function and proliferation of lung ILC2 cells in vivo when exposed to IL-33 or A. flavus. To rule out the involvement of adaptive immunity, in addition to wild type (WT) C57BL/6J mice, Rag1-/- mice were tested with IL-33+Poly(I:C) (). The gating strategy for calculating the number of lung-ILC2s is shown in . ILC2 expansion was significantly suppressed, as determined by the reduction in the percentage and number of total lung-ILC2 in both strains of mice. Functionally, the percentage of IL-33 activated ILC2s (IL-5+/IL-13+ double-positive) was significantly decreased upon treatment of Poly(I:C) () in both WT and Rag1-/- mice. Consistent with previous experiments, eosinophils in the BALF and lungs were significantly reduced in Poly(I:C)-treated wild type and Rag1-/- mice () compared to their counterparts when exposed to IL-33. Further, Poly(I:C)-mediated inhibitory effects on ILC2 proliferation in wild type mice was confirmed by Ki-67 staining (). We continued to examine whether Poly(I:C) treatment regulates ILC2 function in the context of A. flavus exposure. FACS analysis revealed that while A. flavus significantly increased the percentages of IL5+/IL13+ double-positive cells and the total numbers of lung ILC2 cells, co-administration of Poly(I:C) abolished this induction (). Taken together, these results strongly suggest that Poly(I:C) activates an innate immune signaling pathway to negatively regulate ILC2-induced eosinophilic lung inflammation and that this suppression was independent of adaptive immunity in mice.

Poly(I:C) inhibits the activation and proliferation of ILC2 cells induced by IL-33 or A. flavus in WT and Rag1-/- mice.

A. Experimental protocol showing the animal groups (WT and Rag1-/-), the corresponding treatment regimen and timeline. B. C57B6/J WT mice were treated with PBS, Poly(I:C), IL-33 or IL-33+Poly(I:C). Lung single cell suspensions were prepared and the percentage and number of ILC2 cells in lungs were analyzed. In addition, lung cells were stimulated with PMA in cultures as described in the Materials and Methods. The percentage of IL5+/IL13+-double positive ILC2 cells in lungs were analyzed. (n = 3–5 per group as indicated with open circles). C. Similar to B, instead of IL-33, A. flavus was used. (n = 2–5). D. Similar to B, instead of WT mice, the Rag1-/- mice were used. (n = 2–5 per group as indicated with open circles). E. C57B6/J WT mice were treated with PBS, Poly(I:C), IL-33 or IL-33+Poly(I:C). The lung ILC2 cells were analyzed with Ki-67 staining and isotype antibody. The result is a representative of three independent experiments.

The TLR3-Trif-IFNAR1 signaling axis mediates the inhibitory effects of Poly(I:C) on IL-33-induced acute lung inflammation

Activation of RNA-sensing pathways usually results in the production of multiple effector molecules such as type I interferons (IFN-I) and other proinflammatory cytokines such as TNFα and IL1β, which may function together to modulate ILC2-driven type 2 inflammatory response. To determine the role of the TLR3-Trif-IFNAR1 signaling axis, we performed a series of experiments using mice genetically deficient in TLR3, Trif or IFNAR1. Remarkably, we found that in the context of IL-33-induced acute lung inflammation, the inhibitory effects of Poly(I:C) were completely abolished in these three knockout strains. More importantly, in contrast to wild type mice shown in , TLR3-/- (), Trif Lps2 () and IFNAR1-/- mice () treated with either IL-33 or IL-33+Poly(I:C) did not show any significant changes in eosinophils (number and percentage) in BALF or lungs, and the activation of lung-ILC2 cells were unaffected either (Figs ). Collectively, these results suggest that TLR3-Trif-IFNAR1 signaling axis mediates the effector function of Poly(I:C) to negatively regulate IL-33-induced type 2 lung inflammation via suppressing the activation of lung ILC2 cells.

The inhibitory effect of Poly(I:C) is mediated by the TLR3-mediated pathway.

A. Groups of TLR3-/- mice as indicated were treated with PBS, Poly(I:C), IL-33 or IL-33+Poly(I:C). BALF was collected and analyzed for differential immune cell types. (n = 2–5 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). B. Administration of Poly(I:C) into TLR3-/- mice did not significantly decrease the percentage and number of eosinophils in lungs after exposure to IL-33. (n = 2–5 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). C. The percentage and number of ILC2 cells and percentage of IL5+/IL13+-double positive ILC2 cells in lungs of TLR3-/- mice were analyzed.

The inhibitory effect of Poly(I:C) is mediated by the Trif-mediated pathway.

A. Groups of Trif Lps2 mice as indicated were treated with PBS, Poly(I:C), IL-33 or IL-33+Poly(I:C). BALF was collected and analyzed for differential immune cell types. (n = 2–4 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). B. Administration of Poly(I:C) into Trif Lps2 mice did not significantly decrease the percentage and number of eosinophils in lungs after exposure to IL-33. (n = 2–4 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). C. The number and percentage of IL5+/IL13+-double positive ILC2 cells in lungs of Trif Lps2 mice were analyzed.

The inhibitory effect of Poly(I:C) is mediated by the IFN-I signaling pathway.

A. Groups of IFNAR1-/- mice as indicated were treated with PBS, Poly(I:C), IL-33 or IL-33+Poly(I:C). BALF was collected and analyzed for differential immune cell types. (n = 5 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). B. Administration of Poly(I:C) into IFNAR1-/- mice did not significantly decrease the percentage and number of eosinophils in lungs after exposure to IL-33. (n = 5 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). C. The percentage and number of ILC2 cells and percentage of IL5+/IL13+-double positive ILC2 cells in lungs of IFNAR1-/- mice were analyzed.

Extrinsic sensing of natural RNAs of virus-infected cells prevents A. flavus-induced type 2 lung immunopathology

Poly(I:C) is widely used to imitate viral infections. However, Poly(I:C) is a chemically synthesized RNA analog, not a natural RNA. Although we showed above that Poly(I:C) effectively prevented ILC2-mediated immunopathology induced by IL-33 and A. flavus, it remains unclear whether natural RNAs from virus-infected cells could function similarly to Poly(I:C) in vivo to inhibit the outcome of allergen-induced acute type 2 inflammation. To address this issue, we isolated total RNAs from either RNA- or DNA-virus infected cells and tested their immunostimulatory activities in vitro and in vivo. We found that long dsRNA species (> 40bp) were detected in total RNAs isolated from both RNA- and DNA-virus infected cells including human rhinovirus (RV1B), vesicular stomatitis virus (VSV), human adenovirus (AdV5) and vaccinia virus (VACV) using a Dot-blot with dsRNA-specific J2 monoclonal antibody, which is consistent with previous reports [43-46] (). Functionally, these natural vRNAs were able to induce the expression of type I & III interferons in a lung epithelial cell BEAS-2B (). When delivered into mouse lungs, both RV1B- and AdV5-RNAs potently stimulated the expression of ISGs in a dose-dependent manner (). More importantly, at the same dose of Poly(I:C), the treatment with either RV1B RNA or AdV5 RNA was sufficient for reducing the infiltration of airway and lung eosinophils and suppressing the activation of lung ILC2 cells in wild type mice while the inhibitory effects of RV1B RNA were completely abolished in TLR3-/-MAVS-/- mice (Figs ), but not in TLR3-/- mice (), indicating that compared to Poly(I:C) that solely depended on the TLR3-Trif signaling axis in mouse lungs as shown in Figs RV1B RNA seemed to activate both TLR3- and MDA5-MAVS-mediated signaling pathways, similar to RV1B infection [47]. Collectively, these results suggest that viral RNAs derived from cells infected by RNA- and DNA viruses seem to function similarly to Poly(I:C), by activating innate immune responses to negatively regulate type 2 lung inflammation via suppressing the activation of lung ILC2 cells. Based on these findings, we propose a working model for extracellular RNAs released from cells infected by respiratory RNA- or DNA-viruses, which may stimulate lung innate immunity to modulate ILC2-mediated type 2 inflammation as depicted in . Mechanistically, exRNAs activate the TLR3-Trif signaling axis to induce the local production of type I interferons, which may act on the IFNAR1 of lung ILC2 cells to restrain their abilities to proliferate and produce type 2 cytokines in the context of exposure to IL-33 and environmental allergens such as A. flavus.

exRNAs from RV1B-infected cells activates innate RNA-sensing pathways to prevent A. flavus-induced lung inflammation.

A. Groups of WT and TLR3-/-MAVS-/- mice as indicated were treated with A. flavus or A. flavus+RV1B RNA. BALF was collected and analyzed for differential immune cell types. (n = 3–10 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). B. In contrast to WT mice, administration of RV1B RNA into TLR3-/-MAVS-/- mice did not significantly decrease the percentage and number of eosinophils in lungs after exposure to A. flavus. (n = 3–10 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). C. The percentage and number of ILC2 cells and percentage of IL5+/IL13+-double positive ILC2 cells in lungs of WT and TLR3-/-MAVS-/- mice were analyzed (P value ≥0.05 was not considered statistically significant [N.S.]).

exRNAs from AdV5-infected cells activates innate RNA-sensing pathways to prevent A. flavus-induced lung inflammation.

A. Groups of WT mice as indicated were treated with A. flavus or A. flavus+AdV5 RNA. BALF was collected and analyzed for differential immune cell types. (n = 4–6 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). B. Administration of AdV5 RNA into WT mice significantly reduced the percentage and number of eosinophils in lungs after exposure to A. flavus. (n = 4–6 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). C. The number and percentage of IL5+/IL13+-double positive ILC2 cells in lungs of WT mice were analyzed (n = 4–6 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]).

Discussion

In this study, we revealed a new role for exRNA-activated innate immune responses in negatively regulating ILC2-mediated acute type 2 lung immunopathology and AHR. Mechanistically, we showed that the protective effects of exRNAs were mediated by the TLR3- and MAVS-mediated signaling axis and were independent of adaptive immunity. In susceptible individuals, the exposure to common harmless allergens elicits aberrant type 2 responses that promote the development of allergic diseases. In contrast, these exposures usually do not lead to pathological responses in most non-atopic healthy individuals, suggesting the possible existence of anti-allergic pathways that are still poorly understood. It has been recently reported that some environmental exposures to endotoxin, can protect us against the development of allergy [5, 6], indicating that humans have evolved protective pathways to respond to environmental stimuli. Our data imply that in normal individuals, innate RNA-sensing pathways might be a homeostatic mechanism to modulate mucosal immunity against developing unrestrained type 2 inflammatory responses during environmental allergen exposures. Our traditional perception is that respiratory viral infections result in pathological responses. Emerging evidence from animal models have suggested otherwise that some viral infections, e.g. gammaherpesvirus or influenza virus could activate innate immune responses that are protective against allergen-induced type 2 immunopathology [25, 48]. Additionally, a beneficial role of enteric viruses has also been recently reported by several studies that innate RNA sensing immunity seems to play an important function in sustaining intestinal homeostasis via educating intestinal intraepithelial lymphocytes (IELs) [49-51]. Although the exact underlying molecular mechanism remains to be uncovered, it is plausible that the protective immunity could be mediated, at least in part, by exRNAs, which has been shown to be produced in cells infected by both DNA and RNA viruses [43-46]. A few recent studies have shown that type I interferons directly inhibit the function and proliferation of ILC2 in vitro and in vivo during influenza A infection or treatment with TLRs agonists such as CpG-DNA and R848 [22, 23, 25, 52–54]. Notably, unlike RV1B and AdV5 [43-46], influenza A virus did not produce detectable amounts of dsRNA in cells [43]. Thus, influenza A virus is mainly recognized by RIG-I or TLR7, but not by the long dsRNA sensors TLR3 or MDA5, to activate innate immune responses [43, 55]. Extracellular dsRNAs could be generated during common respiratory infections by both RNA and DNA viruses such as human rhinovirus and adenovirus, which usually cause mild self-limiting respiratory infections in most individuals [56, 57]. As shown in , extracellular viral dsRNAs are sufficient to trigger the type I interferon signaling in mouse lungs, which can robustly counteract the rapid activation of ILC2 cells upon exposure to IL-33 or a fungal allergen. Our current data on the protective function of exRNA derived from RV1B and AdV5 infected cell seem to be contradictory to the clinical experience where respiratory viral infections frequently cause exacerbations in asthmatic patients, who often have defective interferon responses [26-28]. However, until now, the exact molecular mechanism for virus-induced asthma exacerbations remain unexplained mechanistically. Therefore, more works are needed to in order to fully address underlying molecular mechanisms of the effector function of exRNAs-induced innate immune signaling on ILC2-mediated type 2 inflammation. Here, we report that immune sensing and signaling of exRNA seem to play a regulatory role in controlling the development of type 2 lung immunopathology induced by IL-33 or a fungal allergen. Specifically, the protective effects of exRNA were mediated by local interferon responses that suppressed the function and proliferation of ILC2 cells. Our results may provide novel insights into the mechanisms underlying susceptibility to a wide range of allergic disorders, including asthma, rhinosinusitis and food allergy.

FACS gating strategy for the identification of specific cell types including eosinophils.

Cells recovered from BALF were stained for cell surface markers as indicated. The absolute numbers were calculated based on reference beads (top panel). Formula (Number of cells per mL): (Total Beads/# events of Beads) x (# event of Sample)/Volume of Tested Sample. (Related to Figs 1C, 2C, 3C, 5A, 6A, 7A, 8A, 9A and ).
Fig 1

Poly(I:C) activates innate immune responses in a dose-dependent manner and inhibits IL-33 induced eosinophilia and ILC2 proliferation.

A. Experimental setup of an acute lung inflammation model that illustrates the animal groups, the corresponding treatment regimen and timeline (upper panel) and weigh changes following treatment as indicated. Error bars represent SEMs. Statistics of the weight changes was determined using the Two-Way ANOVA. The dot lines (animal groups treated with either PBS or increased amount of Poly(I:C) without IL-33, ### p < 0.001, #### p < 0.0001); the sold lines (animal groups treated with PBS or increased amount of Poly(I:C) with IL-33, ** p < 0.01, ****p < 0.0001). B. Transcriptional induction of gene expressions by Poly(I:C) in mouse lungs. C. Groups of mice as indicated were treated with PBS, IL-33 in presence of increased doses of Poly(I:C) as indicated. Bronchoalveolar lavage fluid (BALF) was collected and analyzed for differential immune cell types. The result is a pool of two independent experiments. (n = 3–5 per group as indicated with open circles). D. Administration of Poly(I:C) in a dose-dependent manner reduced the percentage and number of lung-eosinophils after exposure to IL-33. (n = 3–5 per group as indicated with open circles). E. Poly(I:C) treatment decreased the number of lung-ILC2 cells after exposure to IL-33 in a dose-dependent manner. (n = 3–5 per group as indicated with open circles). Unless otherwise indicated, P value was determined using Mann-Whitney test, P value ≥0.05 was not considered statistically significant [N.S.]). * p < 0.05, ** p < 0.01.

Fig 2

Poly(I:C) at a low dose inhibits IL-33-induced AHR and acute eosinophilia.

A. Groups of mice as indicated were treated with PBS, IL-33 with or without Poly(I:C) (5 μg/mouse) as indicated. Lung function was examined by Flexivent (Scireq). Airway resistance (R), elastance (E) and compliance (C) were measured after exposure to increasing doses (6.25–50 mg/mL) of aerosolized methacholine. (n = 3–5, P value <0.05 was considered statistically significant, 2way ANOVA, Tukey’s multiple comparisons test, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001). B. Lung pathology was assessed with H&E and PAS staining. Representative images are shown here (scale bars, 100 μm). C. Bronchoalveolar lavage fluid (BALF) was collected and analyzed for differential immune cell types. The result is a pool of two independent experiments. (n = 3–5 per group as indicated with open circles). D. Administration of Poly(I:C) decreased the percentage and number of eosinophils in lungs after exposure to IL-33. (n = 3–5 per group as indicated with open circles).

Fig 3

Poly(I:C) at a low dose inhibits A. flavus induced AHR and acute eosinophilia.

A. Groups of mice as indicated were treated with PBS, Poly(I:C), A. flavus or A. flavus+Poly(I:C). Airway hyperreactivity (AHR) was examined by Flexivent (Scireq). Airway resistance (R), elastance (E) and compliance (C) were measured after exposure to increasing doses (6.25–50 mg/mL) of aerosolized methacholine. (n = 2–5 per group as indicated with open circles, P value <0.05 was considered statistically significant, 2way ANOVA, Tukey's multiple comparisons test, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001). B. Lung pathology was assessed with H&E and PAS staining. Representative images are shown here (scale bars, 100 μm). C. BALF was collected and analyzed for differential immune cell types. The result is a pool of two independent experiments. (n = 2–5 per group as indicated with open circles). D. Administration of Poly(I:C) decreased the percentage and number of eosinophils in lungs after exposure to A. flavus. (n = 2–5 per group as indicated with open circles).

Fig 5

The inhibitory effect of Poly(I:C) is mediated by the TLR3-mediated pathway.

A. Groups of TLR3-/- mice as indicated were treated with PBS, Poly(I:C), IL-33 or IL-33+Poly(I:C). BALF was collected and analyzed for differential immune cell types. (n = 2–5 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). B. Administration of Poly(I:C) into TLR3-/- mice did not significantly decrease the percentage and number of eosinophils in lungs after exposure to IL-33. (n = 2–5 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). C. The percentage and number of ILC2 cells and percentage of IL5+/IL13+-double positive ILC2 cells in lungs of TLR3-/- mice were analyzed.

Fig 6

The inhibitory effect of Poly(I:C) is mediated by the Trif-mediated pathway.

A. Groups of Trif Lps2 mice as indicated were treated with PBS, Poly(I:C), IL-33 or IL-33+Poly(I:C). BALF was collected and analyzed for differential immune cell types. (n = 2–4 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). B. Administration of Poly(I:C) into Trif Lps2 mice did not significantly decrease the percentage and number of eosinophils in lungs after exposure to IL-33. (n = 2–4 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). C. The number and percentage of IL5+/IL13+-double positive ILC2 cells in lungs of Trif Lps2 mice were analyzed.

Fig 7

The inhibitory effect of Poly(I:C) is mediated by the IFN-I signaling pathway.

A. Groups of IFNAR1-/- mice as indicated were treated with PBS, Poly(I:C), IL-33 or IL-33+Poly(I:C). BALF was collected and analyzed for differential immune cell types. (n = 5 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). B. Administration of Poly(I:C) into IFNAR1-/- mice did not significantly decrease the percentage and number of eosinophils in lungs after exposure to IL-33. (n = 5 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). C. The percentage and number of ILC2 cells and percentage of IL5+/IL13+-double positive ILC2 cells in lungs of IFNAR1-/- mice were analyzed.

Fig 8

exRNAs from RV1B-infected cells activates innate RNA-sensing pathways to prevent A. flavus-induced lung inflammation.

A. Groups of WT and TLR3-/-MAVS-/- mice as indicated were treated with A. flavus or A. flavus+RV1B RNA. BALF was collected and analyzed for differential immune cell types. (n = 3–10 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). B. In contrast to WT mice, administration of RV1B RNA into TLR3-/-MAVS-/- mice did not significantly decrease the percentage and number of eosinophils in lungs after exposure to A. flavus. (n = 3–10 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). C. The percentage and number of ILC2 cells and percentage of IL5+/IL13+-double positive ILC2 cells in lungs of WT and TLR3-/-MAVS-/- mice were analyzed (P value ≥0.05 was not considered statistically significant [N.S.]).

Fig 9

exRNAs from AdV5-infected cells activates innate RNA-sensing pathways to prevent A. flavus-induced lung inflammation.

A. Groups of WT mice as indicated were treated with A. flavus or A. flavus+AdV5 RNA. BALF was collected and analyzed for differential immune cell types. (n = 4–6 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). B. Administration of AdV5 RNA into WT mice significantly reduced the percentage and number of eosinophils in lungs after exposure to A. flavus. (n = 4–6 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]). C. The number and percentage of IL5+/IL13+-double positive ILC2 cells in lungs of WT mice were analyzed (n = 4–6 per group as indicated with open circles, P value ≥0.05 was not considered statistically significant [N.S.]).

(PPTX) Click here for additional data file.

FACS gating strategy for the identification of lung ILC2 cells.

Cells recovered from total lung homogenates were stained for cell surface markers as indicated. The absolute numbers were calculated based on reference beads (top panel). Formula (Number of cells per mL): (Total Beads/# events of Beads) x (# event of Sample)/Volume of Tested Sample. (Related to Figs 1E, B–D, 5C, 6C, 7C, 8C, 9C and ). (PPTX) Click here for additional data file.

Poly(I:C) inhibits IL-33-induced eosinophilia in Rag1-/- mice.

A. Four groups of Rag1-/- mice were treated with PBS, Poly(I:C), IL-33 or IL-33+Poly(I:C) as indicated. BALF was collected and analyzed for differential immune cell types. B. Administration of Poly(I:C) decreased the percentage and number of eosinophils in lungs after exposure to IL-33. (n = 2–5 per group as indicated with open circles, P value was determined using Mann-Whitney test, * p < 0.05, ** p < 0.01, *** p < 0.001). (PPTX) Click here for additional data file.

Cells infected with both RNA- and DNA viruses produce immunostimulatory dsRNA species.

. A. Detection of the double-stranded structure in total RNA isolated from virus-infected HeLa cells by a dsRNA-specific antibody J2 with Dot Blot. B. Induction of IFNs by RNAs produced by HeLa cells infected with both RNA- and DNA-viruses. BEAS-2B cells were transfected with total RNAs (1.0 μg /ml per 0.2x106 cells) of HeLa cells infected with viruses for 16–18 hours. Total RNAs were also treated with or without RNases III or T1 as indicated. C. Transcriptional induction of gene expressions by RV1B RNA in mouse lungs. Wild type mice were exposed via the intratracheal route to increased amounts of RV1B RNA as indicated. After 16-18h, total RNA isolated from mouse lungs was subjected to RT-qPCR analysis. (Related to Figs 8 & 9). N.D., not detected. (PPTX) Click here for additional data file.

Administration of RV1B RNA into TLR3-/- partially inhibited A. flavus-induced lung inflammation.

A. Groups of WT and TLR3-/- mice as indicated were treated with A. flavus or A. flavus+RV1B RNA. BALF was collected and analyzed for differential immune cell types. B. The percentage and number of eosinophils cells in lungs of WT and TLR3-/- mice were analyzed. C. The percentage and number of ILC2 cells and percentage of IL5+/IL13+-double positive ILC2 cells in lungs of WT and TLR3-/- mice were analyzed. (n = 5–6 per group as indicated with open circles, P value was determined using Mann-Whitney test, P value ≥0.05 was not considered statistically significant [N.S.]). * p < 0.05, ** p < 0.01). D. Cells were stained with the isotype antibodies corresponding to IL-5 and IL-13. (PPTX) Click here for additional data file.

Transfer Alert

This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present. 30 Apr 2020 PONE-D-20-07673 Sensing and Signaling of Immunogenic Extracellular RNAs Restrain Group 2 Innate Lymphoid Cell-Driven Acute Lung Inflammation and Airway Hyperresponsiveness PLOS ONE Dear Dr. Li, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Although the manuscript is very interesting, there are a number of points that the reviewers, who are experts in the field, have raised and which have to be addressed. First of all, you have to give more details on the methodology as well as on the experiments performed in the M&M section. Second, the statistical analysis has to be revised. Third, the comments of reviewer #2 regarding gating strategy and intracellular staining have to be addressed. Finally, the conclusions drawn have to clearly reflect what the experimental design allows to infer from the experiments: e.g. a poly(I:C) only control appears to be missing, poly(I:C) was given together with allergen and/or IL-33 and not alone, the use of TLR3 single knockouts is recommended. Please provide a detailed point-by-point response addressing all the points raised by the reviewers along with your revised manuscript. We would appreciate receiving your revised manuscript by Jun 14 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Heinz Fehrenbach Academic Editor PLOS ONE Journal Requirements: 1. When submitting your revision, we need you to address these additional requirements. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. At this time, we request that you please report additional details in your Methods section regarding animal care, as per our editorial guidelines: 1) Please provide details of animal welfare (e.g., shelter, food, water, environmental enrichment) 2) please describe any steps taken to minimize animal suffering and distress, such as by administering analgesics, 3) please include the method of sacrifice and 4) Please describe the post-operative care received by the animals, including the frequency of monitoring and the criteria used to assess animal health and well-being. Thank you for your attention to these requests. 3. Please provide additional information about each of the cell lines used in this work, including source, history, culture conditions and any quality control testing procedures (authentication, characterisation, and mycoplasma testing). For more information, please see http://journals.plos.org/plosone/s/submission-guidelines#loc-cell-lines. 4. Please provide the source, product number and any lot numbers of the reagents listed in the "Cells, viruses and reagents" section of the Materials and Methods. 5. At this time, we ask that you please provide scale bars on all IHC images. 6. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability. Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized. Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access. We will update your Data Availability statement to reflect the information you provide in your cover letter. 7. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: No ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: This study aimed to investigate the effect of extracellular RNA or DNA on the activation of innate lymphoid Type II cells. Therefore the authors used a mouse model for experimental asthma triggered with a fungal antigen. Applying the extracellular RNA suppressed the product the rotation of the ILC2 cells which was shown to be dependent on the TLR3-Trif-IFNAR1 axis. This is an interesting and elegantly performed study, however in my opinion there are several limitations which are further explained in the comments below, especially concerning the statistical analysis. Major points • The mouse model needs to be described in more detail in the methods part. How many challenges were performed, at which time points and was there also a control receiving poly IC only but no allergen/IL33. Please also provide a scheme in the figure for the fungal model. • The statistical analysis is performed only with a parametric t test. But actually due to the in vivo experiments a non-parametric tests might be more appropriate. Second since there are more groups and treatments being compared at the same time this analysis certainly requires a more advanced statistical tests. • For all figures containing histology pictures it would be good to supply an overview picture off the whole lung lobe to judge the overall inflammation. • In figure 1B the authors show a dose increase of poly IC, but with different doses than were used in a mouse model. However , they conclude from this figure that 5 microgram would be the ideal dose for further experiments. This is confusing. • The text mentions the DCS and T cells are strongly increased at 50 microgram of poly IC, but there seems to be a nonsignificant trend only. This would need to be adapted in the results. • It is interesting that poly IC reduces the ILC2 and th2 response in the lungs. Did the authors check for i.e. a th1 or an ILC 1 response as viral products might reduce the th2 phenotype by augmenting the th1 response? • One major limitation of this paper is that the IL 33 or allergen was given at the same time as the poly IC. In order to investigate if such a stimulus is protected or aggravates asthmatic inflammation one would need to first establish experimental asthma in the mouse and then do the challenge with poly IC. Minor points • In my opinion that different knockouts different models but with the same analysis could be shown in the supplement to reduce the amount of figures. Reviewer #2: The study looks at the effect of co-treatment with IL-33 and TLR3 agonists on lung inflammation, using a number of mouse knockouts to make a convincing case for an IFN pathway downstream of poly IC or dsRNA treatment. There are a couple of points which could be resolved in order to improve the manuscript. In places the description of the methods is not detailed enough. The time and number of doses is not always clear. The degree of IL-33 induced inflammation in the lung is very high for what appears to be 3 treatments with a fairly standard dose. How were ILC2 numbers calculated. The ILC2 plots in the figures do not appear to match the gating strategy described. For intracellular cytokine staining, the authors should provide isotype controls in cells from both unstimulated mice. This is critical give the staining increase in small, and it is possible that the ILC2 change in size or in terms of intrinsic fluorescence. In the final experiments, I'm not convinced about the use of TLR3/MAVS double knockouts. While MAVS will be important in viral infection, it is less clear if it would be involved in response to extracellular DNA, which is what the authors are examining. This should be repeated in TLR3 single knockouts. More details should be given regarding the animals (age / sex / diet / light cycle (including time of IL-33 treatment) /randomisation ect) ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step. 8 Jun 2020 please also see the attached rebuttal letter. PONE-D-20-07673 “Sensing and Signaling of Immunogenic Extracellular RNAs Restrain Group 2 Innate Lymphoid Cell-Driven Acute Lung Inflammation and Airway Hyperresponsiveness We thank the editor and both reviewers for the constructive comments. We have performed the requested experiments. The generated new data have been included in this revised manuscript. In addition, we have also added more details on the sections of Materials and Methods as suggested by the reviewers. The detailed changes in text have been highlighted in yellow. Our point-to-point responses are shown below. -------------------------------------------------------------------------------------------------------------------------------------- Editor’s comments: “you have to give more details on the methodology as well as on the experiments performed in the M&M section.” Re: yes, we have added more details on the relevant sections of Materials and Methods. The changes are highlighted in yellow. “the statistical analysis has to be revised.” Re: yes, we have revised the statistical analysis as recommended by Reviewer #1 and added more details to the corresponding figure legends and the relevant sections. “the comments of reviewer #2 regarding gating strategy and intracellular staining have to be addressed.” Re: yes, we have provided more details on the gating strategy and intracellular staining (see our responses to the reviewer #2’s concerns below) “the conclusions drawn have to clearly reflect what the experimental design allows to infer from the experiments: e.g. a poly(I:C) only control appears to be missing, poly(I:C) was given together with allergen and/or IL-33 and not alone, the use of TLR3 single knockouts is recommended.” Re: yes, the poly (I:C) alone control has been included as shown in Figures 2-6. As suggested, we have performed a new experiment using TLR3 single knockouts. The generated result is now shown in Figure S5. Compared to DKO mice (TLR3-/-MAVS-/-), in which the inhibitory effects of RV1B RNA were completely abolished, TLR3 single knockouts only showed a partial phenotype, indicating that both TLR3 and MAVS are both involved in sensing RV1B RNA. Reviewers' comments: Reviewer #1: “This study aimed to investigate the effect of extracellular RNA or DNA on the activation of innate lymphoid Type II cells. Therefore, the authors used a mouse model for experimental asthma triggered with a fungal antigen. Applying the extracellular RNA suppressed the product the rotation of the ILC2 cells which was shown to be dependent on the TLR3-Trif-IFNAR1 axis. This is an interesting and elegantly performed study, however in my opinion there are several limitations which are further explained in the comments below, especially concerning the statistical analysis.” Re: we really appreciate the Reviewer’s positive comments on this work. Major points “The mouse model needs to be described in more detail in the methods part. How many challenges were performed, at which time points and was there also a control receiving poly IC only but no allergen/IL33. Please also provide a scheme in the figure for the fungal model.” Re: yes, the poly (I:C) alone control has been included as shown in Figures 2-6. As shown in the scheme, poly (I:C), RV1B RNA or AdV5 RNA, was administered on Day -1, 1 and 2. Yes, we have provided a scheme in the figure for the fungal model as shown in Figures 3A, 4A, 8A and 9A. “The statistical analysis is performed only with a parametric t test. But actually, due to the in vivo experiments a non-parametric tests might be more appropriate. Second since there are more groups and treatments being compared at the same time this analysis certainly requires a more advanced statistical tests.” Re: we agree with the reviewer’s comment and have reanalyzed the relevant data set using the Mann-Whitney test. Accordingly, we have updated the P values in the related figures. The changes on the statistical analysis did not affect our overall conclusions. “For all figures containing histology pictures it would be good to supply an overview picture off the whole lung lobe to judge the overall inflammation.” Re: we thank the reviewer’s suggestion. As the overall inflammation of lung had been reflected on the BALF via FACS analysis, we feel that the current the magnification (scale bars, 100�m) of lung histology could provide a better resolution on a more detailed view of the airway via showing the infiltration of leukocytes, mucus production and goblet-cell hyperplasia. “In figure 1B the authors show a dose increase of poly IC, but with different doses than were used in a mouse model. However, they conclude from this figure that 5 microgram would be the ideal dose for further experiments. This is confusing.” Re: the decision to use 5 �g was not solely based on Figure 1B. In fact, all experiments shown in Figure 1 have contributed to the adoption of 5 �g per mouse as the optimal dose for further extensive experiments. “The text mentions the DCS and T cells are strongly increased at 50 microgram of poly IC, but there seems to be a nonsignificant trend only. This would need to be adapted in the results.” Re: we agree with the reviewer’s comments. The relevant texts have been removed. “It is interesting that poly IC reduces the ILC2 and th2 response in the lungs. Did the authors check for i.e. a th1 or an ILC 1 response as viral products might reduce the th2 phenotype by augmenting the th1 response?” Re: we thank the reviewer’s excellent point. We agree that it would be very interesting to examine a Th1 or ILC 1 response in the future experiments. “One major limitation of this paper is that the IL 33 or allergen was given at the same time as the poly IC. In order to investigate if such a stimulus is protected or aggravates asthmatic inflammation one would need to first establish experimental asthma in the mouse and then do the challenge with poly IC.” Re: we agree with the reviewer that we have only shown the preventative role of poly(I:C). It would be important to examine whether or not the poly IC administration could attenuate the ongoing eosinophilic lung inflammation induced by IL-33 or a fungal allergen in mice in the future experiments. Minor points “In my opinion that different knockouts different models but with the same analysis could be shown in the supplement to reduce the amount of figures.” Re: we appreciate the reviewer’s suggestion. However, at the moment, we think that the story flowed well with the current order of figures. We are willing to consider move some figures to the supplement, if there is a publication limit on the number of main figures. Reviewer #2: “In places the description of the methods is not detailed enough.” Re: yes, we have added more details on the relevant sections of Materials and Methods. The changes are highlighted in yellow. “The time and number of doses is not always clear. The degree of IL-33 induced inflammation in the lung is very high for what appears to be 3 treatments with a fairly standard dose.” Re: we did 3 treatments with either IL-33 or A. flavus to induce lung inflammation. We have provided an experimental scheme in the relevant figures. “How were ILC2 numbers calculated. The ILC2 plots in the figures do not appear to match the gating strategy described.” Re: We apologize for the confusion of ILC2 plot. The ILC2 gating strategy shown in Figure 4B was used for calculating the absolute number of ILC2. The gating plots shown in Figure 4 C-D were the representative the showing the percentage of ILC2 cells in total lung lymphocytes. Now, we have moved the old Figure 2B into supplementary figures to make it as the new Figure S2. Same as the method for calculating the number of eosinophils, ILC2 numbers were calculated based on the reference beads shown in the new Figure S2. The formula (Number of ILC2 cells per mL) is (total beads/# events of beads) x (# event of sample)/ Volume of cell per mL). “For intracellular cytokine staining, the authors should provide isotype controls in cells from both unstimulated mice. This is critical give the staining increase in small, and it is possible that the ILC2 change in size or in terms of intrinsic fluorescence.” Re: we thank the reviewer’s excellent suggestion. For the intracellular cytokine staining, now we have added isotype control antibodies corresponding to IL5- or IL13- staining, respectively (Figure S5D). “In the final experiments, I'm not convinced about the use of TLR3/MAVS double knockouts. While MAVS will be important in viral infection, it is less clear if it would be involved in response to extracellular DNA, which is what the authors are examining. This should be repeated in TLR3 single knockouts.” Re: we thank the reviewer’s excellent point. As suggested, we have performed new experiments using TLR3 single knockouts. The generated new data is now shown in Figure S4. “More details should be given regarding the animals (age / sex / diet / light cycle (including time of IL-33 treatment) /randomisation etc).” Re: yes, we have added more details on animals in the relevant section of Materials and Methods. Submitted filename: Rebutal_PONE-D-20-07673.docx Click here for additional data file. 14 Jul 2020 Sensing and Signaling of Immunogenic Extracellular RNAs Restrain Group 2 Innate Lymphoid Cell-Driven Acute Lung Inflammation and Airway Hyperresponsiveness PONE-D-20-07673R1 Dear Dr. Li, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Heinz Fehrenbach Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: the authors have answered all of my comments and have they are with improved the manuscript. I do not have further points. Reviewer #2: (No Response) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No 17 Jul 2020 PONE-D-20-07673R1 Sensing and Signaling of Immunogenic Extracellular RNAs Restrain Group 2 Innate Lymphoid Cell-Driven Acute Lung Inflammation and Airway Hyperresponsiveness Dear Dr. Li: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Prof. Dr. Heinz Fehrenbach Academic Editor PLOS ONE
  57 in total

1.  Interferon and IL-27 antagonize the function of group 2 innate lymphoid cells and type 2 innate immune responses.

Authors:  Kazuyo Moro; Hiroki Kabata; Masanobu Tanabe; Satoshi Koga; Natsuki Takeno; Miho Mochizuki; Koichi Fukunaga; Koichiro Asano; Tomoko Betsuyaku; Shigeo Koyasu
Journal:  Nat Immunol       Date:  2015-11-23       Impact factor: 25.606

Review 2.  Innate Lymphoid Cells of the Lung.

Authors:  Jillian L Barlow; Andrew N J McKenzie
Journal:  Annu Rev Physiol       Date:  2019-02-10       Impact factor: 19.318

Review 3.  Recognition of Endogenous Nucleic Acids by the Innate Immune System.

Authors:  Axel Roers; Björn Hiller; Veit Hornung
Journal:  Immunity       Date:  2016-04-19       Impact factor: 31.745

Review 4.  Human rhinoviruses.

Authors:  Samantha E Jacobs; Daryl M Lamson; Kirsten St George; Thomas J Walsh
Journal:  Clin Microbiol Rev       Date:  2013-01       Impact factor: 26.132

5.  Exposure to Bacterial CpG DNA Protects from Airway Allergic Inflammation by Expanding Regulatory Lung Interstitial Macrophages.

Authors:  Catherine Sabatel; Coraline Radermecker; Laurence Fievez; Genevieve Paulissen; Svetoslav Chakarov; Claudia Fernandes; Sabine Olivier; Marie Toussaint; Dimitri Pirottin; Xue Xiao; Pascale Quatresooz; Jean-Claude Sirard; Didier Cataldo; Laurent Gillet; Hicham Bouabe; Christophe J Desmet; Florent Ginhoux; Thomas Marichal; Fabrice Bureau
Journal:  Immunity       Date:  2017-03-21       Impact factor: 31.745

6.  An unexpected role for uric acid as an inducer of T helper 2 cell immunity to inhaled antigens and inflammatory mediator of allergic asthma.

Authors:  Mirjam Kool; Monique A M Willart; Menno van Nimwegen; Ingrid Bergen; Philippe Pouliot; J Christian Virchow; Neil Rogers; Fabiola Osorio; Caetano Reis e Sousa; Caetano Reis E Sousa; Hamida Hammad; Bart N Lambrecht
Journal:  Immunity       Date:  2011-04-07       Impact factor: 31.745

7.  Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3.

Authors:  L Alexopoulou; A C Holt; R Medzhitov; R A Flavell
Journal:  Nature       Date:  2001-10-18       Impact factor: 49.962

8.  Innate Immunity and Asthma Risk in Amish and Hutterite Farm Children.

Authors:  Michelle M Stein; Cara L Hrusch; Justyna Gozdz; Erika von Mutius; Donata Vercelli; Carole Ober; Anne I Sperling; Catherine Igartua; Vadim Pivniouk; Sean E Murray; Julie G Ledford; Mauricius Marques Dos Santos; Rebecca L Anderson; Nervana Metwali; Julia W Neilson; Raina M Maier; Jack A Gilbert; Mark Holbreich; Peter S Thorne; Fernando D Martinez
Journal:  N Engl J Med       Date:  2016-08-04       Impact factor: 91.245

9.  Long-term activation of TLR3 by poly(I:C) induces inflammation and impairs lung function in mice.

Authors:  Nicole C Stowell; Jonathan Seideman; Holly A Raymond; Karen A Smalley; Roberta J Lamb; Devon D Egenolf; Peter J Bugelski; Lynne A Murray; Paul A Marsters; Rachel A Bunting; Richard A Flavell; Lena Alexopoulou; Lani R San Mateo; Don E Griswold; Robert T Sarisky; M Lamine Mbow; Anuk M Das
Journal:  Respir Res       Date:  2009-06-01

10.  Bronchial mucosal IFN-α/β and pattern recognition receptor expression in patients with experimental rhinovirus-induced asthma exacerbations.

Authors:  Jie Zhu; Simon D Message; Patrick Mallia; Tatiana Kebadze; Marco Contoli; Christine K Ward; Elliot S Barnathan; Mary Ann Mascelli; Onn M Kon; Alberto Papi; Luminita A Stanciu; Michael R Edwards; Peter K Jeffery; Sebastian L Johnston
Journal:  J Allergy Clin Immunol       Date:  2018-04-24       Impact factor: 10.793

View more
  3 in total

Review 1.  Crosstalk between ILC2s and Th2 CD4+ T Cells in Lung Disease.

Authors:  Lan-Lan Mi; Wei-Wei Guo
Journal:  J Immunol Res       Date:  2022-05-10       Impact factor: 4.493

2.  TLR3-driven IFN-β antagonizes STAT5-activating cytokines and suppresses innate type 2 response in the lung.

Authors:  Rinna Tei; Koji Iijima; Koji Matsumoto; Takao Kobayashi; Jyoti Lama; Elizabeth A Jacobsen; Hirohito Kita
Journal:  J Allergy Clin Immunol       Date:  2021-08-21       Impact factor: 10.793

3.  A crosstalk between type 2 innate lymphoid cells and alternative macrophages in lung development and lung diseases (Review).

Authors:  Lan-Lan Mi; Yue Zhu; Hong-Yan Lu
Journal:  Mol Med Rep       Date:  2021-03-31       Impact factor: 2.952

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.