Literature DB >> 32607060

LncRNA LINC00261 overexpression suppresses the growth and metastasis of lung cancer via regulating miR-1269a/FOXO1 axis.

Caixia Guo1, Hongmei Shi1, Yuli Shang1, Yafei Zhang1, Jiajia Cui1, Hongtao Yu1.   

Abstract

BACKGROUND: LncRNAs are key regulators in cancer. The current study explored the role of lncRNA LINC00261 (LINC00261) in lung cancer (LC).
METHODS: Expression of LINC00261 in LC tissues and cells was determined by quantitative real-time polymerase chain reaction (qRT-PCR). Pearson's Chi square test and Kaplan-Meier analysis were performed to evaluate the correlations between LINC00261 expression and clinical characteristics, and overall survival time. A549 and SPC-A1 cells were transfected with LINC00261 overexpression plasmid, cell viability, cell number, and apoptosis were detected by CCK-8 assay, colony formation, and flow cytometry. Moreover, wound-healing and transwell assay were performed to detect cell metastasis and invasion. Expressions of proteins related to cell proliferation and metastasis were determined by Western blot. Xenograft was constructed, and tumor size and weight were measured and the effects of LINC00261 overexpression on tumor growth were detected. Bioinformatics analysis, dual-luciferase reporter assay, qRT-PCR, correlation analysis, and functional rescue experiments were conducted on clinical cases and LC cells to explore the molecular mechanism of LINC00261 in LC.
RESULTS: In LC, LINC00261 expression was down-regulated, and was associated with more advanced TNM stage, metastasis and a shorter survival time. LINC00261 overexpression inhibited the growth and metastasis of LC cells in vitro and tumor growth in vivo. Furthermore, miR-1269a directly interacted with LINC00261 and FOXO1. The expressions of miR-1269a and FOXO1 were dysregulated by LINC00261 in LC. Additionally, miR-1269a promoted the progression of LC through targeting FOXO1.
CONCLUSIONS: Down-regulation of LINC00261 expression has a prognostic value in LC, and overexpression LINC00261 inhibits LC progression via targeting miR-1269a/FOXO1 axis.
© The Author(s) 2020.

Entities:  

Keywords:  FOXO1; LINC00261; Lung cancer; Metastasis; miR-1269a

Year:  2020        PMID: 32607060      PMCID: PMC7318380          DOI: 10.1186/s12935-020-01332-6

Source DB:  PubMed          Journal:  Cancer Cell Int        ISSN: 1475-2867            Impact factor:   5.722


Background

Lung cancer (LC) has become the first leading cause of cancer-associated mortality worldwide [1]. LC can be divided into small-cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), and the main histologic types of NSCLC are squamous cell carcinoma and adenocarcinoma [2]. Molecular-targeted therapies have been widely used in cancer treatment [3, 4]. However, due to lack of a comprehensive understanding for cancer progression, available molecular targets are currently limited. Long non-coding RNAs (LncRNAs) are a class of RNA transcripts with more than 200 nt in length, and do not encode proteins [5]. Study showed that lncRNAs are potential pathway-regulators during cancer development [6]. Compared with normal tissues, large-scale RNA sequencings have demonstrated that several lncRNAs are dysregulated in tumor tissues [7], including in laryngeal squamous cell carcinoma [8], colorectal cancers [9], and hepatocellular carcinoma, via regulating the expressions of miRNAs [10] [11]. In addition, lncRNAs are also potential prognostic markers for patients with cancer such as gastric cancer [12]. A systematic review and meta-analysis show that multiple lncRNAs are strongly associated with prognosis of some cancers [13]. High expression of lncRNA SChLAP1 is a significant prognostic maker predictive of metastatic progression of prostate cancer [14]. Taken together, lncRNAs play key roles in cancer progression and should be further investigated. In LC, lncRNAs are involved in cell growth, apoptosis and metastasis at epigenetic, transcriptional, or post-transcriptional levels [15]. Study found that LINC00261 is a crucial tumor suppressor in various malignant tumors, including in colon cancer [16], choriocarcinoma [17] and endometrial carcinoma [18]. LINC00261 also suppresses growth and metastasis via suppressing epithelial-mesenchymal transition (EMT) and Wnt signaling in non-small cell lung cancer [19, 20]. However, the role of LINC00261 and its molecular mechanism in LC are not fully understood. The current study aimed to explore the expression and prognostic value of LINC00261, and focused on the role and potential molecular mechanism of LINC00261 in LC, hoping to provide a new potential therapeutic target for LC treatment.

Methods

LC samples and clinical information collection

LC and adjacent normal lung tissue samples were obtained from 78 LC patients who received surgical resection between July 2015 and July 2017 in the Henan Provincial Chest Hospital, and all the samples were stored at − 80 °C. This study was approved by the Ethics Committee of Henan Provincial Chest Hospital. The clinical features of all the participants, including gender, age, TNM stage, lymph node metastasis, histological type, distant metastasis and tumor size, were collected from the hospital. The relationships between LINC00261 expression and clinic features in LC patients were shown in Table 1. The relatively high or low expression level of LINC00261 was defined according to the median level of the expression.
Table 1

The relationship between LINC00261 expression levels in cancer tissues and clinical pathological factors of patients with lung cancer

Clinical featuresTotal numberLINC00261 expressionP value
High (n = 36)Low (n = 42)
Gender
 Male5122290.463
 Female271413
Age
 < 603416180.888
 ≥ 60442024
TNM stage
 I–II4927220.039
 III–IV29920
Lymph node metastasis
 Yes288200.020
 No502822
Histological type
 SCC4420240.888
 AD341618
Distant metastasis
 Yes299200.039
 No492722
Tumor size (cm)
 < 34019210.807
 ≥ 3381721
The relationship between LINC00261 expression levels in cancer tissues and clinical pathological factors of patients with lung cancer

Cell culture

The normal human bronchial epithelial cells (BEAS-2B, CBP60577), LC lines (A549 (CBP60084), NCI-H1299 (CBP60053), NCI-H23 (CBP60132), SPC-A1 (CBP60153)) were purchased from Cobioer Co., Ltd. (China). The LC cell line L78 was obtained from Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. All the cells were cultured in RPMI-1640 medium (61870044, ThermoFisher, USA) containing 10% FBS (16140071, ThermoFisher, USA) at 37 °C with 5% CO2.

RNA isolation and qRT-PCR

Chloroform and isopropanol methods were used to isolate total RNAs from the tissues and cells. NanoDrop 2000 (ND-2000-GL, Thermo Scientific, USA) was used to quantify the RNAs. To determine the levels of LINC00261 and FOXO1, reverse-transcription and qRT-PCR were performed using the PrimeScript™ II 1st Strand cDNA Synthesis Kit (6210B, Takara, Japan), SYBR® Green PCR Master Mix (4312704, ABI, USA) and Bio-Rad CFX 96 Touch Real-Time PCR Detection System (1855196, Bio-Rad, China). GAPDH served as a reference gene. The loop RT primer sequence was 5′-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATA-CGACCCAGTAGC-3′, and used for detecting the expression of miR-1269a. U6 snRNA served as an internal reference gene. Parameters for qRT-PCR were as follows: at 95 °C for 5 min, 40 cycles at 95 °C for 15 s, at 60 °C for 30 s, and at 70 °C for 10 s. The relative expression was calculated by 2−ΔΔCt method. All primers for qRT-PCR were shown in Table 2.
Table 2

The primers used for qRT-PCR

Gene nameThe forward primer (5′–3′)The reversed primer (5′–3′)
LINC00261GTCAGAAGGAAAGGCCGTGATGAGCCGAGATGAACAGGTG
FOXO1TCGTCATAATCTGTCCCTACACACGGCTTCGGCTCTTAGCAAA
GAPDHGCTCTCTGCTCCTCCTGTTCACGACCAAATCCGTTGACTC
miR-1269aGACTGAGCCGTGCTACTGGTGTCGTGGAGTCGGCAATTG
U6 snRNACGCAAGGATGACACGCAAATCGGCAATTGCACTGGATACG
The primers used for qRT-PCR

Cell transfection

For cell transfections, 100 pmol miR-1269a mimic (miR10005923-1-5, Ribobio, China) was added into Opti-MEM medium (31985062, Thermofisher, USA) containing Lipofectamine 2000 (11668019, Thermofisher, USA) and mixed for 20 min at room temperature. Next, the mixture was added into a 6-well cell culture plate to culture the cells (2 × 105 cells/well) at 37 °C with 5% CO2 for 8 h. Then, the medium was replaced by RPMI-1640 containing 10% FBS. After transfection for 24 h, the cells were used for later detection.

Generation of transgenic cell lines

Full-length cDNAs of LINC00261 and FOXO1 (Tsingke Co., Ltd.) were inserted into pCDH-CMV vector (CD513B-1, System Biosciences, USA) and then infected into 293T cells (CBP60439, Cobioer, China) to produce a lentivirus, which was used to infect A549 and SPC-A1 cells (2 × 105 cells/well) in the 6-well plate. After 72 h, the cells were collected to determine the efficiencies of LINC00261 and FOXO1 overexpression. Cells were selected using 2 µg/mL puromycin starting on day 4 after the virus infection. Following assays were carried out 2 weeks after the infection.

CCK-8 assay

After cell incubation, the cells (3000 cells/well) were seeded into a 96-well plate. 10 µL CCK-8 70-CCK801 (MultiSciences, China) was added into each well for 4 h at 37 °C. Then the absorbance value at 490 nm was detected by the SpectraMax plus 384 Microplate Reader (PLUS 384, Molecular Devices, USA). The medium containing only 10 μL CCK-8 reagent served as the blank control, and each group were set up with 9 parallel wells.

Colony formation assay

The cells (1 × 102 cells/well) were seeded into a 6-well plate to be cultured for 7 d, and the medium was changed every 3 d. After the culture, the cells were fixed by paraformaldehyde at room temperature for 30 s, stained by 0.1% crystal violet solution (548-62-9, Aladdin, China) at room temperature for 30 min, and washed by PBS twice. Next, the cells were observed under a microscope (TS100, Nikon, Japan). Colony formation number and relative colony formation were calculated from 10 randomly selected fields under a microscope.

Flow cytometry

The cells (2 × 105 cells/well) were grown into a 6-well plate, cultured for 24 h, and then treated by 500 µL Trypsin (25300054, Thermofisher, USA) at 37 °C for 1 min. The cells were collected by centrifuging at 500×g, 4 °C for 5 min. To determine cell apoptosis, the cells were resuspended in 300 μL Annexin-V kit (70-AP101-100-AVF, MultiSciences, China) binding buffer, and then mixed with 5 μL Annexin-V-FITC solution at RT for 15 min. The nuclei were stained by 5 µL PI for 5 min, and then another 200 μL binding buffer was added into the cells. For cell cycle arrest analysis, the cells were fixed in 70% ethanol at 4 °C overnight and stained by PI/RNase A mixture at 37 °C for 30 min in the dark. Finally, the cell cycle was analyzed by flow cytometer (342973, BD Biosciences, USA). FACSCalibur flow cytometer (342973, BD Biosciences, USA), and BD FACSCanto™ system software v2.4 (646602, BD Biosciences, USA) were used to detect the cell apoptosis and cell cycle.

Wound healing

A wound was created by using a 10 μL pipette tip after the cells were grown to 100% confluence. The cells were then starved and cultured for 48 h. The scratch area was measured from 3 fields in each group under a microscope (TS100, Nikon, Japan) at 0 h and 48 h.

Transwell assay

The cells (2 × 103 cells/well) were seeded in serum-free media contained the upper chamber of transwell plate (3428, Corning, USA) pre-coated with 40 μL Matrigel, while 600 μL normal medium was added into the lower chamber. After incubation for 24 h, the cells invaded from the upper chamber into the lower were fixed by methanol and stained by 0.1% crystal violet (548-62-9, Aladdin, China) at room temperature for 30 min. Then, 10 fields under a microscope were randomly selected to count invaded cells. The experiments were performed in triplicate.

Western blot analysis

Total proteins were isolated from the cells on ice using the lysis buffer (89901, Thermo Scientific, USA), and the protein concentration was measured using the BCA Protein Assay kit (23225, ThermoFisher, USA). The proteins were separated by 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto a PVDF membrane. The membrane was then blocked by 5% non-fat milk at RT for 10 min, and exposed to the following primary antibodies: Anti-Ki-67 (359 kD, 1:5000, ab92742, Abcam, UK), Anti-PCNA (29kD, 1:1000, ab18197, Abcam, UK), Anti-MMP-3 (54kD, 1:1000, ab53015, Abcam, UK), MMP-9 (95kD, 1:1000, ab73734, Abcam, UK), Anti-GAPDH (36 kD, 1:5000, ab8245, Abcam, UK) at 4 °C for 12 h. Anti-mouse HRP secondary antibody (1:2000, ab6728, Abcam, UK) was incubated with the membrane at RT for 2 h for detection of GAPDH. Anti-rabbit HRP secondary antibody (1:2000, ab97051, Abcam, UK) was used for detection of other proteins. Then, the membrane was treated by chemiluminescence solution (WBKLS0100, Millipore, USA) at room temperature in the dark for 1 min. The signals were finally developed by using SignalFire™ ECL reagent (6883, CST, USA).

Dual-luciferase reporter assay

StarBase (http://starbase.sysu.edu.cn/) was used to predict the interaction between LINC00261 and miRNA, and the interaction between miR-1269a and its target mRNA was predicted by Targetscan7.2 (http://www.targetscan.org/vert_72/). Potential binding site of LINC00261 (LINC00261-WT, 5′-CAAGAGGCAATGGTCCCAGTCCAA-3′), mutation sequence (LINC00261-MUT, 5′-CATCATCGATGCCTGCGTCAGGTA-3′), potential binding site of FOXO1 3′UTR (FOXO1-WT, 5′-AGGAACTGAGAGAAGCAGTCCAA-3′) and the mutation sequence (FOXO1-MUT, 5′-AGGAACTGAGAGAAGGTCAGGTA-3′) were inserted into dual-luciferase reporter vector (pmirGLO, E1330, Promega, USA). Those reporter plasmids were then transfected into the cells with miR-1269a mimic. Cells transfected with reporter plasmid only served as controls. After culture for 24 h at 37 °C, the luciferase activity of cells was determined by dual-luciferase assay system (E1910, Promega, USA) and Microplate Luminometer (11300010, Berthold, Germany). The firefly luciferase activity was normalized to that of renilla luciferase activity.

Xenograft Assay

We purchased 12 8-week-old male BALB/C nude mice (weighting 20 g–25 g) from Vitalriver Corporation (China). The mice were kept in the Typical SPF Laboratory Animal room at 23 °C and provided with free access to sterilized food and water. The cells (1 × 106) stably infected by pCDH-CMV empty vector (NC) or pCDH-CMV-LINC00261 were resuspended in PBS/matrigel mixture on ice and then subcutaneously injected into the nude mice (with 6 mice in each group). The tumor volumes were measured at day 5, 10, 15, 20, 25 and 30. Finally, all the mice were sacrificed and the tumors were weighted. Animal experiments were approved by the Institutional Animal Care and Use Committee of Henan Provincial Chest Hospital.

Immunohistochemistry (IHC)

FOXO1 primary antibody (1:500; ab70382; Abcam, UK) was added to the cells at 4 °C overnight. Horseradish peroxidase-labeled anti-rabbit IgG H&L secondary antibody (1:2000; ab205718; Abcam, UK) was then added to the cells and incubated at 37 °C for 30 min. DAB developer (Biyuntian Biotechnology Co., Ltd.) was used to develop the brown-yellow positive color. The tumor sections were counterstained by Hematoxylin for 3 min, differentiated with 1% hydrochloric acid alcohol, made transparent by xylene, and fixed with gum seal. The sections were then observed under a light microscope (Olympus, 100× and 200× Magnification) and photographed.

Data analysis

The statistics were analyzed using Graphpad Prism 5.02 software (La Jolla, CA, USA). The data are shown as mean ± standard deviation. Correlations of LINC00261 expression and clinic pathological characters were analyzed by Pearson’s Chi square test. Kaplan–Meier analysis was performed to plot the overall survival curves. The differences among groups were analyzed by one-way ANOVA, followed by Tukey’s post hoc test. Gene expression differences in LC and adjacent normal lung tissues were analyzed by paired t-test. Spearman’s correlation analysis was performed to evaluate the expression correlations among LINC00261, miR-1269a and FOXO1. P < 0.05 was defined as a significant difference.

Results

LINC00261 was down-regulated in LC tissues and cells and was associated with a poor prognosis

In this study, we measured the level of LINC00261 in LC tissues and adjacent normal lung tissues. RT-PCR result showed that LINC00261 expression was down-regulated in LC tissues (P < 0.001, Fig. 1a) and in A549, H1299, H23, SPC-A1 and L78 cells, especially in A549 and SPC-A1 cells. Thus, A549 and SPC-A1 cells were used in further study (P < 0.001, Fig. 1c). In addition, the Kaplan–Meier analysis revealed that low expression LINC00261 was associated with a shorter overall survival time (P < 0.05, Fig. 1b). Pearson’s Chi square test indicated that the expression of LINC00261 was correlated with TNM stage (P = 0.039), lymph node metastasis (P = 0.020) and distant metastasis (P = 0.039) in LC patients (Table 1).
Fig. 1

LINC00261 expression was down-regulated in LC tissues and cells and was associated with overall survival. a The level of LINC00261 in LC tissues (LC, n = 78) and adjacent normal lung tissues (normal, n = 78) determined by qRT-PCR. b The Kaplan–Meier analysis of LINC00261 in relation to overall survival rate in patients with LC. c The level of LINC00261 in BEAS-2B cells and A549, H1299, H23, SPC-A1 and L78 cells. ##P < 0.001 vs. BEAS-2B. All experiments were conducted independently in triplicate

LINC00261 expression was down-regulated in LC tissues and cells and was associated with overall survival. a The level of LINC00261 in LC tissues (LC, n = 78) and adjacent normal lung tissues (normal, n = 78) determined by qRT-PCR. b The Kaplan–Meier analysis of LINC00261 in relation to overall survival rate in patients with LC. c The level of LINC00261 in BEAS-2B cells and A549, H1299, H23, SPC-A1 and L78 cells. ##P < 0.001 vs. BEAS-2B. All experiments were conducted independently in triplicate

LINC00261 overexpression inhibited the growth, metastasis, and promoted apoptosis and cell cycle arrest of LC cells

To investigate the role of LINC00261 in LC, LINC00261 was constitutively overexpressed in A549 and SPC-A1 cells. QRT-PCR results showed that the expression of LINC00261 in A549 and SPC-A1 cells were increased by LINC00261 overexpression 72 h after the infection (P < 0.001, Fig. 2a, b). Two weeks after the infection, corresponding assays were performed to determine effects of LINC00261 overexpression on cell viability, colony formation, cell apoptosis and cell cycle arrest. CCK-8 assay showed that overexpressed LINC00261 suppressed the viabilities of A549 and SPC-A1 cells (P < 0.05, Fig. 2c, d), and inhibited colony formation of A549 and SPC-A1 cells (P < 0.001, Fig. 2e–g). Ki-67 and PCNA (Proliferating Cell Nuclear Antigen) were cell proliferation-associated markers, and the effects of LINC00261 overexpression on Ki-67 and PCNA expressions were explored by Western blot, the results indicated that LINC00261 overexpression significantly reduced the levels of Ki-67 and PCNA in A549 and SPC-A1 cells (P < 0.001, Fig. 2h–k). Furthermore, flow cytometry demonstrated that LINC00261 overexpression promoted apoptosis (P < 0.001, Fig. 3a–c) and cell cycle arrest in G1 phase (P < 0.001, Fig. 3d–f) of A549 and SPC-A1 cells. Additionally, the migration and invasion of A549 and SPC-A1 cells upon constitutive LINC00261 overexpression were determined, and the results showed that LINC00261 overexpression suppressed the migration and invasion of LC cells (All P < 0.001, Fig. 4a–f). The expressions of metastasis-associated markers (MMP-3 and MMP-9) were also measured by Western blot, and we found that LINC00261 overexpression inhibited the expressions of MMP-3 and MMP-9 in LC cells (All P < 0.001, Fig. 4g–j).
Fig. 2

LINC00261 overexpression suppressed the growth of LC cells. a, b The efficiency of LINC00261 overexpression in A549 (a) and SPC-A1 (b) was measured by qRT-PCR, 72 h after infection. (c, d) The viabilities of A549 (c) and SPC-A1 (d) cells after infection for 24 h, 48 h and 72 h were measured by CCK-8 assay. (e–g) The colony formation abilities of A549 (f) and SPC-A1 (g) cells after infection were determined by colony formation assay. (h–k) Cells were harvested 2 weeks after infection and the levels of Ki-67, PCNA in A549 (h–i) and SPC-A1 (j, k) cells were determined by Western blot. GAPDH served as an internal control. *P < 0.05, **P < 0.001 vs. blank, #P < 0.05, ##P < 0.001 vs. NC. Blank: untreated cells. NC: pCDH-CMV empty plasmid. LINC00261: pCDH-CMV- LINC00261 overexpression plasmid. All experiments repeated independently in triplicate

Fig. 3

LINC00261 overexpression promoted apoptosis and cell cycle arrest of LC cells. a–c The apoptosis rates of A549 and SPC-A1 cells were determined by flow cytometry. d–f The cell cycle of A549 and SPC-A1 cells was determined by flow cytometry. **P < 0.001 vs. blank, ##P < 0.001 vs. NC. Blank: cells treated by transfection regent only. NC: pCDH-CMV empty plasmid. LINC00261: pCDH-CMV- LINC00261 overexpression plasmid. All experiments repeated independently in triplicate

Fig. 4

LINC00261 overexpression inhibited the migration, invasion and related protein expressions in LC cells. a–c The migration of A549 and SPC-A1 cells was determined by wound-healing assay a. Magnification: 100×. The migration of A549 and SPC-A1 cells was calculated (b, c). d–f The invasion of A549 and SPC-A1 cells was calculated (d, e). The invaded cells (f) were subjected to transwell assay and observed under a microscope (Magnification: 200x). g–j The expression levels of MMP-3 and MMP-9 were determined by Western blot. GAPDH served as an internal control. **P < 0.001 vs. blank, ##P < 0.001 vs NC. Blank: cells treated with transfection regent only. NC: pCDH-CMV empty plasmid. LINC00261: pCDH-CMV-LINC00261 overexpression plasmid. All experiments repeated independently in triplicate

LINC00261 overexpression suppressed the growth of LC cells. a, b The efficiency of LINC00261 overexpression in A549 (a) and SPC-A1 (b) was measured by qRT-PCR, 72 h after infection. (c, d) The viabilities of A549 (c) and SPC-A1 (d) cells after infection for 24 h, 48 h and 72 h were measured by CCK-8 assay. (e–g) The colony formation abilities of A549 (f) and SPC-A1 (g) cells after infection were determined by colony formation assay. (h–k) Cells were harvested 2 weeks after infection and the levels of Ki-67, PCNA in A549 (h–i) and SPC-A1 (j, k) cells were determined by Western blot. GAPDH served as an internal control. *P < 0.05, **P < 0.001 vs. blank, #P < 0.05, ##P < 0.001 vs. NC. Blank: untreated cells. NC: pCDH-CMV empty plasmid. LINC00261: pCDH-CMV- LINC00261 overexpression plasmid. All experiments repeated independently in triplicate LINC00261 overexpression promoted apoptosis and cell cycle arrest of LC cells. a–c The apoptosis rates of A549 and SPC-A1 cells were determined by flow cytometry. d–f The cell cycle of A549 and SPC-A1 cells was determined by flow cytometry. **P < 0.001 vs. blank, ##P < 0.001 vs. NC. Blank: cells treated by transfection regent only. NC: pCDH-CMV empty plasmid. LINC00261: pCDH-CMV- LINC00261 overexpression plasmid. All experiments repeated independently in triplicate LINC00261 overexpression inhibited the migration, invasion and related protein expressions in LC cells. a–c The migration of A549 and SPC-A1 cells was determined by wound-healing assay a. Magnification: 100×. The migration of A549 and SPC-A1 cells was calculated (b, c). d–f The invasion of A549 and SPC-A1 cells was calculated (d, e). The invaded cells (f) were subjected to transwell assay and observed under a microscope (Magnification: 200x). g–j The expression levels of MMP-3 and MMP-9 were determined by Western blot. GAPDH served as an internal control. **P < 0.001 vs. blank, ##P < 0.001 vs NC. Blank: cells treated with transfection regent only. NC: pCDH-CMV empty plasmid. LINC00261: pCDH-CMV-LINC00261 overexpression plasmid. All experiments repeated independently in triplicate

LINC00261 overexpression inhibited the growth of LC cells in vivo

Furthermore, the function of LINC00261 in LC in vivo was explored. The xenograft was established in the mice by injecting A549 or SPC-A1 cells (constitutively overexpressing LINC00261 or empty vector control) via the ventral side into BALB/c nude mice. The tumors in the LINC00261 overexpression group were significantly smaller and lighter than those in NC group (P < 0.001, Fig. 5a–e). IHC showed that the expression levels of FOXO1 were increased in LINC00261 overexpression group (Fig. 5f–i), while RT-qPCR showed that the expression of miR-1269a was significantly decreased in LINC00261 overexpression group (Fig. 5j–k).
Fig. 5

LINC00261 overexpression inhibited tumor growth in vivo. a, b The xenograft tumor volume in nude mice from LINC00261 overexpression group (n = 3) and NC group (3 mice in each group). c Photographs of tumors at day 30 after LINC00261 transfected A549 and SPC-A1 cells injected into nude mice (3 mice in each group). d, e The tumor weight g in nude mice from LINC00261 overexpression group (n = 3) and NC group (3 mice in each group). f–i The expression levels of FOXO1 were increased in LINC00261 overexpression group, which was detected by IHC. j–k The expression levels of miR-1269a were significantly decreased in LINC00261 overexpression group, which was detected by RT-qPCR. **P < 0.001 vs. NC. NC: pCDH-CMV empty plasmid. LINC00261: pCDH-CMV-LINC00261 overexpression plasmid. All experiments repeated independently in triplicate

LINC00261 overexpression inhibited tumor growth in vivo. a, b The xenograft tumor volume in nude mice from LINC00261 overexpression group (n = 3) and NC group (3 mice in each group). c Photographs of tumors at day 30 after LINC00261 transfected A549 and SPC-A1 cells injected into nude mice (3 mice in each group). d, e The tumor weight g in nude mice from LINC00261 overexpression group (n = 3) and NC group (3 mice in each group). f–i The expression levels of FOXO1 were increased in LINC00261 overexpression group, which was detected by IHC. j–k The expression levels of miR-1269a were significantly decreased in LINC00261 overexpression group, which was detected by RT-qPCR. **P < 0.001 vs. NC. NC: pCDH-CMV empty plasmid. LINC00261: pCDH-CMV-LINC00261 overexpression plasmid. All experiments repeated independently in triplicate

MiR-1269a directly interacted with LINC00261 and FOXO1

StarBase predicted that LINC00261 might function as a sponge for miR-1269a (Fig. 6a). Moreover, dual-luciferase reporter assays demonstrated that miR-1269a mimic decreased luciferase activities of A549 and SPC-A1 cells transfected with LINC00261-WT luciferase reporter plasmid, while the luciferase activities of A549 and SPC-A1 cells transfected with LINC00261-WT luciferase did not change (Fig. 6b–c). Furthermore, Targetscan7.2 predicted a potential binding site of miR-1269a at position 65–72 of FOXO1 3′UTR (Fig. 6d), and dual-luciferase reporter assays confirmed that miR-1269a mimic suppressed the luciferase activity of FOXO1-WT reporter plasmid, but it did not change the luciferase activity of FOXO1-MUT reporter plasmid (Fig. 6e–f).
Fig. 6

MiR-1269a targeted FOXO1 mRNA and was sponged by LINC00261. a A potential binding site of miR-1269a at LINC00261 predicted by starBase. b, c The relative luciferase activities of A549 and SPC-A1 cells were determined by dual- luciferase reporter assays. d A potential binding site of miR-1269a at position 65–72 of FOXO1 3′UTR predicted by Targetscan7.2. e, f The relative luciferase activities of A549 and SPC-A1 cells were determined by dual-luciferase reporter assays. **P < 0.001 vs. blank. LINC00261-WT: LINC00261-WT luciferase reporter plasmid. LINC00261-MUT: LINC00261-MUT luciferase reporter plasmid. FOXO1-WT: FOXO1 3′UTR-WT luciferase reporter plasmid. FOXO1-MUT: FOXO1 3′UTR -MUT luciferase reporter plasmid. All experiments repeated independently in triplicate

MiR-1269a targeted FOXO1 mRNA and was sponged by LINC00261. a A potential binding site of miR-1269a at LINC00261 predicted by starBase. b, c The relative luciferase activities of A549 and SPC-A1 cells were determined by dual- luciferase reporter assays. d A potential binding site of miR-1269a at position 65–72 of FOXO1 3′UTR predicted by Targetscan7.2. e, f The relative luciferase activities of A549 and SPC-A1 cells were determined by dual-luciferase reporter assays. **P < 0.001 vs. blank. LINC00261-WT: LINC00261-WT luciferase reporter plasmid. LINC00261-MUT: LINC00261-MUT luciferase reporter plasmid. FOXO1-WT: FOXO1 3′UTR-WT luciferase reporter plasmid. FOXO1-MUT: FOXO1 3′UTR -MUT luciferase reporter plasmid. All experiments repeated independently in triplicate QRT-PCR and spearman correlation analysis were further performed to determine the expressions of LINC00261, miR-1269a and FOXO1 in LC. The results showed that LINC00261 overexpression reduced the expression of miR-1269a but increased that of FOXO1 in LC cells (Fig. 7a, b). The expression level of miR-1269a was up-regulated in LC tissues, but that of FOXO1 was down-regulated in LC tissues (Fig. 7c, d). The spearman correlation analysis demonstrated that the expression of LINC00261 was negatively correlated with miR-1269a (r = − 0.595, P < 0.001), similarly, the expression of FOXO1 was negatively correlated with miR-1269a (r = − 0.558, P < 0.001), and the expression of LINC00261 was negatively correlated with FOXO1 (r = − 0.442, P < 0.001).
Fig. 7

The expression levels and correlation analysis of miR-1269a and FOXO1 in LC tissues and cells. a, b The expression levels of miR-1269a and FOXO1 in A549 (a) and SPC-A1 (b) cells measured by qRT-PCR. **P < 0.001 vs. blank, #P < 0.05, ##P < 0.001vs NC. c, d The expression levels of miR-1269a (c) and FOXO1 (d) in LC tissues (LC, n = 78) and adjacent normal lung tissues (normal, n = 78) determined by qRT-PCR. **P < 0.001 vs. normal.e–g Spearman correlation analysis was performed on LINC00261 and miR-1269a (E, n = 78, r = − 0.595, P < 0.001), FOXO1 and miR-1269a (F, n = 78, r = − 0.558, P < 0.001), LINC00261 and FOXO1 (G, n = 78, r = − 0.442, P < 0.001). Blank: cells treated with transfection regent only. NC, pCDH-CMV empty plasmid. LINC00261, pCDH-CMV-LINC00261 overexpression plasmid. LC, lung cancer. All experiments repeated independently in triplicate

The expression levels and correlation analysis of miR-1269a and FOXO1 in LC tissues and cells. a, b The expression levels of miR-1269a and FOXO1 in A549 (a) and SPC-A1 (b) cells measured by qRT-PCR. **P < 0.001 vs. blank, #P < 0.05, ##P < 0.001vs NC. c, d The expression levels of miR-1269a (c) and FOXO1 (d) in LC tissues (LC, n = 78) and adjacent normal lung tissues (normal, n = 78) determined by qRT-PCR. **P < 0.001 vs. normal.e–g Spearman correlation analysis was performed on LINC00261 and miR-1269a (E, n = 78, r = − 0.595, P < 0.001), FOXO1 and miR-1269a (F, n = 78, r = − 0.558, P < 0.001), LINC00261 and FOXO1 (G, n = 78, r = − 0.442, P < 0.001). Blank: cells treated with transfection regent only. NC, pCDH-CMV empty plasmid. LINC00261, pCDH-CMV-LINC00261 overexpression plasmid. LC, lung cancer. All experiments repeated independently in triplicate

MiR-1269a promoted LC progression through targeting FOXO1

To confirm the regulative relation between miR-1269a and FOXO1 in LC, A549 and SPC-A1 cells were co-transfected with FOXO1 and miR-1269a, and the results were compared with those transfected with FOXO1, miR-1269a or empty vector. The expression of FOXO1 was increased by FOXO1 overexpression but reduced by miR-1269a mimic, and co-transfection with FOXO1 and miR-1269a could reverse these effects (P < 0.001, Fig. 8a, b). Furthermore, the viability, colony formation, apoptosis, cell cycle, migration and invasion of A549 and SPC-A1 cells were determined. The results indicated that miR-1269a promoted cell growth, migration and invasion and suppressed apoptosis and cell cycle arrest, but FOXO1 overexpression reversed effects on LC cells. More importantly, co-incubation of FOXO1 overexpression plasmid and miR-1269a mimic could neutralize the effects of FOXO1 and miR-1269a (Figs. 8, 9, 10).
Fig. 8

MiR-1269a promoted the growth of LC cells through targeting FOXO1. a, b The level of FOXO1 in A549 (a) and SPC-A1 (b) cells was measured by qRT-PCR. c, d The viabilities of A549 (c) and SPC-A1 (d) cells after infection were measured by CCK-8 assay. e–g The colony formation abilities of A549 (f) and SPC-A1 (g) cells after infection were determined by colony formation assay. *P < 0.05, **P < 0.001, vs Vector. #P < 0.05, ##P < 0.05 vs. FOXO1. ^P < 0.05, ^^P < 0.05 vs. mimic. Vector: pCDH-CMV empty plasmid. FOXO1: pCDH-CMV-FOXO1 overexpression plasmid. Mimic: miR-1269a mimic. FOXO1 + mimic: pCDH-CMV-FOXO1 and miR-1269a mimic. All experiments repeated independently in triplicate

Fig. 9

MiR-1269a inhibited the apoptosis and cell cycle arrest of LC cells through targeting FOXO1. a–c The apoptosis of A549 and SPC-A1 cells was determined by flow cytometry. d–f The cell cycle of A549 and SPC-A1 cells was determined by flow cytometry. *P < 0.05, **P < 0.001, vs Vector. #P < 0.05, ##P < 0.05 vs. FOXO1. ^P < 0.05, ^^P < 0.05 vs. mimic. Vector: pCDH-CMV empty plasmid. FOXO1: pCDH-CMV-FOXO1 overexpression plasmid. Mimic: miR-1269a mimic. FOXO1 + mimic: pCDH-CMV-FOXO1 and miR-1269a mimic. All experiments repeated independently in triplicate

Fig. 10

MiR-1269a inhibited the metastasis of LC cells through targeting FOXO1. a–c The migration of A549 and SPC-A1 cells was determined by wound-healing assay (magnification: 100x). The migration of A549 and SPC-A1 cells was calculated (b and c). (d–f) The invasion of A549 and SPC-A1 cells was calculated (d and e). The invaded cells (f) were subjected to transwell assay and shown under a microscope (magnification: 200x). *P < 0.05, **P < 0.001, vs Vector. #P < 0.05, ##P < 0.05 vs. FOXO1. ^P < 0.05, ^^P < 0.05 vs. mimic. Vector: pCDH-CMV empty plasmid. FOXO1: pCDH-CMV-FOXO1 overexpression plasmid. Mimic: miR-1269a mimic. FOXO1 + mimic: pCDH-CMV-FOXO1 and miR-1269a mimic. All experiments repeated independently in triplicate

MiR-1269a promoted the growth of LC cells through targeting FOXO1. a, b The level of FOXO1 in A549 (a) and SPC-A1 (b) cells was measured by qRT-PCR. c, d The viabilities of A549 (c) and SPC-A1 (d) cells after infection were measured by CCK-8 assay. e–g The colony formation abilities of A549 (f) and SPC-A1 (g) cells after infection were determined by colony formation assay. *P < 0.05, **P < 0.001, vs Vector. #P < 0.05, ##P < 0.05 vs. FOXO1. ^P < 0.05, ^^P < 0.05 vs. mimic. Vector: pCDH-CMV empty plasmid. FOXO1: pCDH-CMV-FOXO1 overexpression plasmid. Mimic: miR-1269a mimic. FOXO1 + mimic: pCDH-CMV-FOXO1 and miR-1269a mimic. All experiments repeated independently in triplicate MiR-1269a inhibited the apoptosis and cell cycle arrest of LC cells through targeting FOXO1. a–c The apoptosis of A549 and SPC-A1 cells was determined by flow cytometry. d–f The cell cycle of A549 and SPC-A1 cells was determined by flow cytometry. *P < 0.05, **P < 0.001, vs Vector. #P < 0.05, ##P < 0.05 vs. FOXO1. ^P < 0.05, ^^P < 0.05 vs. mimic. Vector: pCDH-CMV empty plasmid. FOXO1: pCDH-CMV-FOXO1 overexpression plasmid. Mimic: miR-1269a mimic. FOXO1 + mimic: pCDH-CMV-FOXO1 and miR-1269a mimic. All experiments repeated independently in triplicate MiR-1269a inhibited the metastasis of LC cells through targeting FOXO1. a–c The migration of A549 and SPC-A1 cells was determined by wound-healing assay (magnification: 100x). The migration of A549 and SPC-A1 cells was calculated (b and c). (d–f) The invasion of A549 and SPC-A1 cells was calculated (d and e). The invaded cells (f) were subjected to transwell assay and shown under a microscope (magnification: 200x). *P < 0.05, **P < 0.001, vs Vector. #P < 0.05, ##P < 0.05 vs. FOXO1. ^P < 0.05, ^^P < 0.05 vs. mimic. Vector: pCDH-CMV empty plasmid. FOXO1: pCDH-CMV-FOXO1 overexpression plasmid. Mimic: miR-1269a mimic. FOXO1 + mimic: pCDH-CMV-FOXO1 and miR-1269a mimic. All experiments repeated independently in triplicate

Discussion

LC patients develop lymph node metastasis and distant metastasis [21]. In this study, we found that the expression LINC00261 was reduced in LC and was associated with a poor prognosis in LC patients. Moreover, overexpression LINC00261 inhibited LC growth and progression via targeting miR-1269a/FOXO1 axis. LINC00261 is a tumor suppressor gene in many types of cancers, for instance, LINC00261 inhibits cell growth and migration of endometriosis [22], hepatocellular carcinoma [23] and gastric cancer [24]. Additionally, LINC00261 enhances chemo-sensitization of human esophageal cancer cells [25] and human colon cancer cells [26]. These findings indicate that LINC00261 could be a therapeutic target for cancer treatment. The current study showed that LINC00261 expression was down-regulated in the LC tissues and cells. In addition, patients with relative lower expression of LINC00261 in their tumor had a shorter overall survival time, more advanced TNM stage and a higher risk of metastasis. Previous studies reported that low expression of LINC00261 in non-small cell lung cancer and pancreatic cancer can be used as a prognostic marker [27, 28], which was similar to our results. Further experiments demonstrated that overexpression of LINC00261 significantly suppressed the growth of LC cells, inhibited cell viability and cell colony progression, and promoted cell apoptosis. Cell cycle assay showed that cell cycle of LC cells with overexpressed LINC00261 was arrested in G1 phase, which, however, was inconsistent with a previous study [29], and future experiments are required to be conducted to determine the protein expression levels of CHK1, CHK2, and WEE1. The suppressive role of LINC00261 was also confirmed by xenograft assays. Thus, these results proved that LINC00261 is potentially a tumor suppressor for LC. LncRNAs are crucial signal transduction mediators in cancer signaling pathways by interacting with proteins, RNA, and lipids [6]. Although LINC00261 shows similar function in the progression of different cancers, but the molecular mechanisms could be different. For instance, LINC00261 regulates BCL2L11 expression in endometriosis through acting as a competing endogenous RNA for miR-132-3p [30], while LINC00261 suppresses Wnt signaling activity in colon cancer through restraining β-catenin into nuclei and causing degradation of β-catenin [16], moreover, LINC00261 also destabilizes Slug protein in gastric cancer [24]. The potential target miRNA was investigated to explore the molecular mechanism through which LINC00261 suppresses the cell proliferation and metastasis of LC cells, and we found that in LC cells LINC00261 was a sponge for miR-1269a, and that FOXO1 was target gene for miR-1269a. Previous study showed that miR-1269a expression was up-regulated in late-staged colorectal cancer and promotes metastasis through forming a positive feedback loop with TGF-β [31]. Pan-cancer analysis indicated that miR-1269a is dysregulated in 14 cancers from The Cancer Genome Atlas (TCGA) [32]. In non-small cell lung cancer, up-regulating the expression of miR-1269a promotes cancer cell proliferation [33]. The present study found that miR-1269a expression was up-regulated in LC tissues and cells, which was similar to previous studies conducted on other cancers. Furthermore, miR-1269a was negatively correlated with the expression of LINC00261, which indirectly supports the suppressive interaction between LINC00261 and miR-1269a. Forkhead transcription factor 1 (FOXO1) belongs to the Forkhead box (FOX) transcription factor family, and is a key regulator during the development of multiple organs or tissue cells such as embryonic heart and islet alpha cells [34]. The FOX transcription factor family is associated with colorectal cancer pathogenesis [35]. FOXO1 is considered to be a tumor suppressor in multiple solid tumors, for example, up-regulation of FOXO1 is associated with a poor prognosis in patients with cervical cancer [36]. One previous study showed that miR-27a promotes the progression of pancreatic ductal adenocarcinoma through activating Wnt/β-catenin pathway via FOXO1 [37]. TCF19 promotes the cell growth of non-small cell lung cancer by inhibiting FOXO1 [38]. Recently, study indicated that degradation of FOXO1 mediated by G9a at K273 residue promoted cell proliferation of colon cancer [39]. Therefore, we considered that FOXO1 has a suppressive effect on LC progression. In our study, we confirmed that FOXO1 expression was down-regulated in LC tissues, in addition, FOXO1 was regulated by miR-1269a and LINC00261. Furthermore, functional rescue experiments indicated that FOXO1 overexpression inhibited the proliferation and metastasis of lung cancer cells, while miR-1269a mimic had opposite effects on LC cells and could block the effects of FOXO1 overexpression.

Conclusion

In conclusion, the current study found that in LC LINC00261 expression was down-regulated, which also has an important prognostic value for LC patients. Furthermore, overexpression LINC00261 inhibits the growth and metastasis of LC cells via targeting miR-1269a/FOXO1 axis. Thus, LINC00261 may serve as a suppressor gene and could be explored as a potential therapeutic target for treating patients with advanced TNM stage of LC.
  38 in total

Review 1.  Bone metastases in lung cancer. Potential novel approaches to therapy.

Authors:  Silvestre Vicent; Naiara Perurena; Ramaswamy Govindan; Fernando Lecanda
Journal:  Am J Respir Crit Care Med       Date:  2015-10-01       Impact factor: 21.405

2.  LINC00261 suppresses human colon cancer progression via sponging miR-324-3p and inactivating the Wnt/β-catenin pathway.

Authors:  Dongsheng Yan; Weidong Liu; Yeliu Liu; Man Luo
Journal:  J Cell Physiol       Date:  2019-06-10       Impact factor: 6.384

3.  Long noncoding RNA HOTAIR regulates polycomb-dependent chromatin modification and is associated with poor prognosis in colorectal cancers.

Authors:  Ryunosuke Kogo; Teppei Shimamura; Koshi Mimori; Kohichi Kawahara; Seiya Imoto; Tomoya Sudo; Fumiaki Tanaka; Kohei Shibata; Akira Suzuki; Shizuo Komune; Satoru Miyano; Masaki Mori
Journal:  Cancer Res       Date:  2011-08-23       Impact factor: 12.701

4.  MiR-27a-regulated FOXO1 promotes pancreatic ductal adenocarcinoma cell progression by enhancing Wnt/β-catenin signaling activity.

Authors:  Jing Ling; Xiao Dong; Lei Wang; Ying Xue; Xuebing Jia; Weifeng Song; Qi Li
Journal:  Am J Transl Res       Date:  2019-05-15       Impact factor: 4.060

5.  Long Noncoding RNA MALAT1 Regulates Cancer Glucose Metabolism by Enhancing mTOR-Mediated Translation of TCF7L2.

Authors:  Pushkar Malakar; Ilan Stein; Amijai Saragovi; Roni Winkler; Noam Stern-Ginossar; Michael Berger; Eli Pikarsky; Rotem Karni
Journal:  Cancer Res       Date:  2019-03-26       Impact factor: 12.701

6.  The FOXP1, FOXP2 and FOXP4 transcription factors are required for islet alpha cell proliferation and function in mice.

Authors:  Jason M Spaeth; Chad S Hunter; Lauren Bonatakis; Min Guo; Catherine A French; Ian Slack; Manami Hara; Simon E Fisher; Jorge Ferrer; Edward E Morrisey; Ben Z Stanger; Roland Stein
Journal:  Diabetologia       Date:  2015-05-29       Impact factor: 10.122

7.  Long non-coding RNA LINC00261 sensitizes human colon cancer cells to cisplatin therapy.

Authors:  Z K Wang; L Yang; L L Wu; H Mao; Y H Zhou; P F Zhang; G H Dai
Journal:  Braz J Med Biol Res       Date:  2017-12-11       Impact factor: 2.590

Review 8.  The forkhead-box family of transcription factors: key molecular players in colorectal cancer pathogenesis.

Authors:  Paul Laissue
Journal:  Mol Cancer       Date:  2019-01-08       Impact factor: 27.401

9.  Long noncoding RNA EPB41L4A-AS2 inhibits hepatocellular carcinoma development by sponging miR-301a-5p and targeting FOXL1.

Authors:  Yu-Gang Wang; Tao Wang; Min Shi; Bo Zhai
Journal:  J Exp Clin Cancer Res       Date:  2019-04-10

10.  MiR-1269a acts as an onco-miRNA in non-small cell lung cancer via down-regulating SOX6.

Authors:  R-H Jin; D-J Yu; M Zhong
Journal:  Eur Rev Med Pharmacol Sci       Date:  2018-08       Impact factor: 3.784

View more
  11 in total

1.  Expression status and prognostic value of autophagy-related lncRNAs in prostate cancer.

Authors:  Guo Chen; Xiaoping Qin; Yu Wang; Biyun Gao; Muan Ling; Wenjun Yin; Yutong Li; Bin Pan
Journal:  Cell Cycle       Date:  2022-04-24       Impact factor: 5.173

2.  Construction and Comparison of ceRNA Regulatory Network for Different Age Female Breast Cancer.

Authors:  Zhi-Qin Liu; Gao-Tao Zhang; Li Jiang; Chun-Qing Li; Que-Ting Chen; Du-Qiang Luo
Journal:  Front Genet       Date:  2021-04-21       Impact factor: 4.599

3.  M2 macrophages-derived exosomal microRNA-501-3p promotes the progression of lung cancer via targeting WD repeat domain 82.

Authors:  Jie Lei; Peng Chen; Feng Zhang; Na Zhang; Jianfei Zhu; Xiaoping Wang; Tao Jiang
Journal:  Cancer Cell Int       Date:  2021-02-05       Impact factor: 5.722

Review 4.  LINC00261: a burgeoning long noncoding RNA related to cancer.

Authors:  Menggang Zhang; Fang Gao; Xiao Yu; Qiyao Zhang; Zongzong Sun; Yuting He; Wenzhi Guo
Journal:  Cancer Cell Int       Date:  2021-05-22       Impact factor: 5.722

Review 5.  miR-1269a and miR-1269b: Emerging Carcinogenic Genes of the miR-1269 Family.

Authors:  Zijun Xie; Chenming Zhong; Shiwei Duan
Journal:  Front Cell Dev Biol       Date:  2022-02-18

Review 6.  Research progress on the interaction between long non‑coding RNAs and RNA‑binding proteins to influence the reprogramming of tumor glucose metabolism (Review).

Authors:  Weizheng Wu; Kunming Wen
Journal:  Oncol Rep       Date:  2022-07-20       Impact factor: 4.136

Review 7.  Current treatments for non-small cell lung cancer.

Authors:  Qianqian Guo; Liwei Liu; Zelong Chen; Yannan Fan; Yang Zhou; Ziqiao Yuan; Wenzhou Zhang
Journal:  Front Oncol       Date:  2022-08-11       Impact factor: 5.738

8.  The CDK1-Related lncRNA and CXCL8 Mediated Immune Resistance in Lung Adenocarcinoma.

Authors:  Jinmin Xue; Yang Song; Wenwen Xu; Yuxi Zhu
Journal:  Cells       Date:  2022-08-29       Impact factor: 7.666

9.  LINC00261 Suppresses Cisplatin Resistance of Esophageal Squamous Cell Carcinoma Through miR-545-3p/MT1M Axis.

Authors:  Lijun Wang; Xiaojun Wang; Pengwei Yan; Yatian Liu; Xuesong Jiang
Journal:  Front Cell Dev Biol       Date:  2021-07-15

10.  A Signature of 14 Long Non-Coding RNAs (lncRNAs) as a Step towards Precision Diagnosis for NSCLC.

Authors:  Anetta Sulewska; Jacek Niklinski; Radoslaw Charkiewicz; Piotr Karabowicz; Przemyslaw Biecek; Hubert Baniecki; Oksana Kowalczuk; Miroslaw Kozlowski; Patrycja Modzelewska; Piotr Majewski; Elzbieta Tryniszewska; Joanna Reszec; Zofia Dzieciol-Anikiej; Cezary Piwkowski; Robert Gryczka; Rodryg Ramlau
Journal:  Cancers (Basel)       Date:  2022-01-16       Impact factor: 6.639

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.