Clinical evaluation of a non-purified direct molecular assay for the detection of Clostridioides difficile toxin genes in stool specimens.

Recently, a new rapid assay for the detection of tcdB gene of Clostridioides difficile was developed using the GENECUBE. The assay can directly detect the tcdB gene from stool samples without a purification in approximately 35 minutes with a few minutes of preparation process. We performed a prospective comparative study of the performance of the assay at eight institutions in Japan. Fresh residual stool samples (Bristol stool scale ≥5) were used and comparisons were performed with the BD MAX Cdiff assay and toxigenic cultures. For the evaluation of 383 stool samples compared with the BD MAX Cdiff assay, the sensitivity, and specificity of the two assays was 99.0% (379/383), 98.1% (52/53), 99.1% (327/330), respectively. In the comparison with toxigenic culture, the total, sensitivity, and specificity were 96.6% (370/383), 85.0% (51/60), and 98.8% (319/323), respectively. The current investigation indicated the GENECUBE Clostridioides difficile assay has equivalent performance with the BD MAX Cdiff assay for the detection of tcdB gene of C. difficile.

Introduction

Clostridioides difficile is a Gram-positive, rod-shaped, obligate anaerobic bacterium.

C. difficile infection (CDI) includes C. difficile-associated diarrhea, pseudomembranous colitis, ileus, and toxic megacolon [1], and is one of the most common healthcare-associated infections worldwide with an incidence reported as 7.0 to 8.5 cases/10,000 patient days (PD) in the United States [2], 1.5 to 4.7 case/10,000 PD in Europe [3], and 0.8–7.4 case /10,000 PD in Japan [4, 5]. Diarrhea, especially hospital-based or healthcare-associated diarrhea, is a representative symptom of CDI, and detection of toxins or toxigenic C. difficile in symptomatic patients’ stools are the main criteria for diagnosis [6], and molecular detection of toxin genes are now used commonly [6].

Several molecular assays for detection of toxin genes have been developed and are classified into three groups: those that detect tcdB gene for the diagnosis of CDI, including the BD MAX Cdiff assay [7], and the cobas Liat Cdiff assay [8]; those that detect cdt gene and tcdC mutations in addition to tcdB gene, including the Xpert C. difficile [9] assay and the Verigene CDF Panel [10]; and multiplex molecular assays such the FilmArray GI panel [11] and the xTAG Gastrointestinal Pathogen Panel [12]. Most molecular assays have been reported to have excellent performance for the detection of tcdB [7, 13] and prompt identification was reported among several assays [14, 15].

GENECUBE (TOYOBO Co., Ltd., Osaka, Japan) is a a Qprobe-PCR based fully automated rapid genetic analyzer capable of extracting nucleic acids from biological material, preparing reaction mixtures, and amplifying a target gene by PCR. This device can handle a maximum of eight samples at once and analyze up to four items at the same time. In the GENECUBE system, purification mode, amplification mode or both modes can be selected for each assay; amplification mode is used for PCR of purified samples or direct PCR of prepared samples. GENECUBE is used for Mycobacterium tuberculosis [16], Mycobacterium avium, Mycobacterium intracellulare, Neisseria gonorrhoeae [17], Chlamydia trachomatis, and Mycoplasma pneumoniae [18, 19]. In addition, assays for the determination of Staphylococcus aureus and mecA were released [20] and rapid precise molecular identification of the causative pathogens from positive blood culture medium without a purification process was reported.

Recently, a new assay for the detection of tcdB of C. difficile with the GENECUBE was created by TOYOBO Co., Ltd. The assay can be performed in approximately 35 minutes with a few minutes of preparation process without a purification. In this study, we performed a multicenter study to evaluate the new C. difficile assay.

Materials and methods

Study design (samples and strains)

This study was performed to evaluate the clinical performance of the GENECUBE Clostridioides difficile assay for the detection of tcdB in stool samples. Comparisons were performed with the BD MAX Cdiff assay (Becton Dickinson and Company, Ltd., New Jersey, USA) and toxigenic cultures (Fig 1).

Fig 1

Study procedure for the evaluation of the GENECUBE Clostridioides difficile assay.

C. DIFF QUIK CHEK COMPLETE test of stool samples of University of Fukui Hospital were performed at Miroku Medical Laboratory Inc. MML, Miroku Medical Laboratory Inc.; SRL, SRL Inc.

Fresh residual stool samples (Bristol stool scale ≥5 [21]), which were submitted for the evaluation of CDI, were obtained from eight hospitals (Hiroshima University Hospital; HUD, St. Marianna University School of Medicine Hospital; SMD, University of Tsukuba Hospital; TUD, University of Fukui Hospital; FUD, Chutoen General Medical Center; CTD, Tsuruga Municipal Hospital; TRD, Tone Chuo Hospital; TCD, and Tsukuba Medical Center Hospital; TMD) between November 2018 and March 2019. All the stool samples were anonymized after clinical testing and the study was performed on the anonymized residual stool samples.

In the first evaluation, the GENECUBE assay evaluation and C. DIFF QUIK CHEK COMPLETE (QUIK CHEK, Abbott Diagnostics Medical Co., Ltd., Illinois, USA) assay evaluations were performed at each institution. If each institution routinely used the QUIK CHEK for the evaluation of CDI on a daily basis, we used these results in the current study. After the first evaluation, registered stool samples were transported in cool conditions (2–8°C) for the second evaluation to SRL Inc. (Tokyo, Japan) for BD MAX assay evaluation with the BD MAX Cdiff assay and to Miroku Medical Laboratory Inc. (Nagano, Japan) for toxigenic culture. SRL Inc. was the only commercially available centralized laboratory in Japan to accept stool samples for the molecular assay evaluation of toxin genes of C. difficile in 2018. BD MAX assay evaluation with the BD MAX Cdiff assay was performed as per the manufacturer’s instruction. Positive control and negative control were examined for each evaluation.

The GENECUBE assay evaluation with GENECUBE C. difficile assay was performed within 3 days after the submission of stool samples from wards. BD MAX assay evaluation with the BD MAX Cdiff assay and toxigenic culture were performed within 5 days after the submission of stool samples. Assay evaluation of stool samples with insufficient stool volume or with an excess of due date were excluded.

This study was approved by institutional review boards of Hiroshima University Hospital (protocol no. E1395-1) and of each hospital. All assay evaluations were performed after approval.

GENECUBE assay evaluation with the GENECUBE C. difficile assay

For sample preparation, approximately 20–50 μL stool sample was obtained with a single-use cotton swab and samples were diluted with 1 mL of lysis buffer in filter-equipped tubes (Fig 2). After filtration of the diluted stool samples, 200 μL diluted stool samples were treated by bead-beating for 20 s with easy beads (TOYOBO Co., Ltd.,) for DNA extraction and then centrifuged for 3 mins at 13,000 ×g after the addition of 200 μL of lysis buffer. Then 20 μL supernatant was used for the assay evaluation.

Fig 2

Preparation of test samples for the GENECUBE Clostridioides difficile assay.

The PCR conditions were as follows: denaturation at 97°C for 15 s, and 60 cycles of 97°C for 1 s, 54°C for 5 s and 63°C for 2 s. The PCR products were subjected to a melting point analysis, the conditions of which were: 94°C for 30 s and 39°C for 30 s, followed by heating from 40°C to 75°C in increments of 0.09°C/s. Data were analyzed automatically and displayed on the GENECUBE monitor after completion of the assay evaluation.

Culture and identification of C. difficile

Briefly, approximately 100 μL stool sample was mixed with 100 μL trypticase soy broth (Becton Dickinson and Company) and treated by ethanol shock for 30 min in an equal volume of 99% ethanol before inoculation, as previously described. Treated stool samples were cultivated with selective agar (CCMA-EX, Nissui Pharmaceutical Co., Ltd., Tokyo, Japan) at 35°C for 48 h under anaerobic conditions in an anaerobic chamber. Colonies of C. difficile were initially identified by their colony appearance and then confirmed by both matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI/TOF MS, Bruker Corporation, Massachusetts, USA) and the glutamate dehydrogenase (GDH) of the QUIK CHEK.

Analysis of tcdA, tcdB, cdt genes and tcdC mutation in isolated C. difficile strains

C. difficile strains were plated on CCMA-EX agar and grown at 35°C for 46–48 h in anaerobic conditions. Sample preparation was conducted with the concentration of 4 McFarland standard. DNA was extracted from 200 μL of the suspended sample using a QIAamp DNA Mini Kit (QIAGEN N.V., Hilden, Germany) and eluted in a final volume of 100 μL. Real time PCR was performed according to previous papers (Table 1) [22-24].

Table 1

Primers and probes used for real-time PCR.

Target genes	Oligonucleotide	Sequence (5'-3')a,b	Amplicon size(bp)	Region	Reference
tcdA	tcdA_F	CAGTCGGATTGCAAGTAATTGACAAT	102		[27]
	tcdA_R	AGTAGTATCTACTACCATTAACAGTCTGC		5891–5993c
	tcdA_P	FAM-TTGAGATGATAGCAGTGTCAGGATTG-TAMRA
tcdB	tcdB_F	TACAAACAGGTGTATTTAGTACAGAAGATGGA	240		[27]
	tcdB_R	CACCTATTTGATTTAGMCCTTTAAAAGC		5681–5921d
	tcdB_P	FAM-TTTKCCAGTAAAATCAATTGCTTC-TAMRA
cdtA	cdtA_F	GATCTGGTCCTCAAGAATTTGGTT	103		[28]
	cdtA_R	GCTTGTCCTTCCCATTTTCGATT		1051–1153e
	cdtA_P	FAM-CAAGAGATCCGTTAGTTGCAGCATATCCAATTGT-MGBEQ
cdtB	cdtB_F	AAAAGCTTCAGGTTCTTTTGACAAG	132		[28]
	cdtB_R	TGATCAGTAGAGGCATGTTCATTTG		837–968e
	cdtB_P	CY5-AACTCTTACTTCCCCTGAAT-BHQ2
tcdC	tcdC_F	GCACAAAGGRTATTGCTCTACTGG	70		[26]
	tcdC_R1	AGCTGGTGAGGATATATTGCCAA
	tcdC_R2	CAAGATGGTGAGGATATATTGCCA
	tcdC_P_wt	FAM-AAACACRCCHAAAATAA-MGBEQe
	tcdC_P_mut	HEX-AAACACRCCAAAATAA-MGBEQ

a FAM, 6-carboxyfluorescein; TAMRA, Carboxy tetramethyl-rhodamine; MGBEQ,Minor Groove Binder Eclipse Quencher; CY5, Cy5 carboxylic acid; BHQ-2, Black Hole Quencher 2; HEX, Hexachlorofluorescein.

b R = A or G; H = A,C or T

c On the basis of sequence in GeneBank with accession number M30307 for tcdA

d On the basis of sequence in GeneBank with accession number X53138 for tcdB

e On the basis of sequence in GeneBank with accession number L76081 for cdtA and cdtB

This assay evaluation was performed on a CFX real-time PCR system (Bio-Rad Laboratories, Inc. Hercules, CA, USA) in a 96-well optical plate format with a THUNDERBIRD Probe qPCR Mix QPS-101 (TOYOBO Co., Ltd.). For testing of the isolates, each 18 μL reaction mixture consisted of 1×THUNDERBIRD Probes, 0.3 μM of each specific primer, 0.2μM of the fluorescent probes, sterile water, and 2 μL DNA template. The thermal cycling conditions were as follows: one cycle 95°C for 1 min, followed by 40 cycles (45 cycles for testing of stool specimens) at 95°C for 5 s and 55°C for 1 min. Date was acquired with the Bio Rad CFX Manager software v 3.0 (Bio Rad).

Investigation of analytical sensitivity and comparison with other assays

For the determination of the limit of detection of the GENECUBE C. difficile assay and comparisons with other assays, we used two spiked stool samples and spiked demineralized water for the evaluation. Culture-negative stool samples were pooled and used as matrix of spiked stool samples. C. difficile strain ATCC9689 was spiked into negative pooled stool samples at a concentration of 1.5 × 107 CFU/mL, 1.5 × 106 CFU/mL, 1.5 × 105 CFU/mL, 7.5 × 104 CFU/mL, 5.0 × 104 CFU/mL, 3.0 × 104 CFU/mL, 1.5 × 104 CFU/mL, and 1.5 × 103 CFU/mL for each set of two pooled stool samples and one demineralized water sample. For the concentration, 1 McFarland was regarded as approximately 3.0 × 107 CFU/mL as previously described [25]. For the GENECUBE C. difficile assay, 50 μL spiked sample was used for assay evaluation and tests were performed four times for each sample. The LODs were estimated as the lowest concentration at which the positivity rate was 100%. As a comparison, the BD MAX Cdiff assay and QUIK CHEK were evaluated with these spiked samples. A single test was performed for each sample. Both the GENECUBE evaluation and the BD MAX evaluation were performed on the same day with the same spiked samples, which were preserved in cool conditions for a day after spiked samples were prepared.

Statistical analyses

The GENECUBE assay results were compared with each result of BD MAX Cdiff assay and toxigenic culture. The positive predictive value and negative predictive value were calculated from routine 2×2 result tables. The 95% confidence intervals (CIs) were calculated by the method of Clopper and Pearson using the online calculator at https://statpages.info/ctab2x2.html.

Results

Analytical sensitivity

The results of the spike assay evaluation are summarized in Table 2. In the GENECUBE assay evaluation, all positive results (100%) were obtained down to 1.5 × 103 CFU/mL for demineralized water samples and 3.0 × 104 CFU/mL for stool samples.

Table 2

Investigation of the limit of detection of the GENECUBE Clostridioides difficile assay compared with other assays.

CFU/mLa	Demineralized Water				Pooled stool sample 1b				Pooled stool sample 2b
	GENECUBEc	C. DIFF QUIK CHEK COMPLETE		BD MAXc	GENECUBE	C. DIFF QUIK CHEK COMPLETE		BD MAX	GENECUBE	C. DIFF QUIK CHEK COMPLETE		BD MAX
	(Positive / Tests)	Toxin	GDH		(Positive / Tests)	Toxin	GDH		(Positive / Tests)	Toxin	GDH
0	0/4 (0%)	-	-	-	0/4 (0%)	-	-	-	0/4 (0%)	-	-	-
1.5 × 103	4/4 (100%)	-	-	-	1/4 (25%)	-	-	-	1/4 (25%)	-	-	-
1.5 × 104	4/4 (100%)	-	-	+	3/4 (75%)	-	-	-	3/4 (75%)	-	-	-
3.0 × 104	4/4 (100%)	-	-	+	4/4 (100%)	-	+	+	4/4 (100%)	-	-	-
5.0 × 104	4/4 (100%)	-	+	+	4/4 (100%)	-	+	+	4/4 (100%)	-	+	-
7.5 × 104	4/4 (100%)	-	+	+	4/4 (100%)	-	+	+	4/4 (100%)	-	+	-
1.5 × 105	4/4 (100%)	-	+	+	4/4 (100%)	-	+	+	4/4 (100%)	-	+	+
1.5 × 106	4/4 (100%)	-	+	+	4/4 (100%)	-	+	+	4/4 (100%)	-	+	+
1.5 × 107	4/4 (100%)	+	+	+	4/4 (100%)	+	+	+	4/4 (100%)	+	+	+

GENECUBE, GENECUBE Clostridioides difficile assay; BD MAX, BD MAX Cdiff assay; GDH, glutamate dehydrogenase.

a C. difficile strain ATCC9689 (0.5 McFarland suspension = 1.5 × 107 CFU/mL).

b Culture-negative frozen stool samples for C. difficile were used as a matrix of pooled stool samples.

c The GENECUBE system and the BD MAX system automatically show the results of molecular analyses on a display when the assay evaluations are complete. We used the automatic analysis to determine “positive” and “negative”.

GDH tests were positive down to 5.0 × 104 CFU/mL for demineralized water samples and stool samples. Molecular assay evaluations of BD MAX were positive down to 1.5 × 104 CFU/mL for demineralized water samples and 3.0 × 104 CFU/mL for pooled stool sample 1, however the test was negative for pooled stool sample 2 at the concentrations of 7.5 × 104 CFU/mL.

Based on these results, the LODs of the GENECUBE assay evaluation were estimated to be 3.0 × 104 CFU/mL for the detection of toxigenic C. difficile.

Clinical stool samples and results of each assay evaluation

A total of 383 clinical stool samples met the study criteria (HUD 106, SMD 29, TUD 21, FUD 17, CTD 80, TRD 54, TCD 39, and TMD 37) and were evaluated by GENECUBE, BD MAX, and culture assay evaluations. In this study, C. difficile was cultivated from 85 stool samples and toxin-producing C. difficile was cultivated from 60 stool samples (70.6%). Both toxin-producing C. difficile and non-toxin producing

C. difficile were isolated from one stool sample.

Of the 60 toxigenic strains, 55 strains were tcdA-positive/tcdB-positive and five strains were tcdA-negative/ tcdB-positive. cdt mutation was detected in five strains (5/60; 8.3%) and tcdC mutation was detected in one strain (1/60; 1.7%) in this study.

The results of QUIK CHEK showed that GDH was positive in 59/85 C. difficile positive stool samples (69.4%) and toxin was positive in 16/60 toxigenic C. difficile positive stool samples (26.7%). As for the GENECUBE assay evaluation, positive results were obtained in 55/383 stool samples. No stool samples had the result of “invalid” with the requirement of re-assay evaluation in this study. For the BD MAX assay evaluation, positive results were obtained in 53/383 stool samples. Re- assay evaluation was performed for an invalid result in one stool sample at the first assay evaluation because of high viscosity.

Comparison of the GENECUBE assay with the BD MAX assay

The comparison of the GENECUBE assay with the BD MAX assay is summarized in Table 3. The sensitivity, and specificity of the two assays were 99.0% (379/383), 98.1% (52/53) and 99.1% (327/330), respectively.

Table 3

Comparison of the GENECUBE Clostridioides difficile assay with BD MAX Cdiff assay.

		GENECUBE		Total
		Positive	Negative
BD MAX	Positive	52	1a	53
	Negative	3b	327	330
Total		55	328	383
Total (%)		99.0% (97.1–99.4) c
Sensitivity (%)		98.1% (91.2–99.9)
Specificity (%)		99.1% (98.0–99.4)

GENECUBE, GENECUBE C. difficile assay; BD MAX, BD MAX Cdiff assay

a C. difficile was not cultivated in selective agar in anaerobic conditions and the GDH assay evaluation of stool sample was negative.

b Toxigenic C. difficile was isolated from all three stool samples and GDH assay evaluations of stool samples were all positive.

c Date in parentheses are 95% confidence intervals.

Of the four stool samples with disconcordance between the two assays, one stool sample was negative by the GENECUBE assay evaluation and positive by the BD MAX assay evaluation. C. difficile was not isolated from the stool sample and the GDH assay evaluation of the stool sample was negative. The other three samples were positive by GENECUBE assay evaluation and negative by BD MAX assay evaluation. Toxigenic C. difficile was isolated from all three stool samples and all were positive for GDH.

Comparison of the GENECUBE assay evaluation with toxigenic culture

The comparison of the GENECUBE assay evaluation with toxigenic culture is summarized in Table 4. The total, sensitivity, and specificity of two assay evaluation were 96.6% (370/383), 85.0% (51/60) and 98.8% (319/323), respectively.

Table 4

Comparison of the GENECUBE Clostridioides difficile assay with toxigenic culture.

		GENECUBE		Total
		Positive	Negative
Toxigenic culture	Positive	51	9a	60
	Negative	4b	319	323
Total		55	328	383
Total (%)		96.6% (94.1–98.0) c
Sensitivity (%)		85.0% (77.1–89.3)
Specificity (%)		98.8% (97.3–99.6)

GENECUBE, GENECUBE C. difficile assay; BD MAX, BD MAX Cdiff assay

a BD MAX Cdiff assay and GDH assay evaluations were negative in the nine stool samples.

b BD MAX Cdiff assay was positive in the four stool samples and GDH assay evaluation was positive in two of the four stool samples.

c Date in parentheses are 95% confidence intervals.

Of the 13 stool samples with disconcordance between the two assays, nine stool samples were negative by the GENECUBE assay evaluation and positive by toxigenic culture. The BD MAX Cdiff assay and GDH assay evaluations were negative in the nine stool samples. The other four samples were positive by the GENECUBE assay evaluation and negative by toxigenic culture. The BD MAX Cdiff assay was positive in the four stool samples and GDH assay evaluation was positive in two of the four stool samples.

Discussion

This is the first study evaluating the performance of the GENECUBE C. difficile assay. We report that the assay can be performed without a purification step. Using spiked stool samples and clinical samples, the GENECUBE C. difficile assay detected all GDH-positive toxigenic C. difficile-containing stool samples and had a non-inferior ability to detect the tcdB gene compared with the BD MAX Cdiff assay. In the one case of a negative result by the GENECUBE assay evaluation and positive result by the BD MAX assay evaluation, a false-positive of the BD MAX assay evaluation was considered based on the negative culture result. In the three cases of positive results of the GENECUBE assay evaluation and negative result of the BD MAX assay evaluation, a true-positive was considered based on the positive culture result.

There were 13 discordant cases when the results of the GENECUBE C. difficile assay and toxigenic culture were compared in this study. As for the nine cases of negative results of the GENECUBE assay evaluation and positive result of toxigenic culture, we considered that the toxin genes in the stool samples were below the limit of detection of the GENECUBE for the negative result of the BD MAX assay evaluation and GDH assay evaluation. In this study, the four cases were positive results of the GENECUBE assay evaluation and the negative culture result. C. difficile is highly sensitive to the culture method used, especially the alcohol shock procedure [26]. However, even when the alcohol shock procedure was performed, toxic genes were still detected in culture-negative stool samples by molecular examination [27]. We think toxigenic C. difficile was present in the stool samples because positive results were also obtained when using different primers and probes (BD MAX Cdiff assay) for the tcdB gene and when using another detection method (GDH test).

In the previous studies, the sensitivity between molecular assays and toxigenic culture have been reported as 82%–97% for the BD MAX Cdiff assay [7, 10, 15, 28] and 83%–100% for the Xpert C. difficile [7, 10, 15, 28, 29]. Based on these results, we consider that the GENECUBE C. difficile assay has sufficient ability as a molecular assay.

In the clinic, sample-to-answer molecular assay evaluation is useful and two excellent C. difficile assays are commercially available worldwide. The cobas Liat Cdiff assay is the fastest molecular assay for the detection of a toxin gene in C. difficile and is complete in about 20 minutes [8]. The Xpert C. difficile assay requires 45 minutes; however, the assay can detect cdt and tcdC gene mutations in addition to the tcdB gene. Furthermore, the Xpert C. difficile assay is considered to have lowest limit of detection for toxin genes in stool samples [30]. Both assays use a cartridge and do not require laborious preparation procedures. Regarding the GENECUBE C. difficile assay, the assay evaluation time is as short as for the cobas Liat Cdiff and Xpert C. difficile assays, and the GENECUBE C. difficile assay is economical because it requires less expensive materials (tips and tubes); however, the preparation and hands-on time are longer than for the cobas Liat Cdiff and Xpert C. difficile assays. The GENECUBE system can perform four assays simultaneously and selectively; thus, if the development of assays for the cdt gene, tcdC mutations, and/or other genes from enteric pathogens are achieved, the GENECUBE C. difficile assay will have a higher clinical utility than the current version.

There were a limitation in the current study and the GENECUBE C. difficile assay. while assay evaluations of spiked stool samples were performed at same time under the same conditions using the GENECUBE and the BD MAX assays, the BD MAX assay evaluation was performed after the GENECUBE assay evaluation for clinical stool samples and an opposite assay evaluation was not conducted. A delay in BD MAX assay evaluation might negatively affect the test performance of the assay. In addition, current study evaluated the comparison only with the BD MAX assay. Further comparative study such with the Xpert C. difficile assay was required for the evaluation of the GENECUBE C. difficile assay.

In conclusion, our evaluation indicated that the new non-purification molecular assay has equivalent performance with other current molecular identification assays for C. difficile toxin genes.

(DOCX)

Click here for additional data file.

6 May 2020

PONE-D-20-08775

Clinical Evaluation of a Non-purified Direct Molecular Assay for the Detection of Clostridioides difficile Toxin Genes in Stool Specimens

PLOS ONE

Dear Dr. Hara,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Your manuscript has been reviewed by one expert in this field.  A minor revision is suggested.

We would appreciate receiving your revised manuscript by two weeks. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Yung-Fu Chang

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This is a competently performed evaluation of a new molecular assay for the detection of C. difficile tcdB gene. There are some specific issues that the authors should address.

1. The use of the terms "positive and negative concordance" rather than "sensitivity and specificity" which are terms likely to be both familar and better understood by the readers seems a odd construct. I understand that when they compared the two molecular assay the "concordance" construct might seem more appropriate to the authors. However when comparing the molecular test to toxigenic culture, a widely accepted C. difficile reference methods (although one that has its own short-comings), sensitivity and specificity does seem more appropriate.

2. ln 48-49: Since GENECUBE assay was only compared to the BD MAX assay, this is an overstatement. Please modify.

3. ln 102-4: Since QUIK CHECK complete is widely used diagnostically, it would be interesting to have compared the GENECUBE performance to it in a manner similar to what was done with BD MAX with toxigenic culture used as a reference method to resolve discrepant results.

4. Ln 114-7: This seems a significant delay between sample collection and test performance. Perhaps a comment in the discussion is warranted?

5. ln 170-2: How was a "postive" test defined in the LOD portion of the study for the two molecular assays.

6. ln 262-6: One of the short-comings of NAAT assays for C. difficile is false positive when compared to toxigenic culture. These "false" positives are even more pronouced when cytotoxicity assays are used as reference methods. This point likely deserves a bit more discussion in your manuscript.

7. Ln 281: To be clear, the two assays to which you are referring are the LIAT and Xpert assays. Correct?

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Peter Gilligan

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

18 May 2020

Dear Editor and Reviewer

Thank you very much for reviewing our manuscript and offering valuable advice. We have addressed your comments with point-by-point responses, and revised the manuscript accordingly.

Reviewer #1: This is a competently performed evaluation of a new molecular assay for the detection of C. difficile tcdB gene. There are some specific issues that the authors should address.

1. The use of the terms "positive and negative concordance" rather than "sensitivity and specificity" which are terms likely to be both familar and better understood by the readers seems a odd construct. I understand that when they compared the two molecular assay the "concordance" construct might seem more appropriate to the authors. However when comparing the molecular test to toxigenic culture, a widely accepted C. difficile reference methods (although one that has its own short-comings), sensitivity and specificity does seem more appropriate.

Response: Thank you very much for your suggestion. We have changed the sentences as suggested.

2. ln 48-49: Since GENECUBE assay was only compared to the BD MAX assay, this is an overstatement. Please modify.

Response: Thank you very much for your suggestion. We have changed the text to show it was only compared with the BD MAX assay (line 47).

3. ln 102-4: Since QUIK CHECK complete is widely used diagnostically, it would be interesting to have compared the GENECUBE performance to it in a manner similar to what was done with BD MAX with toxigenic culture used as a reference method to resolve discrepant results.

Response: Thank you for this comment. C. DIFF QUIK CHEK COMPLETE was useful, especially for the analysis of discrepant results between molecular examination and toxigenic culture.

4. Ln 114-7: This seems a significant delay between sample collection and test performance. Perhaps a comment in the discussion is warranted?

Response: We agree that a delay would negatively affect the test performance of the BD MAX assay. We have added this point regarding the negative effect to the limitation section of discussion (lines 296-297).

5. ln 170-2: How was a "postive" test defined in the LOD portion of the study for the two molecular assays.

Response: The GENECUBE system and the BD MAX system automatically show the results of molecular analyses on a display when the assay evaluations are complete. We used the automatic analysis to determine “positive” and “negative” for the current evaluation (lines 133-135 and Table 2-c).

6. ln 262-6: One of the short-comings of NAAT assays for C. difficile is false positive when compared to toxigenic culture. These "false" positives are even more pronouced when cytotoxicity assays are used as reference methods. This point likely deserves a bit more discussion in your manuscript.

Response: Thank you very much for your review and suggestions. In this study, GDH was also positive in two of the four culture-negative stool samples. We think that toxigenic culture with the alcohol shock method is a highly sensitive method for the detection of toxigenic C. difficile; however, some culture-negative stool samples can be detected by molecular examination. We have added new references and sentences to the discussion section as red text (lines 266-272).

7. Ln 281: To be clear, the two assays to which you are referring are the LIAT and Xpert assays. Correct?

Response: Thank you for this question. You are correct, the two assays are the cobas Liat Cdiff assay and Xpert C. difficile assay. We revised the text from “the two assays” to the “Liat Cdiff and Xpert C. difficile assays”.

To the editorial Office

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Response: Thank you very much for this suggestion. We have modified the style requirements by referring to the above PDF.

2. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ

Response: The corresponding author has obtained an ORCID iD.

3. The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Response: We added a supporting information file to show all of the individual data

Submitted filename: response to reviewers.docx

Click here for additional data file.

20 May 2020

Clinical Evaluation of a Non-purified Direct Molecular Assay for the Detection of Clostridioides difficile Toxin Genes in Stool Specimens

PONE-D-20-08775R1

Dear Dr. Hara,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Yung-Fu Chang

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

26 May 2020

PONE-D-20-08775R1

Clinical Evaluation of a Non-purified Direct Molecular Assay for the Detection of Clostridioides difficile Toxin Genes in Stool Specimens

Dear Dr. Hara:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Yung-Fu Chang

Academic Editor

PLOS ONE