LncRNA FEZF1-AS1 Modulates Cancer Stem Cell Properties of Human Gastric Cancer Through miR-363-3p/HMGA2.

Gastric cancer (GC) is a leading cause of cancer-related death with poor prognosis. Growing evidence has shown that long noncoding ribonucleic acid (lncRNA) FEZ family zinc finger 1 antisense RNA 1(FEZF1-AS1), an "oncogene," regulates tumor progression and supports cancer stem cell. However, the tumorigenic mechanism of FEZF1-AS1 on gastric cancer stem cell (GCSC) is yet to be investigated. Here, we discovered that FEZF1-AS1 was upregulated in GC tissues and cell lines. Knockdown of FEZF1-AS1 inhibited sphere formation and decreased expression of stem factors and markers. Moreover, FEZF1-AS1 silence also suppressed cell proliferation, viability, invasion, and migration of GCSCs. MiR-363-3p is used as a target of FEZF1-AS1, because its expression was suppressed by FEZF1-AS1 in GCSCs. FEZF1-AS1 could sponge miR-363-3p and increased the expression of high-mobility group AT-hook 2 (HMGA2). The expression of FEZF1-AS1 and miR-363-3p, as well as that of miR-363-3p and HMGA2, was negatively correlated in GC tissues. Finally, FEZF1-AS1 contributed to promotion of GCSCs progression partially through inhibition of miR-363-3p. Subcutaneous xenotransplanted tumor model revealed that silence of FEZF1-AS1 suppressed in vivo tumorigenic ability of GSCS via downregulation of HMGA2. In general, our findings clarified the critical regulatory role of FEZF1-AS1/miR-363-3p/HMGA2 axis in GCSC progression, providing a potential therapeutic target for GC.

Introduction

Gastric cancer (GC) is one of the most common malignancies worldwide[1-3]. Incidence of GC is high, especially in China[4]. Despite advanced diagnostic techniques and treatment strategies[5-7], prognosis of GC is still poor[8] due to high metastasis[9]. Development of GC is a complicated biological process, with oncogenes activation or antioncogenes inactivation[10]. Therefore, investigation of molecular mechanisms involved in GC development will be helpful to identify new therapeutic targets.

Recently, cancer stem cells (CSCs), with self-renewal and differentiation abilities[11], have been shown to contribute to tumor development[12]. Gastric CSCs (GCSCs) have been isolated and identified from GC tissues[13]. GCSCs can cause new tumors, as well as relapse, metastasis, and resistance to chemotherapy of gastric tumors[14]. Therefore, although little is known about the potential regulatory mechanism of GCSC[15], it is a promising target for anticancer drugs that can prevent recurrence of GC[16].

Long noncoding ribonucleic acids (lncRNAs) regulate target gene expression[17]. Because of its critical role in cell progression[18], lncRNAs are hot topic in cancer research. The LncRNA FEZ family zinc finger 1 antisense RNA 1 (FEZF1-AS1) has been identified as a carcinogenic lncRNA in a variety of tumors and can promote the progression of osteosarcoma[19], colon cancer[20], pancreatic ductal adenocarcinoma[21], lung cancer[22], and so on. Moreover, FEZF1-AS1 promoted cell proliferation of GC through inhibition of p21[23]. Although FEZF1-AS1 contributed to the stemness of nonsmall cell lung cancer[24], the role and molecular mechanism about FEZF1-AS1 in GCSC remain unclear.

Generally, lncRNAs act as miRNA sponges or competitive endogenous RNAs (ceRNAs) to affect the function of microRNA (miRNA)[25]. A previous study reported that FEZF1-AS1 promotes the progression of osteosarcoma via targeting miR-4443[26] and facilitates the progression of pancreatic ductal adenocarcinoma via miR-107[27]. However, the miRNA targets for FEZF1-AS1 in GC have not been reported. As a common tumor suppressor, miR-363-3p demonstrates protection effect on GC progression[28]. Therefore, FEZF1-AS1 may bind with miR-363-3p to regulate GC progression. Moreover, high-mobility family protein A2 (high-mobility group AT-hook 2, HMGA2) functions as transcription factor to mediate genes associated with tumorigenesis[29] and is involved in miR-363-3p–regulated liver cancer[30]. HMGA2, which is highly expressed in GC[29], induces tumor cells to undergo epithelial to mesenchymal transition (EMT), leads to tumor stem cell properties acquisition, and promotes tumor metastasis of GC[31]. Therefore, FEZF1-AS1/miR-363-3p/HMGA2 axis may participate in GCSCs and GC progression.

In this study, we evaluated the effect and mechanism of FEZF1-AS1 on tumor stem cell properties of GC, which will be useful for the treatment to GC.

Materials and Methods

Patients and Sample Collection

A total of 50 patients with GC were recruited from Shiyan Taihe Hospital from September 2010 to January 2017. Patients with no local or systemic treatment before surgery were definite diagnosed or histopathology confirmed as GC. GC tumor and adjacent normal tissues excised via surgery were collected. This study was approved by the Ethical Committee of Taihe Hospital, Hubei University of Medicine. All participants signed a written informed consent.

In Situ Hybridization

Five-micrometer sections of GC and adjacent normal tissues were fixed in 10% formaldehyde (Sigma-Aldrich) and then embedded with paraffin (Sigma-Aldrich). Following dewaxing and rehydration, the tissues were digested with proteinase K (Sigma-Aldrich). The 4% paraformaldehyde-fixed samples were hybridized overnight with specific antisense oligonucleotide DNA probe 5′-TTCGACTGTTTCCTTGACACTAC-3′ synthesized by Invitrogen (Carlsbad, CA, USA) at 55°C. The samples were then incubated with horseradish peroxidase (HRP, Sigma Aldrich, St. Louis, MO, USA) for 30 min. Hybridization signals were amplified with diaminobenzidine (Sigma Aldrich), and the images were acquired by fluorescent microscope (DP12 SZX7, Olympus Inc., Japan).

Cell Culture

GC cell lines (SGC-7901, AGS, MGC-803, MKN-45, and BGC-823), as well as GES-1 (normal human gastric mucous epithelium cell line), were acquired from American Type Culture Collection (Manassas, VA, USA). All the cell lines were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium (Gibco, MA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco) at 37°C with 5% CO2.

For culture of aldehyde dehydrogenase (ALDH)+ tumor cells, aldefluor assay was used to isolate ALDH+ cells. For this, 1 × 106 MGC-803 or MKN-45 cells were harvested and then incubated at 37°C with aldefluor assay buffer (Stem Cell Technologies, Vancouver, BC, Canada) for 40 min. For the control, the cells were treated with 50 μM N,N-diethylaminoazobenzene (DEAB, Sigma Aldrich; ALDH1 enzyme inhibitor). Fluorescence intensity was analyzed via flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA). Baseline intensity was defined by DEAB-treated cells, and cells with fluorescence intensity beyond the baseline were sorted and designated as ALDH+ cells, and cells with fluorescence intensity below the baseline were sorted and designated as ALDH– cells. The cells were then cultured as before.

Cell Transfection

For the knocking down of FEZF1-AS1, short hairpin RNAs (shRNAs) (1#: 5′-GCACGCTTCCGAGTTTCCATT-3′ and 2#: 5′-GCCTGATGTCTAACAGAAAGG-3′) as well as the scrambled shRNA were synthesized, and then cloned in to lentiviral plasmids LV2 (GenePharma, Shanghai, China), named as LV2-shNC, LV2-shFEZF1-AS1-1#, and LV2-shFEZF1-AS1-2#. ALDH+ cells (4 × 105/well) were transfected with LV2-shNC, LV2-shFEZF1-AS1-1#, and LV2-shFEZF1-AS1-2# with 8 mg/ml polybrene and ViraPower Packaging Mix (Thermo Fisher, Waltham, MA, USA). Lastly, stable cell lines were obtained following5 μg/ml puromycin (Sigma Aldrich) treatment for 7 d.

For overexpression of FEZF1-AS1, the FEZF1-AS1 primary precursor sequence was subcloned into vector pcDNA3.1 (Invitrogen). ALDH+ cells (4 × 105/well) were transfected with pcDNA3.1-FEZF1-AS1 or the empty vector (pcDNA3.1-NC) wtih Lipofectamine 2000 (Invitrogen).

MiR-363-3p mimics and inhibitors, two small interfering RNAs (siRNAs) targeting FEZF1-AS1 as well as the negative control (miR-NC, inh NC, si-NC), were synthesized by GenePharma (Suzhou, China). ALDH+ cells were transfected with 40 nM miR-363-3p mimics/inhibitor, si-FEZF1-AS1, or their NC by Lipofectamine 2000.

Sphere-Formation Assays

ALDH+ cells (5 × 103/ml) with different treatments in serum-free medium were plated in ultralow attachment six-well plates (Corning, NY, USA). The medium was changed every 3 d, and passage one (P1) spheres were counted 14 d later. For further sphere formation assay, P1 spheres were scattered and collected, and then 100 cells/well were re-seeded in 96-well plates. Ten days later, the spheres were quantified.

Flow Cytometry

A total of 1 × 106 ALDH+ cells with different treatments were harvested. Allophycocyanin-antihuman CD133 (566597; BD Biosciences) and fluorescein isothiocyanate-antihuman ALDH1 (611194; BD Biosciences) antibodies were incubated with the cells in the dark for 30 min. After washing with phosphate buffered saline (PBS) (Beyotime Institute of Biotechnology Co., Ltd., Shanghai, China) and re-suspending with fluorescence activated cell sorting (FACS) (Sigma-Aldrich) buffer, cells were analyzed by flow cytometer.

Cell Proliferation

ALDH+ cells (1 × 103/well) were cultured as before for 5 d and then incubated at 37°C with 10 µl of cell counting kit-8 (CCK8) reagent (Beyotime) for 2 h. Absorbance at 450 nm was detected to determine cell viabilities. For colony formation assay, ALDH+ cells (1 × 103/well) were cultured as before for 14 d. The colonies were stained with 1% w/v crystal violet 2% ethanol suspended in PBS, counted, and photographed under light microscope (Olympus, Tokyo, Japan).

Wound-Healing Assay

ALDH+ cells (5 × 105/well) were cultured for 24 h, and then wound gaps were generated via a plastic pipette tip. After washing with PBS, cells were cultured in RPMI-1640 medium as before for another 24 h. The wound width was calculated by inverted microscope.

Transwell Assay

ALDH+ cells (2 × 104/well), suspending in 200 µl RMPI-1640 medium, were plated into the upper layer of the chamber with the Matrigel-coated membrane (BD Biosciences). The lower layer of the chamber was added with 500 µl RPMI-1640 medium containing 10% FBS. After 24 h, invasive cells in the lower layer were fixed in 100% methanol and then stained with 0.1% crystal violet for the detection of stained cells.

Dual Luciferase Reporter Assay

Sequences of wild-type or mutant 3′-untranslated region (UTR) of FEZF1-AS1 or HMGA2 were subcloned into pGL3 luciferase vector (Promega, Madison, Wisconsin, USA). ALDH+ cells (3 × 104/well) were cotransfected with miR-363-3p mimic or miR-NC with pGL3-WT-FEZF1-AS1, pGL3-MUT-FEZF1-AS1, pGL3-WT-HMGA2, or pGL3-MUT-HMGA2. The reference control group of cells was transfected with renilla luciferase expression plasmids. Then, 48 h later, the luciferase activities were measured via Lucifer Reporter Assay System (Promega).

Fluorescence In Situ Hybridization (FISH)

ALDH+ cells were fixed with 4% formaldehyde solution for 15 min, and then incubated with 0.1% Triton X-100 (Sigma-Aldrich) for another 10 min. Fluorescence-conjugated FEZF1-AS1 or miR-363-3p probes (Invitrogen) were hybridized with cells in the dark for 5 h. Cells were photographed via laser scanning confocal microscopy (Carl Zeiss, Jena, Germany).

RNA Immunoprecipitation (RIP)

ALDH+ cells were lysed via Magna RIP Kit (EMD Millipore, Billerica, MA, USA), and incubated at 4°C with protein G Sepharose beads (GE Healthcare, Eindhoven, the Netherlands) coated with anti-AGO2 antibody (ab5072; Abcam, Cambridge, MA, USA) overnight. Anti-IgG antibody was used as negative control. RNAs were isolated for analysis.

Mouse Xenograft Assay

Animal experiments were approved by the Ethics Committee of Taihe Hospital, Hubei University of Medicine (approval no. 2017-57), and carried out in accordance with the guidelines formulated by the Ethics Committee of Hubei University of Medicine. Twenty female BALB/c nude mice (5 wk old) were purchased from ARS/Sprague Dawley Division (Madison, WI, USA), and separated into two groups. ALDH+ cells (1 × 106; MGC-803) in 100 µl PBS with stable expression of shFEZF1-AS1 or the scrambled shRNA were subcutaneously injected into the flanks of nude mice. The tumor tissues of mice were isolated and weighted 24 d after injection.

Histologic Evaluation and Immunohistochemistry

The GC tumor tissues of mice were fixed in 10% buffered formalin and embedded in paraffin. Hematoxylin and eosin (H&E) (Sigma-Aldrich) staining sections were photographed by microscope. For immunohistochemistry, the tissues were incubated in 3% H2O2 for blocking endogenous peroxidase and then fixed in 4% paraformaldehyde. After incubation with 5% dry milk and 0.3% goat serum for 30 min, the sections were incubated at 4°C with anti-HMGA2 (ab52039), Ki-67 (ab16667), or ALDH1 (ab52492) antibodies overnight. Following incubation with HRP-conjugated secondary antibodies for another 2 h, the slides were examined under a light microscope with hematoxylin stain cell nuclei.

Quantitative Reverse Transcription PCR (qRT-PCR)

Total RNAs or miRNAs were extracted via Trizol reagent (Invitrogen) or miRcute miRNA isolation kit (Tiangen, Beijing, China). complementary DNAs (cDNAs) were then reverse transcribed, and quantitative reverse transcription PCR (qRT-PCR) was conducted via SYBR1 Premix Ex Taq™ II (Takara, Shiga, Japan) on 7500 Real-time PCR System (Applied Biosystems, Carlsbad, CA, USA) with primers listed in Table 1. U6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as internal control.

Table 1.

Primer.

ID	Sequences (5′–3′)
GAPDH F	ACCACAGTCCATGCCATCAC
GAPDH R	TCCACCACCCTGTTGCTGTA
FEZF1-AS1 F	TTAGGAGGCTTGTTCTGTGT
FEZF1-AS1 R	GTTTTCCATCTCAGCCTGGA
ALDH1 F	CTGCTGGCGACAATGGAGT
ALDH1 R	GTCAGCCCAACCTGCACAG
CD133 F	CAACCCTGAACTGAGGCAGC
CD133 R	TTGATAGCCCTGTTGGACCAG
Nanog F	GTCTTCTGCTGAGATGCCTCACA
Nanog R	CTTCTGCGTCACACCATTGCTAT
SOX2 F	GCCGAGTGGAAACTTTTGTCG
SOX2 R	GCAGCGTGTACTTATCCTTCTT
OCT4 F	GTTGATCCTCGGACCTGGCTA
OCT4 R	GGTTGCCTCTCACTCGGTTCT
miR-363-3p F	CGGCGAATTGCACGGTATCCA
miR-363-3p R	CAGTGCAGGGTCCGAGGT
HMGA2 F	AAAGCAGAAGCCACTGGAGAAA
HMGA2 R	TTCCTCCTGAGCAGGCTTCTT
U6 F	CTCGCTTCGGCAGCACA
U6 R	AACGCTTCACGAATTTGCGT

ALDH: aldehyde dehydrogenase; CD: cluster of differentiation; FEZF1-AS1: FEZ family zinc finger 1 antisense RNA 1; HMGA2: high-mobility group AT-hook 2; Nanog: nanog homeobox; Oct: octamer-binding transcription factor; SOX: sex-determining region Y-Box transcription factor.

Western Blot

Total proteins were extracted from tumor tissues and cells, and then separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). After transferring to polyvinylidene fluoride (PVDF) membrane and blocking with 5% bovine serum albumin (BSA), the PVDF membranes were probed at 4°C with rabbit anti-ALDH1 antibody (EP1933Y; 1:1,500, Abcam), cluster of differentiation (CD)133 (ab19898), nanog homeobox (Nanog) (ab109250), sex-determining region Y-Box transcription factor 2 (SOX2) (ab97959) oroctamer-binding transcription factor (Oct)4 (ab18976; 1:1,000, Abcam), E-cadherin (ab15148) or N-cadherin (ab76057; 1:2,000, Abcam), HMGA2 (1:2,500, Abcam), and GAPDH (ab9485; 1:3,000, Abcam) overnight. Following incubation with HRP-conjugated secondary antibodies (1:5,000, Abcam), the immunoreactivities were evaluated with enhanced chemiluminescence (KeyGen, Nanjin, China).

Statistical Analysis

All results are presented as mean ± SEM of five independent experiments. The statistical analyses were determined by GraphPad Prism software (GraphPad Prism Software Inc., San Diego, USA) and one-way analysis of variance (ANOVA). Survival curves were plotted via Kaplan–Meier method and log-rank test. Relationship between FEZF1-AS1 and clinico-pathological parameters of GC patients was conducted by Fisher’s exact test. P < 0.05 was considered as statistically significant.

Results

FEZF1-AS1 Was Upregulated in GC Tissues and GCSCs of GC Cell Lines

We first examined FEZF1-AS1 expression in GC tissues. Both qRT-PCR (Fig. 1A) and in situ hybridization (Fig. 1B) results showed that FEZF1-AS1 was highly expressed in tumor tissues than adjacent normal tissues. According to the average expression of FEZF1-AS1, patients were divided into two groups: high FEZF1-AS1 expression group (N = 22) and low FEZF1-AS1 expression group (N = 28). Overall survival (OS) analysis indicated that patients with high expression of FEZF1-AS1 had a shorter OS rate than patients with low expression (P = 0.0364, Fig. 1C). Further analysis between FEZF1-AS1 expression and clinico-pathological characteristics of GC patients revealed that high expression of FEZF1-AS1 was related to lymphatic metastasis (P = 0.013) and tumor-node metastasis (TNM) stage (P = 0.001; Table 2). However, other clinical features such as gender (P = 0.749), and age (P = 0.615) showed no significant relation to FEZF1-AS1 expression (Table 2). These data suggested that FEZF1-AS1 was upregulated in GC and the compact relation between FEZF1-AS1 and GC.

Figure 1.

FEZF1-AS1 was upregulated in GC tissues and GCSCs of GC cell lines. (A) The expression of FEZF1-AS1 in GC tissues and adjacent normal tissues was detected by qRT-PCR (N = 50). *** represents tumor versus adjacent normal tissues, P < 0.001. (B) The expression of FEZF1-AS1 in GC tissues and adjacent normal tissues was detected by in situ hybridization. Scale bars: 200 μm. (C) The correlation of OS of GC patients with high FEZF1-AS1 expression and low expression of FEZF1-AS1 was analyzed. (D) The expression of FEZF1-AS1 in GC cell lines (MGC-803, BGC-823, SGC-7901, MKN-45, and AGS) and normal human gastric mucous epithelium cell line (GES-1) was detected by qRT-PCR. *, **, *** represent GC cell lines versus GES-1, P < 0.05, P < 0.01, P < 0.001. (E) The mRNA expressions of ALDH1, CD133, Nanog, SOX2, Oct4, and FEZF1-AS1 in GSCSs (ALDH+ MGC-803 and MKN-45 cells) were detected by qRT-PCR. **, *** represent ALDH+ cell versus ALDH– cell, P < 0.01, P < 0.001. (F) The protein expressions of ALDH1, CD133, Nanog, SOX2, and Oct4 in GSCSs (ALDH+ MGC-803 and MKN-45 cells) were detected by western blot. **, *** represent ALDH+ cell versus ALDH– cell, P < 0.01, P < 0.001. ALDH: aldehyde dehydrogenase; CD: cluster of differentiation; FEZF1-AS1: FEZ family zinc finger 1 antisense RNA 1; GC: gastric cancer; GCSC: gastric cancer stem cell; Nanog: nanog homeobox; Oct: octamer-binding transcription factor; OS: overall survival; qRT-PCR: quantitative reverse transcription PCR; SOX: sex-determining region Y-Box transcription factor.

Table 2.

Relationship Between FEZF1-AS1 and Clinico-pathological Parameters.

Parameters	Number of patients	FEZF1-AS1 expression		P value
		Low (< average)	High (≥ average)
Number	50	28	22
Gender
Male	26	14	12	0.749
Female	24	14	10
Age (y)
≥ Mean (60)	23	12	11	0.615
< Mean (60)	27	16	11
Location
Gastroesophageal	30	18	12	0.485
Middle to distal	20	10	10
Depth of invasion
T1, T2	28	18	10	0.183
T3, T4	22	10	12
Lymphatic metastasis
Positive	28	20	8	0.013*
Negative	22	8	14
TNM stage
I, II	27	21	6	0.001*
III, V	23	7	16
Tumor differentiation
Low	23	15	8	0.226
Medium, high	27	13	14

FEZF1-AS1: FEZ family zinc finger 1 antisense RNA 1; TNM: tumor-node metastasis.

We then found that FEZF1-AS1 was also increased in five different GC cell lines (AGS, BGC-823, SGC-7901, MKN-45, and MGC-803) compared to GES-1 (Fig. 1D). We then selected MGC-803 and MKN-45 for the isolation of cells with high expression of ALDH1 (ALDH positive; ALDH+), the hallmarks of CSCs, via Aldefluor assay. Genes (Fig. 1E) expression and protein (Fig. 1F) analysis revealed that FEZF1-AS1 and GCSC markers (CD133, Nanog, SOX2, and Oct4) were induced in ALDH+ MGC-803 and MKN-45 cells compared with ALDH negative (ALDH–) cells. Overall, these results indicated that FEZF1-AS1 was elevated in both GC tissues and GCSCs, suggesting an oncogenic role of FEZF1-AS1 in GCSCs.

FEZF1-AS1 Was Critical for GCSCs Properties Maintenance

To evaluate the influence of FEZF1-AS1 on GCSCs properties, GCSCs (ALDH+ MGC-803 and MKN-45 cells) were transfected with shRNAs targeting FEZF1-AS1 (sh#1 and sh#2; Fig. 2A). Sphere formation assay revealed that knockdown of FEZF1-AS1 via shRNAs inhibited spheroid formation in GCSCs (Fig. 2B). FEZF1-AS1 knockdown reduced the mRNAs (Fig. 2C) and protein (Fig. 2D) levels of GCSC markers (ALDH1, CD133, Nanog, SOX2, and Oct4). Flow cytometry (Fig. 2E) analysis also confirmed the inhibitory ability of FEZF1-AS1 silence on enrichment of GCSC markers and ALDH1+/CD133+ rate in ALDH+ MGC-803 and MKN-45 cells. Therefore, FEZF1-AS1 was critical for GCSCs properties maintenance.

Figure 2.

FEZF1-AS1 was critical for GCSCs properties maintenance. (A) Transfection efficiency of shRNAs targeting FEZF1-AS1 (sh#1 and sh#2) in ALDH+ MGC-803 and MKN-45 cells was detected by qRT-PCR. **, *** represent sh#1 or sh#2 versus shNC, P < 0.01, P < 0.001. (B) The effects of sh#1 and sh#2 targeting of FEZF1-AS1 on spheroid-forming ability in ALDH+ MGC-803 and MKN-45 cells were detected by sphere formation assay. *, **, *** represent sh#1 or sh#2 versus shNC, P < 0.05, P < 0.01, P < 0.001. (C) The effect of sh#1 and sh#2 targeting of FEZF1-AS1 on the mRNA expression of ALDH1, CD133, Nanog, SOX2, and Oct4 in GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected by qRT-PCR. **, *** represent sh#1 or sh#2 versus shNC, P < 0.01, P < 0.001. (D) The effect of downregulation of FEZF1-AS1 by transfection of sh#1 and sh#2 on protein expression of ALDH1, CD133, Nanog, SOX2, and Oct4 in GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected by qRT-PCR. *, **, *** represent sh#1 or sh#2 versus shNC, P < 0.05, P < 0.01, P < 0.001. (E) The inhibitory ability of sh#1 and sh#2 on protein expression of ALDH1+/CD133+ rate in GSCSs (ALDH+ MGC-803 and MKN-45 cells) detected by flow cytometry. *** represents sh#1 or sh#2 versus shNC, P < 0.001. ALDH: aldehyde dehydrogenase; CD: cluster of differentiation; FEZF1-AS1: FEZ family zinc finger 1 antisense RNA 1; GCSC: gastric cancer stem cell; mRNA: messenger ribonucleic acid; Nanog: nanog homeobox; Oct: octamer-binding transcription factor; qRT-PCR: quantitative reverse transcription PCR; shRNA: short hairpin RNA; SOX: sex-determining region Y-Box transcription factor.

FEZF1-AS1 Promoted GCSCs Progression

We then determined the effect of FEZF1-AS1 on GCSCs progression. First, CCK8 assay revealed that FEZF1-AS1 knockdown via shRNA (sh#1 and sh#2) decreased the cell viability of GCSCs (Fig. 3A). Second, the inhibition abilities of FEZF1-AS1 knockdown on cell proliferation (Fig. 3B), migration (Fig. 3C), and invasion (Fig. 3D) of GCSCs were also determined. Finally, FEZF1-AS1 knockdown increased the expression of epithelial marker protein (E-cadherin), while decreased mesenchymal marker protein (N-cadherin), as shown by western blot (Fig. 3E) analysis, thereby suppressing EMT and inhibiting cancer metastasis.

Figure 3.

FEZF1-AS1 promoted GCSCs progression. (A) The effect of downregulation of FEZF1-AS1 by transfection of sh#1 and sh#2 on cell viability in GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected by CCK8. **, *** represent sh#1 or sh#2 versus shNC, P < 0.01, P < 0.001. (B) The effect of downregulation of FEZF1-AS1 by transfection of sh#1 and sh#2 cell proliferation in GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected by colony formation assay. *** represents sh#1 or sh#2 versus shNC, P < 0.001. (C) The effect of downregulation of FEZF1-AS1 by transfection of sh#1 and sh#2 on cell migration in GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected by wound healing assay. * represents sh#1 or sh#2 versus shNC, P < 0.05. Scale bars: 100 μm. (D) The effect of downregulation of FEZF1-AS1 by transfection of sh#1 and sh#2 on cell invasion in GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected by transwell assay. **, *** represent sh#1 or sh#2 versus shNC, P < 0.01, P < 0.001. (E) The effect of downregulation of FEZF1-AS1 by transfection of sh#1 and sh#2 on expression of E-cadherin and N-cadherin in GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected by western blot. *, **, *** represent sh#1 or sh#2 versus shNC, P < 0.05, P < 0.01, P < 0.001. ALDH: aldehyde dehydrogenase; FEZF1-AS1: FEZ family zinc finger 1 antisense RNA 1; GAPDH: lyceraldehyde-3-phosphate dehydrogenase; GCSC: gastric cancer stem cell.

FEZF1-AS1 Bound to miR-363-3p

The binding target associated with regulation of FEZF1-AS1 on GCSCs was then determined. Potential binding site between FEZF1-AS1 and miR-363-3p is shown in Fig. 4A. In addition, miR-363-3p mimics inhibited luciferase activity of reporter gene with wild-type FEZF1-AS1 (Fig. 4A), while it had no significant effect on reporter gene with mutated FEZF1-AS (Fig. 4A). Enrichment of FEZF1-AS1 and miR-363-3p via argonaute RISC catalytic component (Ago)2-containing beads compared to immunoglobulin G (IgG)-containing beads also confirmed the binding relationship between FEZF1-AS1 and miR-363-3p (Fig. 4B). Subcellular localization by FISH assay showed that FEZF1-AS1 was colocalized with miR-363-3p in cytoplasm (Fig. 4C). Moreover, miR-363-3p was downregulated by FEZF1-AS1 overexpression via transfection of pcDNA-3.1-FEZF1-AS1 in GCSCs (Fig. 4D), while miR-363-3p was upregulated by knockdown of FEZF1-AS1 via si-FEZF1-AS1 (Fig. 4D), indicating the inhibition ability of FEZF1-AS1 on miR-363-3p expression. Moreover, miR-363-3p was downregulated in human GC tissues (Fig. 4E), predicting a negative correlation with FEZF1-AS1 in GC (Fig. 4F).

Figure 4.

FEZF1-AS1 bound to miR-363-3p. (A) The predicted binding site of miR-363-3p in FEZF1-AS1 is shown. The effect of miR-363-3p mimics on luciferase activity of reporter gene with wild-type (WT) or mutant (MUT) FEZF1-AS1 in GCSCs (ALDH MGC-803 and MKN-45 cells) was detected by luciferase reporter assay. *** represents miR-363-3p mimics versus miR-NC, P < 0.001. (B) The enrichment of FEZF1-AS1 and miR-363-3p in Ago2-containing beads of GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected and quantified. *** represents anti-Ago2 versus anti-IgG, P < 0.001. (C) Subcellular localization of FEZF1-AS1 and miR-363-3p in the cytoplasm of GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected by fluorescence in situ hybridization. Scale bars: 100 μm. (D) The effect of si-FEZF1-AS1 and pcDNA-3.1-FEZF1-AS1 on expression of miR-363-3p in GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected by qRT-PCR. *** represents si-FEZF1-AS1 versus si-NC or pcDNA-3.1-FEZF1-AS1 versus pcDNA-3.1-NC, P < 0.001. (E) The expression of miR-363-3p in GC tissues and adjacent normal tissues was detected by qRT-PCR (N = 50). *** represents tumor versus adjacent normal tissues, P < 0.001. (F) Negative relation between FEZF1-AS1 and miR-363-3p in GC tissues was analyzed. Ago: argonaute RISC catalytic component; ALDH: aldehyde dehydrogenase; FEZF1-AS1: FEZ family zinc finger 1 antisense RNA 1; GC: gastric cancer; GCSC: gastric cancer stem cell; IgG: immunoglobulin G; qRT-PCR: quantitative reverse transcription PCR.

HMGA2 Was a Direct Target of miR-363-3p

Similarly, HMGA2 was predicted as a binding target of miR-363-3p via Targetscan. The target relationship was confirmed by luciferase reporter assay, as shown in Fig. 5A. Transfection efficiency of miR-363-3p mimics or inhibitor was first confirmed as shown in Fig. 5B. Moreover, miR-363-3p mimics inhibited mRNA (Fig. 5C) and protein (Fig. 5D) expression of HMGA2 in ALDH+ cells, whereas miR-363-3p inhibitor induced HMGA2 expression (Fig. 5C, D). Similar to FEZF1-AS1 expression in GC tissues, HMGA2 was also induced in GC tissues (Fig. 5E), predicting a negative relation between HMGA2 and miR-363-3p (Fig. 5F). The upregulation of HMGA2 in GC tissues was also confirmed by western blot analysis (Fig. 5G).

Figure 5.

HMGA2 was a direct target of miR-363-3p. (A) The predicted binding site of miR-363-3p in HMGA2 was listed, and the effect of miR-363-3p mimics on luciferase activity of reporter gene with wild-type (WT) or mutant (MUT) HMGA2 in GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detect by luciferase reporter assay. *** represents miR-363-3p mimics versus miR-NC, P < 0.001. (B) The effect of miR-363-3p mimics and inhibitor on the expression of miR-363-3p in GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected by qRT-PCR. *** represents miR-363-3p mimics versus miR-NC or miR-363-3p inhibitor versus inh NC, P < 0.001. (C) The effect of miR-363-3p mimics and inhibitor on mRNA expression of HMGA2 in GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected by qRT-PCR. **, *** represent miR-363-3p mimics versus miR-NC or miR-363-3p inhibitor versus inh NC, P < 0.01, P < 0.001. (D) The effect of miR-363-3p mimics and inhibitor on protein expression of HMGA2 in GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected by western blot and quantified. *** represents miR-363-3p mimics versus miR-NC or miR-363-3p inhibitor versus inh NC, P < 0.001. (E) The mRNA expression of HMGA2 in GC tissues and adjacent normal tissues was detected by qRT-PCR (N = 50). *** represents tumor versus adjacent normal tissues, P < 0.001. (F) Negative relation between HMGA2 and miR-363-3p in GC tissues was analyzed. (G) The protein expression of HMGA2 in GC tissues and adjacent normal tissues was detected by western blot and quantified. **, *** represent tumor versus adjacent normal tissues, P < 0.01, P < 0.001. ALDH: aldehyde dehydrogenase; GC: gastric cancer; GCSC: gastric cancer stem cell; HMGA2: high-mobility group AT-hook 2; mRNA: messenger ribonucleic acid; qRT-PCR: quantitative reverse transcription PCR.

FEZF1-AS1 Supported GCSCs Properties and Promoted GCSCs Progression via Sponging miR-363-3p

To evaluate the effects of FEZF1-AS1/miR-363-3p on GCSCs properties and progression, GCSCs were cotransfected with miR-363-3p inhibitor and si-FEZF1-AS1. Sphere formation assay showed that the impaired sphere formation induced by FEZF1-AS1 knockdown was partially relieved by miR-363-3p inhibitor in GCSCs (Fig. 6A). The decreased protein expression of GCSC markers (ALDH1, CD133, Nanog, SOX2, and Oct4) induced by FEZF1-AS1 knockdown was reversed in ALDH+ cells cotransfected with miR-363-3p inhibitor and si-FEZF1-AS1 (Fig. 6B). The increased E-cadherin and decreased N-cadherin induced by FEZF1-AS1 knockdown were also reversed in ALDH+ cells cotransfected with miR-363-3p inhibitor and si-FEZF1-AS1 (Fig. 6B). Moreover, miR-363-3p inhibitor attenuated the FEZF1-AS1 knockdown induced the inhibition on enrichment GCSC markers (Fig. 6C). These results showed that FEZF1-AS1 supported GCSCs properties via sponging miR-363-3p. Similarly, the inhibition of FEZF1-AS1 on GCSCs viability (Fig. 7A), proliferation (Fig. 7B), migration (Fig. 7C), and invasion (Fig. 7D) was restored by miR-363-3p inhibitor.

Figure 6.

FEZF1-AS1 supported GCSCs properties via sponging miR-363-3p. (A) The effect of miR-363-3p inhibitor and si-FEZF1-AS1 on spheroid-forming ability in ALDH+ MGC-803 and MKN-45 cells was detected by sphere formation assay. *, ** represent si-FEZF1-AS1 versus si-NC, P < 0.05, P < 0.01. #, ## represent si-FEZF1-AS1 versus si-FEZF1-AS1 + miR-363-3p inhibitor, P < 0.05, P < 0.01. (B) The effect of miR-363-3p inhibitor and si-FEZF1-AS1 on protein expression of HMGA2, ALDH1, CD133, Nanog, SOX2, Oct4, E-cadherin, and N-cadherin in ALDH+ MGC-803 and MKN-45 cells was detected by sphere formation assay. *, **, *** represent si-FEZF1-AS1 versus si-NC, P < 0.05, P < 0.01, P < 0.001. #, ##, ### represent si-FEZF1-AS1 versus si-FEZF1-AS1 + miR-363-3p inhibitor, P < 0.05, P < 0.01, P < 0.001. (C) The effect of miR-363-3p inhibitor and si-FEZF1-AS1 on protein expression of ALDH1+/CD133+ rate in GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected by flow cytometry. ** represents si-FEZF1-AS1 versus si-NC, P < 0.01. ## represents si-FEZF1-AS1 versus si-FEZF1-AS1 + miR-363-3p inhibitor, P < 0.01. ALDH: aldehyde dehydrogenase; CD: cluster of differentiation; FEZF1-AS1: FEZ family zinc finger 1 antisense RNA 1; GC: gastric cancer; GCSC: gastric cancer stem cell; HMGA2: high-mobility group AT-hook 2; Nanog: nanog homeobox; Oct: octamer-binding transcription factor.

Figure 7.

FEZF1-AS1 promoted GCSCs progression via sponging miR-363-3p. (A) The effect of miR-363-3p inhibitor and si-FEZF1-AS1 on cell viability of GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected by CCK8. *, ** represent si-FEZF1-AS1 versus si-NC, P < 0.05, P < 0.01. ## represents si-FEZF1-AS1 versus si-FEZF1-AS1 + miR-363-3p inhibitor, P < 0.01. (B) The effect of miR-363-3p inhibitor and si-FEZF1-AS1 on cell proliferation of GSCSs (ALDH+ MGC-803 and MKN-45 cells) was determined by colony formation assay. *** represents si-FEZF1-AS1 versus si-NC, P < 0.001. ## represents si-FEZF1-AS1 versus si-FEZF1-AS1 + miR-363-3p inhibitor, P < 0.01. (C) The effect of miR-363-3p inhibitor and si-FEZF1-AS1 on cell migration of GSCSs (ALDH+ MGC-803 and MKN-45 cells) was examined by wound healing assay. *, *** represent si-FEZF1-AS1 versus si-NC, P < 0.05, P < 0.001. ### represents si-FEZF1-AS1 versus si-FEZF1-AS1 + miR-363-3p inhibitor, P < 0.001. Scale bars: 100 μm. (D) The effect of miR-363-3p inhibitor and si-FEZF1-AS1 on cell invasion of GSCSs (ALDH+ MGC-803 and MKN-45 cells) was detected by transwell assay. *** represents si-FEZF1-AS1 versus si-NC, P < 0.001. ## represents si-FEZF1-AS1 versus si-FEZF1-AS1 + miR-363-3p inhibitor, P < 0.01. ALDH: aldehyde dehydrogenase; FEZF1-AS1: FEZ family zinc finger 1 antisense RNA 1; GCSC: gastric cancer stem cell.

FEZF1-AS1 Knockdown Suppressed Xenograft Tumor Growth

We inoculated nude mice with ALDH+ MGC-803 cells transfected with sh-FEZF1-AS1 to evaluate the in vivo effects of FEZF1-AS1 on GCSCs. Downregulation of FEZF1-AS1 in tumor tissues of mice injected with sh-FEZF1-AS1–transfected MGC-803 cells was shown in Fig. 8A. Moreover, miR-363-3p expression in tumor was induced by sh-FEZF1-AS1 (Fig. 8B), while the expression of HMGA2 was inhibited by sh-FEZF1-AS1 (Fig. 8C), which are consistent with the in vitro results. FEZF1-AS1 knockdown suppressed tumor growth, with reduction in tumor volume and weight (Fig. 8D). H&E staining and immunohistochemistry showed that downregulation of FEZF1-AS1 decreased HMGA2, ALDH1, and Ki-67 expression (Fig. 8E) in the xenograft tumor tissues. Moreover, western blot analysis indicated that sh-FEZF1-AS1 decreased the expression of HMGA2, ALDH1, CD133, Nanog, SOX2, Oct4, and N-cadherin, while increased E-cadherin, which were consistent with the in vitro results (Fig. 8F).

Figure 8.

FEZF1-AS1 knockdown suppressed xenograft tumor growth. (A) The expression level of FEZF1-AS1 in xenograft tumor mice injected with sh-FEZF1-AS1 transfected cells was examined by qRT-PCR. *** represents sh-FEZF1-AS1 versus. sh-NC, P < 0.001. (B) The effect of downregulation of FEZF1-AS1 on expression of miR-363-3p in xenograft tumor mice was detected by qRT-PCR. ** represents sh-FEZF1-AS1 versus sh-NC, P < 0.01. (C) The effect of sh-FEZF1-AS1 on mRNA expression of HMGA2 in xenograft tumor mice was examined by qRT-PCR. ** represents sh-FEZF1-AS1 versus sh-NC, P < 0.01. (D) The images of tumors in xenograft tumor mice inoculated with cells transfected with sh-FEZF1-AS1 or sh-NC were acquired. The tumor volume and weight in xenograft tumor mice injected with sh-FEZF1-AS1 or sh-NC were calculated and quantified. **, *** represent sh-FEZF1-AS1 versus sh-NC, P < 0.01, P < 0.001. (E) Serial sections of tumor tissue in xenograft tumor mice were used in H&E staining for orientation. Immunohistochemistry staining was performed to determine the expression of HMGA2, ALDH1, and Ki-67 in tumor tissue sections. Black bar: 200 μm. (F) The effect of sh-FEZF1-AS1 on protein expression of HMGA2, ALDH1, CD133, Nanog, SOX2, Oct4, E-cadherin and N-cadherin in xenograft tumor mice was detected by western blot (upper panel) and the protein expression was quantified (lower panel). *, **, *** represents sh-FEZF1-AS1 vs. sh-NC, P < 0.05, P < 0.01, P < 0.001. ALDH: aldehyde dehydrogenase; CD: xxx; FEZF1-AS1: FEZ family zinc finger 1 antisense RNA 1; H&E: hematoxylin and eosin; HMGA2: high-mobility group AT-hook 2; mRNA: messenger ribonucleic acid; Nanog: nanog homeobox; Oct: octamer-binding transcription factor; qRT-PCR: quantitative reverse transcription PCR; SOX: sex-determining region Y-Box transcription factor.

Discussion

GC occurs most commonly in East Asia, including China, with a global 5-year survival rate of less than 10%[32]. Numerous lncRNAs have shown emerging significance in regulation of complex diseases[33], especially GC[34-36]. LncRNA homeobox DNA-binding antisense growth‐associated long noncoding RNA (HAGLROS)[37], and homeobox A11 antisense RNA (HOXA11-AS)[38] contribute to GC progression, while maternally expressed gene (MEG)3 inhibits GC progression[39]. In addition, upregulated lncRNA FEZF1-AS1 in GC specimens promoted tumorigenesis and predicted poor prognosis of GC[23,40]. In addition to the “oncogene” role of FEZF1-AS1 on GC, our study provided evidence for new concept for FEZF1-AS1 as miR-363-3p sponge and molecular regulator of HMGA2, which are the key cellular functions relevant to stemness of GC.

CSCs are involved in the tumor development[41,42]. However, the role of lncRNAs in GCSCs is still less known, and only a few lncRNAs have been characterized in GCSCs. Metastasis-associated in colon cancer-1 antisense RNA (MACC1-AS1) could promote stemness of GC via fatty acid oxidation[43]. Knockdown of lncRNA testis-associated highly conserved oncogenic long non-coding RNA (THOR) inhibited the stemness of GC[44]. This study first revealed that FEZF1-AS1 was upregulated in both GC tissues and cell lines, consistent with previous studies[23,40]. We then selected ALDH+ cells from GC cell lines to explore the molecular mechanism of FEZF1-AS1 on GCSC. CD133 and ALDH expressions are always positively correlated with malignancy of GC[45], and were therefore considered as GCSC markers[46,47]. Thereafter, other GCSC markers, such as Nanog, SOX2, and Oct4, have been widely used to identify GCSCs[48-50]. In this study, loss-of-function assays were performed and results revealed that FEZF1-AS1 knockdown suppressed spheroid-forming ability of ALDH+ cells (MGC-803 and MKN-45) and the ALDH+/CD133+ rate, indicating suppressive ability of FEZF1-AS1 knockdown on stemness of GCs. The downregulation of stem factors (Nanog, SOX2, and Oct4) also indicated that the FEZF1-AS1 knockdown demonstrated inhibition effect on stemness of GCs.

As previously reported, long intervening noncoding RNA (lncRNA) FEZF1-AS1 promoted tumorigenesis of GC[23,40]. We also found that FEZF1-AS1 knockdown inhibited viability, proliferation, migration, and invasion of GCSCs in vitro. Moreover, EMT is important for metastasis of cancer cells[51], with downregulation of E-cadherin and upregulation of N-cadherin[52]. LncRNAs mitotically associated long non coding RNA (MANCR)[53], activated by TGF-β (ATB)[54], highly up-regulated in liver cancer (HULC)[55], Linc00152[56], and homeobox antisense intergenic RNA (HOTAIR)[57] could downregulate epithelial genes and upregulate mesenchymal genes to promote EMT and GC metastasis. This study showed that FEZF1-AS1 knockdown reversed EMT and suppressed GCSC metastasis, which was in line with the effect of FEZF1-AS1 in EMT of nonsmall cell lung cancer metastasis[24]. CSCs could promote cancer progression in surgical resection or post chemoradiotherapy[58]. Here, our results indicated that FEZF1-AS1 supported GCSC properties via positively regulating the stemness of GCs, suggesting a potential therapeutic target for GC[14].

Subcellular localization of FEZF1-AS1, as well as the colocalization between FEZF1-AS1 and miR-363-3p, suggested that FEZF1-AS1 mediated GC stemness and GCSC progression via regulation of miR-363-3p. Because previous studies[23,40] did not explore the direct target for FEZF1-AS1, miR-363-3p was found to be a fire-new direct target for FEZF1-AS1 in this study. Downregulated miR-363-3p was observed in GC tissues[59], and enforced that miR-363-3p inhibited GC progression via targeting NOTCH1[28]. Unlike previous studies which showed that FEZF1-AS1 promoted GC tumorigenesis via Wnt pathway[40], and FEZF1-AS1 promoted GC proliferation via lysine specific demethylase (LSD)1-mediated H3K4me2 demethylation[23], we found that knockdown of FEZF1-AS1 suppressed GC tumor growth via HMGA2. However, due to complicated effects of GCSCs on GC, more molecular mechanisms need to be further investigated. Elaborate animal models should be conducted to evaluate the role of FEZF1-AS1 on GCSC.

In conclusion, this study revealed that knockdown of lncRNA FEZF1-AS1 impaired GCSCs properties and inhibited GCSC cells progression via miR-363-3p–mediated HMGA2. These findings suggest potential application of FEZF1-AS1 in the treatment for GC.