Literature DB >> 32475449

Dietary betaine improves egg-laying rate in hens through hypomethylation and glucocorticoid receptor-mediated activation of hepatic lipogenesis-related genes.

Nagmeldin A Omer1, Yun Hu2, Abdulrahman A Idriss2, Halima Abobaker2, Zhen Hou2, Shu Yang2, Wenqiang Ma3, Ruqian Zhao2.   

Abstract

In avian species, liver lipid metabolism plays an important role in egg laying performance. Previous studies indicate that betaine supplementation in laying hens improves egg production. However, it remains unclear if betaine improves laying performance by affecting hepatic lipid metabolism and what mechanisms are involved. We fed laying hens a 0.5% betaine-supplemented diet for 4 wks to investigate its effect on hepatic lipids metabolism in vivo and confirmed its mechanism via in vitro experiments using embryonic chicken hepatocytes. Results showed that betaine supplemented diet enhanced laying production by 4.3% compared with normal diet, accompanied with increased liver and plasma triacylglycerol concentrations (P < 0.05) in hens. Simultaneously, key genes involved in hepatic lipid synthesis, such as sterol regulatory element binding protein 1 (SREBP-1), fatty acid synthase, acetyl-CoA carboxylase, and stearoyl-CoA desaturase 1 (SCD1) were markedly upregulated at the mRNA level (P < 0.05). Western blot results showed that SREBP-1 and SCD1 protein levels were also increased (P < 0.05). Moreover, mRNA expression of main apolipoprotein components of yolk-targeted lipoproteins, apolipoprotein B (ApoB) and apolipoprotein-V1 (ApoV1), in addition to microsomal triglyceride transfer proteins, which is closely related to the synthesis and release of very-low density lipoprotein, were also markedly elevated (P < 0.05). Methylated DNA immunoprecipitation combined with PCR detects reduction of methylation levels in certain regions of the above gene promoters. Chromatin immunoprecipitation PCR assays showed increased binding of glucocorticoid receptor (GR) to SREBP1 and ApoB gene promoters. Similar results of ApoV1 gene expression were obtained from cultured hepatocytes treated with betaine. Additionally, betaine increased the expression of GR and some genes involved in methionine cycle in vitro. These results suggest that betaine supplementation could alter the expression of liver lipid synthesis and transport-related genes by modifying the methylation status and GR binding on their promoter and hence promote the synthesis and release of yolk precursor substances in the liver.
Copyright © 2020. Published by Elsevier Inc.

Entities:  

Keywords:  betaine; hens; hepatocytes; lipogenesis; methylation

Year:  2020        PMID: 32475449      PMCID: PMC7597640          DOI: 10.1016/j.psj.2020.01.017

Source DB:  PubMed          Journal:  Poult Sci        ISSN: 0032-5791            Impact factor:   3.352


Introduction

The process of egg production requires a massive increase in triacylglycerol (TG) synthesis to support the energy demands of new yolk formation (Wu et al., 2013). In liver, de novo synthesized triglycerides are packaged into very-low density lipoprotein (VLDL) and used for yolk formation (Cherian, 2015, Li et al., 2017). Hepatic TG homeostasis, the balance between de novo lipogenesis and export of VLDL particles, is extremely important for egg production and chicken health (Liu et al., 2016). Nevertheless, the impact of induced hepatic lipogenesis on egg production is debatable. More than 90% of the de novo synthesis of fatty acids (FA) occurs in the liver of poultry. The key FA synthesis-related genes including fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC), and stearoyl-CoA desaturase 1 (SCD1) could be regulated by sterol regulatory element-binding protein-1 (SREBP1) (Choi and Ginsberg, 2011). Hepatic SCD1 is of considerable importance to monounsaturated FA synthesis and is upregulated at the onset of egg-laying in hens (Li et al., 2017). Apolipoprotein B (ApoB) and VLDL-apolipoprotein II, also named ApoV1, are major components of VLDL-yolk, the specialized avian lipoprotein produced by the liver and function to transport lipids to the ovary for yolk deposition (Chan et al., 1980, Kirchgessner et al., 1987). The expression levels of these 2 apolipoproteins are found to be dramatically elevated in laying hens compared with nonlaying (Li et al., 2017). Microsomal triglyceride transfer protein, an enzyme which is located in the lumen of the endoplasmic reticulum, plays a major role in the synthesis and secretion of VLDL particles from the liver (Wetteru et al., 1997). In sexually mature hens, all these enzymes are basically controlled by sex hormones, mainly estrogen (Speake et al., 1998, Walzem et al., 1999, Riegler et al., 2011). Although, nutritional factors may also play an essential role. Betaine is a naturally occurring micronutrient, chemically known as trimethylglycine. It was first reported in sugar beets, then later discovered in many products. In cells, betaine plays 2 critical roles, stabilizing osmolyte and donating methyl group to other biomolecules (Craig, 2004). Numerous studies in hens indicated that betaine supplementation improved the laying performance and egg production (Zou and Lu, 2002, Gudev et al., 2011, Xing and Jiang, 2012). Previously, we also reported improved egg production in betaine-supplemented hens which might be attributed to the activation of hepatic VTGII expression (Omer et al., 2018). However, whether the modulation of hepatic lipids metabolism induced by betaine might influence laying performance in hens is yet to be studied. Furthermore, glucocorticoid receptor (GR), which is thought to be involved in modulating lipids metabolism and TG homeostasis (Yu et al., 2010, Wang et al., 2012), was induced by dietary betaine in hens (Omer et al., 2018). Nevertheless, the correlation among betaine supplementation, hepatic GR expression, and hepatic lipogenesis is largely uncertain in hens. Betaine acts as a primary methyl donor for the epigenetic regulation of gene expression through DNA methylation (Anderson et al., 2012, Day and Kempson, 2016). Hypermethylation of the promoter regions leads to gene silencing because of blocking its accessibility by transcription machinery, whereas hypomethylation results in gene activation (Razin, 1998). Wang et al. reported decreasing hypermethylation pattern of hepatic MTTP gene promoter induced by a high-fat diet, which increased its mRNA expression, when male mice were fed betaine-supplemented diet (Wang et al., 2014). A study in laying hens abdominal fat revealed that betaine-supplemented diet increases FAS mRNA abundance and may affect the methylation status of its promoter (Xing and Jiang, 2012). Hu et al. reported that in ovo betaine injection induced SREBP1 and cholesterol metabolism-related genes expression in liver of newly hatched chicks (Hu et al., 2015). Nevertheless, it seems that betaine effect on lipids metabolism varies with animal species, sex, and physiological condition. Some studies concluded that the inhibition of hepatic FA synthesis as a mechanism by which betaine prevent or improve fatty liver syndrome (Song et al., 2007, Kathirvel et al., 2010, Xing et al., 2011). Therefore, we investigated the key gene expression involved in hepatic TG homeostasis, DNA methylation status of the promoter regions of the affected genes, and its binding activity of GR to further reveal the relationship between betaine supplementation and laying performance in hens.

Materials and methods

Animals and Treatment

As previously reported (Omer et al., 2018), one hundred and twenty 38-wk Rugao yellow breeders laying hens were randomly divided into 2 groups: control group (basal diet) and betaine group (basal diet supplemented with 0.5% pure betaine) as presented in Table 1. The betaine (75% purity) was purchased from the Skystone Feed Co., Ltd., Jiangsu, China. The laying performance was recorded daily throughout the 4-wk feeding period. Sixteen hens were randomly selected, weighed, and killed by rapid decapitation at the end of experiment. Blood samples were taken, and plasma was separated and stored at −20°C. Liver samples were dissected, snap frozen in liquid nitrogen then stored at −80°C.
Table 1

Composition of the experimental diets.1

Ingredient (%)CONBET
Corn65.0065.00
Soybean meal24.6724.67
Shell powder6.706.70
Limestone2.072.07
Salt0.300.30
Dicalcium phosphate0.830.83
Zeolite0.010.01
Choline chloride0.170.17
Methionine0.120.12
Vitamin premix20.030.03
Minerals premix30.100.10
Betaine0.000.50

CON, control group; BET, betaine group.

The vitamins premix contain (per kg): vitamin D3: 9,000,000 IU; vitamin K: 35,000,000 IU; vitamin B1: 10 g; vitamin B2: 28 g; vitamin B6: 12 g;vitamin B12: 80 mg; vitamin E: 140 g; vitamin K3: 9 g; D-Biotin: 5.60 g; D-pantothenic acid: 36 g; folic acid: 3.50 g; niacinamide: 100 g; ethoxyquin:1.65 g.

The minerals premix contain (per kg): Cu: 6.4 g; Fe: 72 g; Zn: 64g; Mn: 72 g; Se: 240 mg; I: 480 mg.

Composition of the experimental diets.1 CON, control group; BET, betaine group. The vitamins premix contain (per kg): vitamin D3: 9,000,000 IU; vitamin K: 35,000,000 IU; vitamin B1: 10 g; vitamin B2: 28 g; vitamin B6: 12 g;vitamin B12: 80 mg; vitamin E: 140 g; vitamin K3: 9 g; D-Biotin: 5.60 g; D-pantothenic acid: 36 g; folic acid: 3.50 g; niacinamide: 100 g; ethoxyquin:1.65 g. The minerals premix contain (per kg): Cu: 6.4 g; Fe: 72 g; Zn: 64g; Mn: 72 g; Se: 240 mg; I: 480 mg.

Determination of Hepatic and Plasma Triglyceride Concentration

The liver and plasma concentrations of triglyceride were examined by an automatic biochemical analyzer (Beckman coulter, AU2700) using commercial assay kits (E1013 and E1003, Applygen Technologies Inc., Beijing, China) following the manufacturer's instructions.

Histological Analysis of Liver Tissue

Liver samples were fixed in 4% paraformaldehyde, paraffin-embedded, sectioned, and then stained with hematoxylin-eosin. For Oil Red staining frozen sections of liver were used.

In Vitro Experiment

Fertilized chicken eggs at embryonic day 17 (E17) were obtained from a local farm and artificially incubated for an additional 2 D at 37.5°C and 60% relative humidity. Embryos E19 were euthanized by decapitation to collect livers. Livers were pooled, digested, and filtrated to get hepatocytes. Then the cell pellet was suspended in M199 medium (Shanghai Basalmedia Technologies Co., Ltd., Shanghai, China), supplemented with 10% fetal bovine serum. Hepatocytes were seeded onto 6-well plates, 2 mL/well. The cells density was about 5.5 × 106 cells/well. The cells were incubated for 24 h at 37.8°C with 5% CO2 before dosing. Then, hepatocytes were treated for 24 h with vehicle control, 10 mmol betaine, 100 nM β-estradiol, or combination of 10 mmol betaine with 100 nM β-estradiol, in a basal medium supplemented with insulin-transferrin-selenium mix (ITS 1 mg/mL; Sigma-Aldrich, St Louis, MO) (2 mL/well). After 24 h of treatment, cells were directly harvested and used for the subsequent experiment.

Total RNA Isolation and Real-Time PCR

Total RNA was isolated from frozen hens liver samples and the embryonic hepatocytes using TRIzol reagent (Invitrogen, Carlsbad, CA) and then reverse-transcribed to cDNA by HiScript qRT SuperMix (Vazyme Biotech Co., Ltd., Nanjing, China). Diluted cDNA (1:50, vol/vol) was used for real-time PCR with QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Foster City, CA). β-actin and 18s rRNA were selected as internal controls for normalization. All primers including those used for qRT-PCR (Table 2) were synthesized by Genewiz (Suzhou, China). Data were analyzed using the method of 2−ΔΔCT (Livak and Schmittgen, 2001).
Table 2

Nucleotide sequences of primers used for qRT-PCR.

Target genesGenBank accessionPrimer sequences (5′ to 3′)PCR products (bp)
APOB1NM_001044633.1F: GGTTACTCCCACGATGGCAAR: AATGCCCTTCCTTCAGGAGC113
APOV1NM_205483.2F: CTTAGCACCACTGTCCCTGAAGTR: TGCATCAGGGATGACCAGC130
ACCNM_205505.1F: TTGTGGCACAGAAGAGGGAAR: GTTGGCACATGGAATGGCAG161
FASNM_205155.2F: AAGCAATTCGTCACGGACAGR: GGCACCATCAGGACTAAGCA116
MTTPNM_001109784.2F: TTCTGAAGGACATGCGTGCTR: GTCTAGGCCGTACGTGGATG116
SCDNM_204890.1F: ACCTTAGGGCTCAATGCCACR: GTTCTCCCGTGGGTTGATGT93
SREBP1NM_204126.2F: GATGCGTTGGAGTACCTTCAGR: GTCACCCTTCAGCCAGTGAAT168
BHMTXM_414685.3F: TCTTCCTGAATTTCCCTTR: TGAACATCCCATCTAGTGA157
DNMT1NM_206952.1F: CGAGTGGGACGGCTTCTTR: AGGCGATAGGTGTCAGGGA144
GNMTXM_015283546.1F: GGAGGAGGGCTTCCAAGTGAR: GCTCCAGCGTCAGCCAGTT140
GRNM_001037826.1F: CTTCCATCCGCCCTTCAR: TCGCATCTGTTTCACCC203
β-actinNM_205518.1F: ATG GCTCCGGTATGTGCAAR: TGTCTTTCTGGCCCATACCAA120
18S rRNAMG967540.1F: ATAACGAACGAGACTCTGGCAR: CGGACATCTAAGGGCATCACA138

Abbreviations: ACC, acetyl-CoA carboxylase; APOB1, apolipoprotein B1; APOV1, apolipoprotein-V1; BHMT, betaine homocysteine methyltransferase; DNMT1, DNA (cytosine-5-)-methyltransferase 1; FAS, fatty acid synthase; GNMT, glycine-N-methyltransferase; GR, glucocorticoid receptor; MTTP, microsomal triglyceride transfer protein; SCD1, stearoyl-CoA desaturase 1; SREBP1, sterol regulatory element-binding protein-1.

Nucleotide sequences of primers used for qRT-PCR. Abbreviations: ACC, acetyl-CoA carboxylase; APOB1, apolipoprotein B1; APOV1, apolipoprotein-V1; BHMT, betaine homocysteine methyltransferase; DNMT1, DNA (cytosine-5-)-methyltransferase 1; FAS, fatty acid synthase; GNMT, glycine-N-methyltransferase; GR, glucocorticoid receptor; MTTP, microsomal triglyceride transfer protein; SCD1, stearoyl-CoA desaturase 1; SREBP1, sterol regulatory element-binding protein-1.

Protein Extraction and Western Blotting

Total protein of the hen's liver was extracted from 40 mg frozen tissues as previously described (Cai et al., 2014a). For cell, total protein was extracted using a lysis buffer purchased from Nanjing Sunshine Biotechnology. In brief, the culture dish was washed by gentle immersion in cold PBS for 2 times. The cells were then scratched to 1.5 mL tubes and centrifuged for 5 min at 700 × g to remove the PBS. The pellet was dissolved in 200 μL cold lysis buffer supplemented with protease inhibitor cocktail and then subjected to ultrasonication to insure cells destruction. Following centrifugation at 12,000 × g for 10 min, the supernatant was collected in new 1.5 mL tubes. Nuclear protein was extracted by a special kit (Beyotime Biotechnology, Wuhan, China). Protein concentrations were measured using a Pierce BCA Protein Assay kit (No. 23225; Thermo Fisher Scientific, Rockford, IL). Western blot analysis for SREBP1 (14088-1-AP, Proteintech, Rosemont, IL, diluted 1:500), SCD1 (2438, Cell Signaling Technology, Danvers, MA, diluted 1:500), BHMT (15965-1-AP, Proteintech, diluted 1:200), DNMT1 (24206-1-AP, Proteintech, diluted 1:1,000), GNMT (18,790, Proteintech, diluted 1:500), GR and MAT2b (15952-1-AP, Proteintech, diluted 1:1,000) was carried out according to the recommended protocols provided by the manufacturers. β-actin (AP0060, Bioworld, Dublin, OH, diluted 1:10,000), β-tubulin (AP0064, Bioworld, diluted 1:5,000) and histone H1 (BS1655, Bioworld, diluted 1:500) were used as loading control. Images were captured using VersaDoc 4,000 MP system, and the band density was analyzed by Quantity One software (Bio-Rad Laboratories, Hercules, CA).

Methylated DNA Immunoprecipitation Analysis

In brief, liver samples were extracted to obtain high-quality genomic DNA and then sonicated to approximately 500 bp sized fragments. Fragmented DNA was heat-denatured, methylated to obtain the immunoprecipitated methylated DNA fractions using a mouse monoclonal antibody against 5-methyl cytosine (ab10805, Abcam, Cambridge, UK). The immune complexes were treated using the protein G agarose beads (No. Sc-2003, Santa Cruz Biotechnology, Santa Cruz, CA), then washed via digestion buffer containing proteinase K (No. P0021, Nanjing Sunshine Biotechnology Ltd., Nanjing, China) to obtain purified methylated DNA immunoprecipitation (MeDIP) DNA. A small aliquot of MeDIP DNA and control input DNA was used to amplify the proximal promoter sequence of chicken SREBP1, ACC, SCD1, FAS, and MTTP genes by real-time PCR with specific primers listed in Table 3. Data were normalized against the input and presented as the fold change in comparison to the average value of the control group.
Table 3

Nucleotide sequences of primers used for MeDIP-PCR.

Target genesPrimer sequences (5′ to 3′)PCR products (bp)
SREBP1 Segment 1F: AACGGGTCCCGGTGTTACR: GGCGCAGCCTTTAGGACC192
SREBP1 Segment 2F: CTCAGCTCCATCTGACCCACR: TTGGGGGCAATGAGGTTTGA190
SREBP1 Segment 3F: GTGGTCTGGGTCGTTGCCR: GAAGACGCCCCGTAACCCAA226
SREBP1 Segment 4F: CAGGACCGCCGTGATGTCR: CTCCCCCAAAAACAGGAGGG238
ACC Segment 1F: ATCGGCATCTCCTCATTGGCR: CCTGGTGCAGGGCAGC272
ACC Segment 2F: CCACCGTCGGTTGGGTTCR: CCATTGGCTGCTGACGGA264
ACC Segment 3F: CAGCTGTGGAGAGGTTTCCCR: CACCGCCTGAACCCTCC247
ACC Segment 4F: AGCAATCACTCCTCCAGCATR: CGTGGGAAACCTCTCCACAG269
SCD1 Segment 1F: CACCTCCCCTTCTGGGCAR: CTACCGTGTCCCTGTCCCT280
SCD1 Segment 3F: CATTCTTTCCAATTCGCTGGCR: GGCTTGCCCTCGCCATT205
SCD1 Segment 3F: ACACGGTGGGGTTAGGAGAGR: CTGGTGGAGGGCAGAAGAAG220
SCD1 Segment 4F: TGTGTCTGAGAGCAGGCAAGR: ACAGTGGGGCTGATTCAGTG239
FAS Segment 1F: GACTGCGGCGAGGAGTAAACR: CGTAGCGCGGACGGTTC216
FAS Segment 2F: ACCGAAAGGCAGACATCCGAR: AGGGTGTTGCTAGGCGATAAG253
FAS Segment 3F: ACAACAAGCGGTAACAACGATR: TTCCTTGCACAAGCCGGTAG206
FAS Segment 4F: GCAACGTGCTGTTAGAAAGGGR: CCTTCCTGGGAAGAGCTGTG255
MTTP Segment 1F: GGCTGCATGGGCATTCAAAAATR: CAAGAAGCGAACTGCTGACAATGG221
MTTP Segment 2F: AGGAGCAGATTCCTCCCAGTF: GCACACGTTTCCCCATTTCC227
MTTP Segment 3F: ACCGCGGATTAAAAGGAGCAR: CGCTAAGGTCACAAGAGCCA228
MTTP Segment 4F: GGGTGTGGTGGTGAATCGTAR: ATTTGGACAGGATGCCAGGG241

Abbreviations: ACC, acetyl-CoA carboxylase; FAS, fatty acid synthase; MTTP, microsomal triglyceride transfer protein; SCD1, stearoyl-CoA desaturase 1; SREBP1, sterol regulatory element-binding protein-1.

Nucleotide sequences of primers used for MeDIP-PCR. Abbreviations: ACC, acetyl-CoA carboxylase; FAS, fatty acid synthase; MTTP, microsomal triglyceride transfer protein; SCD1, stearoyl-CoA desaturase 1; SREBP1, sterol regulatory element-binding protein-1.

Chromatin Immunoprecipitation Analysis

The glucocorticoid receptor element (GRE) binding sites are predicted on the promoter sequences of target genes (SREBP1, ACC, SCD1, FAS, MTTP, ApoB, and ApoV1) using the online software, PROMO (Messeguer et al., 2002, Farré et al., 2003). Chromatin immunoprecipitation (ChIP) analysis was performed as previously described (Cai et al., 2014b). In brief, liver samples were ground, suspended, cross-linked, and sonicated to obtain an average chromatin fragment size of 300–500 bp. Sheard chromatin was precleared, incubated overnight, and treated using protein A/G agarose beads to capture the immunoprecipitated complexes. Finally, DNA fragments were released from immunoprecipitated complexes via reverse cross-linking and then used as template for real-time PCR with specific primers (Table 4).
Table 4

Nucleotide sequences of primers used for ChIP-PCR.

Target genesPrimer sequences (5′ to 3′)PCR products (bp)
SREBP1F: TGATGCGCGATCACCCCAR: AAACCCCGCCCGTAGAAC71
ACCF: CCAGCACAGCACTTGGTTTCR: GCAGAGTTAGGCTTCTGCCA76
SCD1F: TTGCCAGCCACCTCTGGATAR: GGCAGCTGTCAAAAGTGAGC104
FASF: AGATGGCAAAGAAGGGTGGCR: GTCGGCTGGAGTCATTGCTT90
MTTPF: GTAACAGGCATACAACTGGCTGR: AGAATGTTAGAGGCCAGATCCC78
APOB1F: ACATGAACACATTCTGAGTTGCCR: TGTGCGATTTAGGCATCTTCCC168
APOV1F: CAAATGTTCTGCCTCCTGTTCAAR: AGCCCATTGGGTCTTCAGTAA76

Abbreviations: ACC, acetyl-CoA carboxylase; APOB1, apolipoprotein B1; APOV1, apolipoprotein-V1; FAS, fatty acid synthase; MTTP, microsomal triglyceride transfer protein; SCD1, stearoyl-CoA desaturase 1; SREBP1, sterol regulatory element-binding protein-1.

Nucleotide sequences of primers used for ChIP-PCR. Abbreviations: ACC, acetyl-CoA carboxylase; APOB1, apolipoprotein B1; APOV1, apolipoprotein-V1; FAS, fatty acid synthase; MTTP, microsomal triglyceride transfer protein; SCD1, stearoyl-CoA desaturase 1; SREBP1, sterol regulatory element-binding protein-1.

Statistical Analysis

All data are presented as means ± SEM. Comparisons were performed using independent-samples t test and analysis of variance when applicable, with SPSS18.0 for Windows. The data were considered statistically significant when the P-value was less than 0.05.

Results

Laying Performance

Dietary betaine supplementation significantly enhanced egg-laying rate (P < 0.05) but did not affect body weight, average daily feed intake, and egg weight (Table 5).
Table 5

Production performance in laying hens.

ParametersCONBETP-value
Initial body weight, kg1.40 ± 0.011.41 ± 0.010.33
Final body weight, kg1.42 ± 0.021.43 ± 0.020.60
Average daily feed intake, g/D91.03 ± 1.1895.95 ± 2.820.15
Average daily laying rate, %80.19 ± 1.1284.50 ± 0.960.03
Egg weight, g43.09 ± 0.4442.01 ± 0.410.31

Abbreviations: BET, betaine group; CON, control group.

Production performance in laying hens. Abbreviations: BET, betaine group; CON, control group.

Hepatic and Plasma Concentration of TG

Oil red staining showed increasing hepatic lipids droplet in hens supplemented with betaine (Figure 1A). Betaine supplementation markedly elevated hepatic and plasma concentration of TG (P < 0.05) (Figures 1B and 1C).
Figure 1

Plasma and liver concentration of TG and histological analysis of liver tissue. (A) Top: Hematoxylin and eosin (H&E) staining; middle and bottom: oil red staining. (B) Hepatic TG concentration. (C) Plasma TG concentration. Values are means ± SEM, *P < 0.05, compared with control (n = 8). Abbreviation: TG, triacylglycerol.

Plasma and liver concentration of TG and histological analysis of liver tissue. (A) Top: Hematoxylin and eosin (H&E) staining; middle and bottom: oil red staining. (B) Hepatic TG concentration. (C) Plasma TG concentration. Values are means ± SEM, *P < 0.05, compared with control (n = 8). Abbreviation: TG, triacylglycerol.

Hepatic Expression of Genes Involved in Fatty Acid Synthesis and VLDL Formation and Export

Dietary betaine greatly enhanced (P < 0.05) the mRNA and protein level of SREBP-1 and SCD1 in addition to enhancing mRNA expression of FAS and ACC (Figures 2A and 2C). These genes are key regulators for hepatic lipogenesis. Meanwhile, betaine supplementation upregulated MTTP, ApoB, and ApoV1 expression at the mRNA level (P < 0.05), which involved in TG synthesis and export to extrahepatic tissues (Figure 2B). Protein expression of these genes was not carried out because of a lack of chicken specific antibodies.
Figure 2

Effect of betaine supplemented diet on the expression of main genes involved in hepatic lipogenesis and TG and VLDL formation and export in hens. (A) mRNA expression of SREBP1, ACC, SCD1, and FAS. (B) mRNA expression of ApoB, ApoV1, and MTTP. (C) Protein expression of SREBP1 and SCD1. Values are means ± SEM, *P < 0.05, compared with control (n = 8). Abbreviations: ACC, acetyl-CoA carboxylase; ApoB, apolipoprotein B; ApoV1, apolipoprotein-V1; FAS, fatty acid synthase; MTTP, microsomal triglyceride transfer protein; SCD1, stearoyl-CoA desaturase 1; SREBP1, sterol regulatory element-binding protein-1.

Effect of betaine supplemented diet on the expression of main genes involved in hepatic lipogenesis and TG and VLDL formation and export in hens. (A) mRNA expression of SREBP1, ACC, SCD1, and FAS. (B) mRNA expression of ApoB, ApoV1, and MTTP. (C) Protein expression of SREBP1 and SCD1. Values are means ± SEM, *P < 0.05, compared with control (n = 8). Abbreviations: ACC, acetyl-CoA carboxylase; ApoB, apolipoprotein B; ApoV1, apolipoprotein-V1; FAS, fatty acid synthase; MTTP, microsomal triglyceride transfer protein; SCD1, stearoyl-CoA desaturase 1; SREBP1, sterol regulatory element-binding protein-1.

MeDIP Analysis for DNA Methylation Status on the Promoter of Affected Genes

Schematic diagram of promoter sequences of chicken SREBP1, ACC, FAS, SCD1, and MTTP are shown in Figures 3A–3E. Four segments (designated S1-S4) from the promoter of each gene were analyzed with MeDIP-PCR. Betaine supplementation markedly (P < 0.05) induced hypermethylation of S1 and S4 of SREBP1 promoter (Figure 3A), S1 and S2 of ACC promoter (Figure 3B), S1 and S2 of FAS promoter (Figure 3C), S1 and S2 of SCD1 promoter (Figure 3D), and S3 of MTTP promoter (Figure 3E). MeDIP for ApoB and ApoV1 genes was not performed because their promoter sequences contain few CpGs, which make them difficult to construct primers for MeDIP-PCR.
Figure 3

Methylation status on the promoter of SREBP1, ACC, FAS, SCD, and MTTP genes in the liver of hens detected by MeDIP-PCR. (A) Left: DNA methylation status on 4 segments (S) of SREBP1 promoter; right: schematic diagram showing the amplified segments and their sequences. (B) Left: DNA methylation status on 4 segments of ACC promoter; right: schematic diagram showing the amplified segments and their sequences. (C) Left: DNA methylation status on 4 segments of FAS promoter; right: schematic diagram showing the amplified segments and their sequences. (D) Left: DNA methylation status on 4 segments of SCD promoter; right: schematic diagram showing the amplified segments and their sequences. (E) Left: DNA methylation status on 4 segments of MTTP promoter; right: schematic diagram showing the amplified segments and their sequences. Values are means ± SEM, *P < 0.05, compared with control (n = 3). Abbreviations: ACC, acetyl-CoA carboxylase; FAS, fatty acid synthase; MeDIP, methylated DNA immunoprecipitation; MTTP, microsomal triglyceride transfer protein; SCD, stearoyl-CoA desaturase; SREBP1, sterol regulatory element-binding protein-1.

Methylation status on the promoter of SREBP1, ACC, FAS, SCD, and MTTP genes in the liver of hens detected by MeDIP-PCR. (A) Left: DNA methylation status on 4 segments (S) of SREBP1 promoter; right: schematic diagram showing the amplified segments and their sequences. (B) Left: DNA methylation status on 4 segments of ACC promoter; right: schematic diagram showing the amplified segments and their sequences. (C) Left: DNA methylation status on 4 segments of FAS promoter; right: schematic diagram showing the amplified segments and their sequences. (D) Left: DNA methylation status on 4 segments of SCD promoter; right: schematic diagram showing the amplified segments and their sequences. (E) Left: DNA methylation status on 4 segments of MTTP promoter; right: schematic diagram showing the amplified segments and their sequences. Values are means ± SEM, *P < 0.05, compared with control (n = 3). Abbreviations: ACC, acetyl-CoA carboxylase; FAS, fatty acid synthase; MeDIP, methylated DNA immunoprecipitation; MTTP, microsomal triglyceride transfer protein; SCD, stearoyl-CoA desaturase; SREBP1, sterol regulatory element-binding protein-1.

ChIP Analysis for GR Binding on the Promoter of Lipogenic Genes

Schematic diagram of promoter sequences of SREBP1 and ApoB are shown in Figures 4A and 4B, respectively. Dietary betaine significantly (P < 0.05) affect GR binding to GRE at promoter regions of SREBP1 and ApoB gene (Figure 4C). Other genes were not affected by betaine.
Figure 4

GR binding to the promoter of affected genes. (A) Schematic diagram showing the promoter sequences of chicken SREBP1 gene. (B) Schematic diagram showing the promoter sequences of chicken ApoB gene. (C) ChIP assays of GR binding on the promoter of SREBP1, ACC, SCD1, FAS, MTTP, ApoB, and ApoV1. Values are means ± SEM, *P < 0.05, compared with control (n = 3). Abbreviations: ACC, acetyl-CoA carboxylase; APOB1, apolipoprotein B1; APOV1, apolipoprotein-V1; FAS, fatty acid synthase; GR, glucocorticoid receptor; MTTP, microsomal triglyceride transfer protein; SCD1, stearoyl-CoA desaturase 1; SREBP1, sterol regulatory element-binding protein-1.

GR binding to the promoter of affected genes. (A) Schematic diagram showing the promoter sequences of chicken SREBP1 gene. (B) Schematic diagram showing the promoter sequences of chicken ApoB gene. (C) ChIP assays of GR binding on the promoter of SREBP1, ACC, SCD1, FAS, MTTP, ApoB, and ApoV1. Values are means ± SEM, *P < 0.05, compared with control (n = 3). Abbreviations: ACC, acetyl-CoA carboxylase; APOB1, apolipoprotein B1; APOV1, apolipoprotein-V1; FAS, fatty acid synthase; GR, glucocorticoid receptor; MTTP, microsomal triglyceride transfer protein; SCD1, stearoyl-CoA desaturase 1; SREBP1, sterol regulatory element-binding protein-1.

Effect of Betaine on the Expression of ApoV1, GR, and Methionine Cycle-Related Genes In Vitro

Embryonic hepatocytes were treated with β-estradiol (E2) to initiate the synthesis of ApoV1 because its expression is dependent on estrogen. Betaine together with E2 have a maximal effect on ApoV1 expression than E2 alone (Figure 5A). Betaine supplementation greatly (P < 0.05) enhanced GR expression at the mRNA and protein levels, whereas E2 treatment had no effect (Figures 5B and 5C, respectively). Hepatocytes treated with betaine, but not E, had significantly (P < 0.05) higher mRNA and protein level of genes involved in liver methionine cycle named BHMT, GNMT, and DNMT1 (Figures 5D and 5E). The expression of MAT2b was not changed by either betaine or E2.
Figure 5

Effect of betaine on the expression of ApoV1, GR, and methionine cycle related genes in vitro. (A) mRNA expression of ApoV1, (B) mRNA expression of GR. (C) Protein expression of GR. (D) mRNA expression of BHMT, GNMT, DNMT1, MAT2b. (E) Protein expression of BHMT, GNMT, DNMT1, MAT2b. Values are means ± SEM, different letters above the bars indicate significantly different mean value at P < 0.05 compared with control, *P < 0.05, **P < 0.01, (n = 3). ND: Ct was not detectable. Abbreviations: APOV1, apolipoprotein-V1; BHMT, betaine homocysteine methyltransferase; DNMT1, DNA (cytosine-5-)-methyltransferase 1; GNMT, glycine-N-methyltransferase; GR, glucocorticoid receptor; MAT2b, methionine adenosyltransferase 2 subunit beta; MTTP, microsomal triglyceride transfer protein.

Effect of betaine on the expression of ApoV1, GR, and methionine cycle related genes in vitro. (A) mRNA expression of ApoV1, (B) mRNA expression of GR. (C) Protein expression of GR. (D) mRNA expression of BHMT, GNMT, DNMT1, MAT2b. (E) Protein expression of BHMT, GNMT, DNMT1, MAT2b. Values are means ± SEM, different letters above the bars indicate significantly different mean value at P < 0.05 compared with control, *P < 0.05, **P < 0.01, (n = 3). ND: Ct was not detectable. Abbreviations: APOV1, apolipoprotein-V1; BHMT, betaine homocysteine methyltransferase; DNMT1, DNA (cytosine-5-)-methyltransferase 1; GNMT, glycine-N-methyltransferase; GR, glucocorticoid receptor; MAT2b, methionine adenosyltransferase 2 subunit beta; MTTP, microsomal triglyceride transfer protein.

Discussion

In the current study, betaine supplementation enhanced egg laying rate accompanied with increased plasma and liver TG concentration and induced hepatic mRNA expression of the major lipogenic genes, SREBP1, ACC, FAS, and SCD, as well as MTTP, APOB, and APOV1 which are involved in TG synthesis and export. In vitro experiments revealed that betaine treated cells had higher expression of GR, APOV1, and the methyl-transfer enzymes BHMT, GNMT, and DNMT1. In laying hens, the physiological mechanism of egg formation requires the synthesis of yolk precursors, VTG, and VLDL-yolk in the liver (Vézina et al., 2003). Previously, we reported activation of hepatic VTGII expression plays a role in improving egg production in betaine-fed laying hens (Omer et al., 2018). Similar to other studies, our study also revealed an increase liver synthesis of FA and TG during egg laying in birds to maintain the demand for yolk formation (Furuse et al., 1991, Nys and Guyot, 2011). However, part of our results is contradicted with other studies in mice and rats, which concluded inhibiting lipogenesis as a result of betaine administration. In apolipoprotein E–deficient mice, Wang et al. reported that betaine reduced hepatic TG and alter the expression of hepatic lipid metabolism-related genes and especially reduced the expression of FAS (Wang et al., 2013). Another study revealed that betaine significantly attenuated the high-sucrose diet–induced hepatic steatosis which was associated with reduced hepatic lipogenic enzyme activities and gene expression in mice (Song et al., 2017). In rats, Ahn et al. reported that inhibition of lipid synthesis was one of the factors responsible for the antisteatotic activity of betaine (Ahn et al., 2015). It is noticed that most of these studies were conducted in male rather than female animals. Another observation is the use of induced hepatic steatosis model and trying to alleviate the change with betaine. Yet, our data indicating betaine enhanced hepatic lipid export and increased serum TG were in line with some studies in human and rats. For instance, Olthof et al. reported increasing blood TG concentrations in healthy human subject when betaine supplemented orally for 6 wks (Olthof et al., 2005). Sparks et al. reported increased hepatic ApoB mRNA level accompanied by higher serum concentration of TG and ApoB in rats fed betaine-supplemented diet (Sparks et al., 2006). Xu et al. and Ahn et al. stated that betaine improved liver lipid accumulation via increasing hepatic lipid exportation and FA oxidation in rats given high-fat diet (Ahn et al., 2015, Xu et al., 2015). Nevertheless, sex differences, physiological status, diet composition, experimental condition, organ specificity, as well as species differences should be considered when dealing with the effect of betaine on lipids metabolism. We observed increased oil droplets in the liver section of betaine fed hens. Again this result disagrees with other findings assumed hypolipidimic effect of betaine. But it is in agreement with Hayes et al. (Hayes et al., 2003) who observed increased fat droplets in rat hepatocytes following betaine intake. He suggested that betaine might stimulate both synthesis and secretion of VLDL. However, owing to a limitation in the protein supply, there was a brake on apolipoprotein formation. The consequence leads to an imbalance between synthesis and export which lead to increasing fat droplets in the liver. It is worth to do a further in-depth investigation to test the above hypothesis with different conditions, such as higher dietary protein level. In the present study, MeDIP results showed that betaine supplementation lowered the methylation status of the promoter region of target genes. It is not new phenomenon that betaine as a methyl donor, induced promoter hypomethylation. Previously, we showed that betaine reduced the methylation status of the GR gene promoter (Omer et al., 2018). Moreover, Wang et al. reported that addition of betaine decreased methylation level of hepatic PPARα promoter in mice and suggested that betaine selectively decrease the methylation status of certain genes involved in lipid metabolism (Wang et al., 2013). CpG hypomethylation of gene promoter may promote the binding activity of transcription factor to its specific response element (Moore ey al., 2013). In fact, hypomethylation on one of the analyzed segment of SREBP1 gene promoter was matched by a predicted GRE and might contribute to the increased GR binding, which was detected by ChIP method in the liver of betaine-fed hens. Glucocorticoid receptor is known regulator of several genes encoding enzymes in FA and TG synthesis (Wang et al., 2012). Furthermore, apart from GR effect, SREBP1 alone is well-known master regulator of lipids homeostasis (Horton et al., 2002, Eberlé et al., 2004). This study demonstrated that dietary betaine supplementation induced hepatic lipogenesis as well as TG formation and VLDL export in laying hens. These changes were associated with alteration in the expression, promoter methylation, and GR binding to some genes involved. Our findings suggested a distinct mechanism for improved eggs production by betaine supplementation in hens. However, further studies are necessary to determine the limitation regarding timing and dose, in addition to impact of treatment on animal health and welfare.
  37 in total

1.  Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN.

Authors:  Domènec Farré; Romà Roset; Mario Huerta; José E Adsuara; Llorenç Roselló; M Mar Albà; Xavier Messeguer
Journal:  Nucleic Acids Res       Date:  2003-07-01       Impact factor: 16.971

Review 2.  Increased very low density lipoprotein (VLDL) secretion, hepatic steatosis, and insulin resistance.

Authors:  Sung Hee Choi; Henry N Ginsberg
Journal:  Trends Endocrinol Metab       Date:  2011-05-26       Impact factor: 12.015

3.  Expression and methylation of microsomal triglyceride transfer protein and acetyl-CoA carboxylase are associated with fatty liver syndrome in chicken.

Authors:  Zhen Liu; Qinghe Li; Ranran Liu; Guiping Zhao; Yonghong Zhang; Maiqing Zheng; Huanxian Cui; Peng Li; Xiaoyan Cui; Jie Liu; Jie Wen
Journal:  Poult Sci       Date:  2016-04-14       Impact factor: 3.352

Review 4.  SREBP transcription factors: master regulators of lipid homeostasis.

Authors:  Delphine Eberlé; Bronwyn Hegarty; Pascale Bossard; Pascal Ferré; Fabienne Foufelle
Journal:  Biochimie       Date:  2004-11       Impact factor: 4.079

Review 5.  Estrogen induction of VLDLy assembly in egg-laying hens.

Authors:  R L Walzem; R J Hansen; D L Williams; R L Hamilton
Journal:  J Nutr       Date:  1999-02       Impact factor: 4.798

6.  The metabolic cost of avian egg formation: possible impact of yolk precursor production?

Authors:  François Vézina; Katrina G Salvante; Tony D Williams
Journal:  J Exp Biol       Date:  2003-12       Impact factor: 3.312

7.  Regulation of triglyceride metabolism by glucocorticoid receptor.

Authors:  Jen-Chywan Wang; Nora E Gray; Taiyi Kuo; Charles A Harris
Journal:  Cell Biosci       Date:  2012-05-28       Impact factor: 7.133

8.  Genome-wide analysis of glucocorticoid receptor binding regions in adipocytes reveal gene network involved in triglyceride homeostasis.

Authors:  Chi-Yi Yu; Oleg Mayba; Joyce V Lee; Joanna Tran; Charlie Harris; Terence P Speed; Jen-Chywan Wang
Journal:  PLoS One       Date:  2010-12-20       Impact factor: 3.240

9.  Kisspeptin-10 enhanced egg production in quails associated with the increase of triglyceride synthesis in liver.

Authors:  J Wu; W Fu; Y Huang; Y Ni; R Zhao
Journal:  Asian-Australas J Anim Sci       Date:  2013-08       Impact factor: 2.509

10.  Betaine supplementation in maternal diet modulates the epigenetic regulation of hepatic gluconeogenic genes in neonatal piglets.

Authors:  Demin Cai; Yimin Jia; Haogang Song; Shiyan Sui; Jingyu Lu; Zheng Jiang; Ruqian Zhao
Journal:  PLoS One       Date:  2014-08-25       Impact factor: 3.240

View more
  6 in total

1.  Betaine Promotes Fat Accumulation and Reduces Injury in Landes Goose Hepatocytes by Regulating Multiple Lipid Metabolism Pathways.

Authors:  Jiying Liu; Ruilong Song; Shengyan Su; Nannan Qi; Qifa Li; Zhuang Xie; Shali Yu
Journal:  Animals (Basel)       Date:  2022-06-13       Impact factor: 3.231

2.  Dietary herbaceous mixture supplementation reduced hepatic lipid deposition and improved hepatic health status in post-peak laying hens.

Authors:  Yao Zhu; Xiangli Zhang; Pengfei Du; Ziyang Wang; Pengna Luo; Yanqun Huang; Zhenhua Liu; Huaiyong Zhang; Wen Chen
Journal:  Poult Sci       Date:  2022-03-24       Impact factor: 4.014

3.  Parental methyl-enhanced diet and in ovo corticosterone affect first generation Japanese quail (Coturnix japonica) development, behaviour and stress response.

Authors:  Kay Boulton; Peter W Wilson; Valerie R Bishop; Jonathan H Perez; Toby Wilkinson; Kris Hogan; Natalie Z M Homer; Christelle Robert; Jacqueline Smith; Simone L Meddle; Ian C Dunn; Kellie Watson
Journal:  Sci Rep       Date:  2021-10-26       Impact factor: 4.379

4.  Examining the extent of environmental contributions toward DNA methylation and phenotypic variation.

Authors:  Emory Pacht; Brenda Murdoch; Stephanie McKay
Journal:  Anim Front       Date:  2021-12-17

5.  Betaine Alleviates LPS-Induced Chicken Skeletal Muscle Inflammation with the Epigenetic Modulation of the TLR4 Gene.

Authors:  Feng Guo; Mengna Jing; Aoyu Zhang; Yan Yu; Pei Gao; Qiuxia Wang; Li Wang; Zhiyong Xu; Jinyou Ma; Yanhong Zhang
Journal:  Animals (Basel)       Date:  2022-07-26       Impact factor: 3.231

6.  GR-mediated transcriptional regulation of m6A metabolic genes contributes to diet-induced fatty liver in hens.

Authors:  Yue Feng; Yanlin Li; Wenduo Jiang; Yun Hu; Yimin Jia; Ruqian Zhao
Journal:  J Anim Sci Biotechnol       Date:  2021-12-07
  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.