Characterization of occult hepatitis B in high-risk populations in Kenya.

Occult hepatitis B infection (OBI) is defined as the presence of hepatitis B virus (HBV) DNA in the liver or serum in the absence of detectable HBV surface antigen (HBsAg). OBI poses a risk for the development of cirrhosis and hepatocellular carcinoma. The prevalence of OBI in Kenya is unknown, thus a study was undertaken to determine the prevalence and molecular characterization of OBI in Kenyan populations at high risk of HBV infection. Sera from two Nairobi cohorts, 99 male sex workers, primarily having sex with men (MSM-SW), and 13 non-MSM men having HIV-positive partners, as well as 65 HBsAg-negative patients presenting with jaundice at Kenyan medical facilities, were tested for HBV serological markers, including HBV DNA by real-time PCR. Positive DNA samples were sequenced and MSM-SW patients were further tested for hepatitis C virus (HCV) infection. Of the 166 HBsAg-negative samples tested, 31 (18.7%; 95% confidence interval [CI] 13.5-25.3) were HBV DNA positive (i.e., occult), the majority (20/31; 64.5%) of which were HBV core protein antibody positive. HCV infection was not observed in the MSM-SW participants, although the prevalence of HBsAg positivity was 10.1% (10/99; 95% CI 5.6-17.6). HBV genotype A was predominant among study cases, including both HBsAg-positive and OBI participants, although the data suggests a non-African network transmission source among MSM-SW. The high prevalence of HBV infection among MSM-SW in Kenya suggests that screening programmes be instituted among high-risk cohorts to facilitate preventative measures, such as vaccination, and establish entry to treatment and linkage to care.

Introduction

Infection with hepatitis B virus (HBV) in which viral surface antigen (HBsAg) is undetectable yet HBV DNA is detectable in the liver, and possibly in the serum, defines occult hepatitis B infection (OBI) [1]. Other concurrent serological markers of HBV infection, including antibody to the core (anti-HBc) or surface (anti-HBs) proteins are often present, but seronegative OBI in which HBV DNA is the only detectable marker of infection is also observed [2]. The clinical impact of OBI includes progression to severe liver disease, a risk of reactivation during immunosuppression and an ongoing risk of transmission in the context of misdiagnosis due to the lack of detectable HBsAg [3] OBI is more frequently found in populations at high risk of infection (HIV infected or people who inject drugs [PWID]) [4] and endemic regions of the world (≥8% prevalence) [5]. HBV is present at intermediate endemicity (2% to 7%) throughout sub-Saharan Africa, at approximately 6.1% [6] and has been suggested to be a neglected tropical disease disproportionately affecting this region [7]. Understandably then, OBI is fairly prevalent throughout Africa, ranging from approximately 7% to 50% in ‘low-risk’ populations comprised of blood donors or healthcare workers [8-11] to approximately 6% to 30% in HIV infected populations [12-15]. The prevalence of HBV infection in Kenya is estimated to be between 1% to 5% [16], although rates among specific high-risk populations (HIV co-infected, PWID, jaundiced patients seeking medical care) are much higher [17-19]. As the prevalence of OBI in Kenya is not known, the aim of this study was to investigate and characterize OBI in several Kenyan populations at high risk of infection; jaundiced patients seeking medical care, men having HIV-positive partners and male sex workers.

Materials and methods

Specimen collection

Ninety-nine specimens of archived sera from a follow-up sampling study to the 2009–2015 cohort study of Nairobi male sex workers primarily having sex with men (MSM-SW) described by McKinnon, et al. [20] were included in the study. The cohort peer referral convenience sampling investigation collected specimens from 127 participants, of which 99 had sufficient serum volume for investigation of OBI and thus was the basis for their selection in the current study. Similarly, the follow up sampling study also included 20 men, to serve as controls, who reported never engaging in receptive anal intercourse (“non-MSM men”) and were in a serodiscordant relationship with an HIV-positive female partner. Thirteen specimens from the non-MSM cohort were included, based on the presence of sufficient serum volume for investigation of OBI. Demographic and behavioural characteristics of MSM-SW participants were collected during the original cohort studies, as was the HIV status of all MSM-SW and non-MSM men. All non-MSM participants were HIV negative, while 46.5% (46/99) of MSM-SW men were HIV positive. Thirty-two MSM-SW men (31 HIV negative, 1 HIV positive) had also been vaccinated with the HBV vaccine during a simulated HIV-1 vaccine feasibility trial (Kavi Institute of Clinical Research) without knowledge of their HBV status at the time of vaccination. Alanine aminotransferase levels of participants within each cohort were not available for analysis in this study. HBsAg negative archived sera from jaundiced patients seeking medical care at four select hospitals throughout Kenya: Kenyatta National Hospital (Nairobi), Moi Teaching and Referral Hospital (Eldoret), New Nyanza Provincial General Hospital (Kisumu), and Coast General Hospital (Mombasa) as described by Ochwoto, et al. [19] were also included in the study. The original study included 164 HBsAg negative specimens, 65 of which had sufficient serum volume remaining for investigation of OBI and thus was the basis for their selection in the current study. All jaundiced patients included in this study had been tested for antibody to hepatitis C virus (HCV) in the original study and were found to be negative [19].

Serological testing

Specimens from the archived serum banks were initially tested for anti-HBc and HBsAg by electrochemiluminescence EIA followed by HBV DNA testing (S1 Fig). MSM-SW samples were also tested for the presence of antibody to HCV. All serological tests were performed using the COBAS e411 platform (Elecsys; Roche Diagnostics, Quebec, Canada).

HBV DNA testing and phylogenetic analysis

Nucleic acid was extracted from 200 μL sera using an automated nucleic acid extraction system (NucliSENS easyMag, bioMerieux Inc, Saint-Laurent, QC) and eluted in 60 μL elution buffer. HBV DNA was initially detected by real-time PCR involving 3 concurrently probed genomic regions [21]. In brief, 15 μL of DNA extract was added to a reaction mixture including QuantiTect virus master mix (Qiagen, Toronto, ON), reference dye solution and a primer-probe mix (Table 1) specific for the HBsAg-coding region (nt 228–371, based on GenBank reference sequence AY128092), or the ENHI regulatory region (nt 1178–1281), or the X/ENHII genomic region (nt 1549–1671). Primers and probes were prepared by Integrated DNA Technologies (Kanata, ON) with oligonucleotide probes having a 5’ 6-FAM fluorescent reporter dye and a double quencher (ZEN/3’IB) combination. Reaction mixtures were amplified using an Applied Biosystems 7500 real-time PCR system (ThermoFisher Scientific, Burlington, ON) including 50 cycles of 95°C for 15s, 60°C for 45s. Specimens were considered to be HBV DNA positive if at least two genomic regions were positive by real-time PCR. The real-time PCR method was validated against a panel of approximately 250 specimens having a viral load <6 IU/mL or “target not detected” as determined by the Cobas High Pure System/TaqMan HBV Test, as well as sensitive nested PCR of all DNA extracts [22, 23]. Ct cut-offs, below which the specimen was considered to be positive for HBV DNA, as detected for each genomic region were determined following validation, and were as follows: 37.77 (HBsAg-coding region), 40.82 (ENHI regulatory region), 38.33 (X/ENHII genomic region).

Table 1

Primer and probe sequences for HBV DNA detection and sequence analysis.

Primer or Probe name	5’—3’ sequence	Approximate genomic regiona
Surface-FWD primer	TCCTCACAATACCRCAGAGT	228–247
Surface-REV primer	GATARCCAGGACAARTTGGAG	371–351
Surface real time PCR probe	AAAATTCGCAGTCCCCAACCTCCA	306–329
ENHI-FWD primer	AAGTGTTTGCTGACGCAA	1178–1195
ENHI-REV primer	GAGTTCCGCAGTATGGATC	1281–1263
ENHI real time PCR probe	CCATCRGCGCATGCGYGGAA	1224–1243
X/ENHII-FWD primer	CCGTCTGTTCCTTCTCATCTG	1549–1569
X/ENHII-REV primer	GTCCAAGAGTCCTCTTATGYAAG	1671–1649
X/ENHII real time PCR probe	TGCACTTCGCTTCACCTCTGCAC	1580–1602
HBPr134 first stage FWD	TGCTGCTATGCCTCATCTTC	414–433
HBPr135 first stage REV	CARAGACAAAAGAAAATTGG	822–803
HBPr75 nested stage FWD	CAAGGTATGTTGCCCGTTTGTCC	455–477
HBPr94 nested stage REV	GGYAWAAAGGGACTCAMGATG	795–775

aAccording to GenBank Accession AY128092 nucleotide numbering.

For amplification and sequencing of HBV DNA, 150 μL HBsAg positive or OBI positive study samples were extracted and PCR amplified using first stage and nested primers specific for the HBsAg-coding region, as described by Stuyver, et al. [23] (HBVPr134/135 and HBVPr94/75; Table 1). Amplicons were gel purified and cycle sequenced using an Applied Biosystems 3730 XL DNA Analyzer (ThermoFisher Scientific, Burlington, ON). Sequences were aligned and trimmed using Clustal X v2.0.11 [24] and BioEdit v7.2.5 [25], respectively. Maximum likelihood analysis of the partial HBsAg-coding region (trimmed to 327 bp representing nt 458 to 784, based on GenBank accession AY128092) was performed using DIVEIN software [26] by the GTR+γ+I model determined as the most appropriate substitution model for the alignment. Phylogenetic tree construction was optimized by nearest neighbour interchange and subtree pruning and regrafting with branch support computed by the approximate likelihood-ratio test based on a Shimodaira-Hasegawa-like procedure [27]. Nucleotide sequence alignments were translated to amino acid in order to determine the presence of mutations affecting susceptibility to antiviral therapies (any variant at reverse transcriptase amino acid sites rtI169, rtV173, rtL180, rtA181, rtT184, rtV191, rtA194, rtS202, rtM204 was noted) and immune recognition of the HBsAg protein (any variant at HBsAg amino acid sites P105, T116, T118, G119, K/R122, S/T123, C124, T/I126, P127, Q129, T/N131, M133, S136, C139, T140, K141, P142, S/T143, D144, G145, E164, P178, Q181, and I195 was noted) [28, 29].

The risk of PCR environmental contamination was controlled with spatial and temporal separation of all steps (DNA extraction, PCR reaction pre-mix preparation, PCR amplification, and nested PCR analysis) as well as the inclusion of negative controls at the extraction and amplification steps.

Ethical approval and informed consent

Ethical approval for collection and investigation of specimens from jaundiced patients seeking medical care was obtained from the Kenya Medical Research Institute’s National Ethical Review committee, approval number SSC 2436 [19]. Informed consent was given by each participant or guardian through a signed consent form prior to drawing a blood sample and obtaining demographic information. Ethical approval for collection and investigation of specimens from MSM and non-MSM participants was obtained through institutional review boards at the Kenyatta National Hospital ERC and the University of Manitoba [20]. Both institutional research ethics boards approved the investigation of infectious pathogens in consenting participants, including the detection and characterization of hepatitis B and hepatitis C viruses.

Statistical analysis

Fisher’s exact test (two-tailed) was used to analyse the association of anti-HBc with OBI and the association of DNA positivity with MSM-SW demographic and behavioural characteristics. Chi-square analysis was used to determine the association of educational level with HBV DNA positivity. Confidence intervals of prevalence estimates were calculated by computing the confidence interval of a proportion by the Wilson/Brown method. All statistical analyses were performed using GraphPad prism (v8.4.1). P values < 0.05 were considered significant.

Results

OBI and chronic HBV infection in Kenyan MSM-SW and non-MSM cohorts

The MSM-SW and non-MSM cohorts had not previously been tested for HBV, thus both OBI and chronic HBV infection (defined as HBsAg positivity) was assessed in these cohorts. The jaundiced cohort consisted of previously tested [19] HBsAg negative participants. The MSM-SW (n = 99) and non-MSM (n = 13) cohort participants were found to have a combined anti-HBc positivity of 36.6% (41/112; 95% confidence interval [CI] 28.3–45.8). Six of 35 anti-HBc positive specimens from MSM-SW were HBsAg-positive, 4 of which were also HBV DNA positive (S1A Fig, Table 2), indicating chronic infection, while anti-HBc positive samples from non-MSM men were all HBsAg and HBV DNA negative (S1B Fig, Table 2). Sixty-four MSM-SW and 7 non-MSM anti-HBc negative samples were tested for HBV DNA and HBsAg; 4 of 64 anti-HBc negative specimens tested from MSM-SW were HBsAg positive, 3 of which were also HBV DNA positive (S1A Fig, Table 2), thus establishing a prevalence of HBsAg positive chronic infection among MSM-SW of 10.1% (10/99; 95% CI 5.6–17.6). One non-MSM individual was HBsAg positive (DNA negative, anti-HBc positive; S1B Fig). A finding of OBI was based on a positive HBV DNA signal by real-time PCR in at least two different genomic regions with samples from HBsAg negative individuals. All negative extraction and amplification controls were consistently negative, indicating control of possible environmental contamination. OBI was observed in 1 non-MSM and 10 MSM-SW HBsAg negative men for an OBI prevalence of 8.3% (1/12; 95% CI 0.4–35.4) and 11.2% (10/89; 95% CI 6.2–19.5), respectively (Table 2).

Table 2

HBsAg, anti-HBc antibody and HBV DNA results of study samples by cohort.

	MSM-SW (n = 99)a		non-MSM (n = 13)b		Jaundiced (n = 65)c
	anti-HBc positive (n = 35)	anti-HBc negative (n = 64)	anti-HBc positive (n = 6)	anti-HBc negativec (n = 7)	anti-HBc positive (n = 37)	anti-HBc negative (n = 28)
HBsAg pos DNA pos	4	3	0	0	-	-
HBsAg neg DNA posd	6	4	0	1	14	6

aComprised of 89 HBsAg negative and 10 HBsAg positive men.

bNon-MSM participants were HIV uninfected men with HIV positive partners; comprised of 12 HBsAg negative and 1 HBsAg positive individuals.

cAll study samples from jaundiced individuals were HBsAg negative.

dOBI.

OBI in the jaundiced Kenyan cohort; association of anti-HBc positivity and OBI

Anti-HBc antibody positivity was found in 56.9% (37/65; 95% CI 44.8–68.2) HBsAg negative specimens from individuals presenting with jaundice at a medical facility (S1C Fig, Table 2). Twenty samples (6 anti-HBc negative and 14 anti-HBc positive) tested positive for HBV DNA, resulting in 30.8% (95% CI 20.9 to 42.8) OBI positivity (Table 2). A significant association was observed between anti-HBc antibody positivity and OBI among all high-risk cohorts (Fisher’s exact test; P = 0.0153) with an increase in significance observed when only the MSM-SW and jaundiced cohorts were considered (Fisher’s exact test; P = 0.007).

Associations with HBV DNA positivity among Kenyan MSM-SW cohort

HIV-reactivity results of MSM-SW and non-MSM individuals were determined during the original cohort study [20]. There was no significant association (Fisher’s exact test) between MSM-SW HIV positivity and HBV DNA or anti-HBc positivity observed. All HBV DNA positivity was observed in unvaccinated men, other than 3 cases of OBI and 2 cases of HBsAg positive chronic infection in vaccinated HIV negative MSM-SW. All MSM-SW specimens tested negative for antibody to HCV, while HIV co-infection was present in 58.8% (10/17; 95% CI 36.0–78.4) of HBV DNA positive MSM-SW participants (S1A Fig). Association between HBV DNA positivity and demographic, treatment or behavioural characteristics of MSM-SW cohort participants, determined during the original cohort study, was investigated (Table 3). The mean age of MSM-SW men was identical regardless of HBV DNA positivity (28 years), with similar median ages among the two groups (HBV DNA positive, 26 years; HBV DNA negative 25.5 years). Similarly, there were no significant associations observed with HBV DNA positivity, other than an association with the participant being treated with HIV antiretroviral therapy (Table 3).

Table 3

Associations with HBV DNA positivity among MSM-SW cohort participants.

Variable	HBV DNA positivea	HBV DNA negative	P Valueb
Marital status (single)	14/16 (87.5%)	54/75 (72.0%)	0.2253
Education
Primary or less	1/15 (6.7%)	7/68 (10.3%)	0.8985 (Chi-square)
Secondary	7/15 (46.7%)	29/68 (42.6%)
Postsecondary	7/15 (46.7%)	32/68 (47.1%)
Antiretroviral treatment	12/15 (80.0%)	26/68 (38.2%)	0.0042
Oral sex
Often-Alwaysc with a regular partner	3/15 (20%)	11/66 (16.7%)	0.7165
Often-Always with a casual partner	2/11 (18.2%)	8/54 (14.8%)	0.6732
Insertive anal sex
Often-Always with a regular partner	8/15 (53.3%)	37/66 (56.1%)	>0.9999
Often-Always with a casual partner	5/12 (41.7%)	28/53 (52.8%)	0.5372
Receptive anal sex
Often-Always with a regular partner	7/15 (46.7%)	18/66 (27.3%)	0.2140
Often-Always with a casual partner	7/12 (58.3%)	16/52 (30.8%)	0.1965

aIncludes both HBsAg positive chronic and OBI DNA positive MSM-SW men. Not all participants in the original study cohort answered all interview questions.

bFisher’s exact test unless otherwise indicated.

cOften-Always is in comparison to Never-Sometimes. Bold indicates a P value <0.05.

Phylogenetic analysis of HBV DNA positive samples

Following real-time PCR, specimens positive for HBV DNA (n = 38) underwent nested PCR for sequence analysis. Twenty-four specimens (S1 Table) were nested PCR positive and had sufficiently long sequence (at least 327 bp) for phylogenetic analysis. Seventeen OBI sequences from 1 non-MSM, 3 MSM-SW and 13 jaundiced participants, as well as 7 sequences from HBsAg positive MSM-SW specimens were aligned with GenBank reference sequences representing HBV subgenotypes, including 42 Kenyan HBV reference sequences (S1 Table), and were subjected to maximum likelihood phylogenetic analysis. All negative extraction and amplification controls were consistently negative, indicating control of possible environmental contamination. All study sequences were determined to be genotype A (Fig 1; GenBank accession no. MK487133—MK487155, MN972524). The MSM-SW sequences primarily clustered together, including with the single non-MSM OBI sequence (Cluster 1) and showed complete sequence identity over 327 nucleotides. Sequences from jaundiced patients did not cluster, although a second smaller cluster (Cluster 2) within the phylogenetic tree, comprised of a mixture of sequences from the MSM-SW and jaundiced cohorts, as well as several reference sequences from Kenya, showed complete sequence identity over 327 nucleotides. Definitive classification of the subgenotype of each sequence could not be determined due to subgenomic region analysis [30]. However, sequences from jaundiced patients appeared to be more similar to subgenotype A1 based on tree topology. MSM-SW OBI sequences were observed exclusively within Cluster 1, which clustered most closely with subgenotype A2 reference sequences with 98% branch support (Fig 1). Mutations associated with immune escape or impaired HBsAg or virion secretion [29] were infrequently observed within amino acid alignments of OBI sequences. Only three mutations were observed within the HBsAg major hydrophilic region (amino acids 99 to 160) of three specimens from jaundiced individuals; T116N, T118A (both observed with KN126 and KN160; accession numbers MK487143 and MK487142, respectively) and D144E (KN113; accession number MK487153). No known nucleos(t)ide analog resistance mutations were observed within amino acid alignments of the polymerase reading frame (rtI111 to rtM218) within the study sequences.

Fig 1

Phylogenetic analysis of the HBsAg-coding region sequence (nt 458–784) from jaundiced OBI, non-MSM OBI, and MSM-SW OBI and HBsAg positive participants.

Twenty-four trimmed sequences (327 bp) from 17 OBI (comprising sequences from 1 non-MSM, 3 MSM-SW and 13 jaundiced participants) and 7 HBsAg positive MSM-SW specimens were aligned with GenBank reference sequences and analyzed by maximum likelihood method, using the most fit GTR+γ+I substitution model with the approximate likelihood ratio test for branch support statistics. Reference sequences are shown as a genotype or subgenotype followed by the GenBank accession number and country of origin if available. Two clusters are indicated. Branch support >70% is shown. The ruler shows the branch length for a pairwise distance equal to 0.05. Filled square, MSM-SW OBI sequences; open square, non-MSM OBI sequence; filled circle, jaundiced OBI sequences; grey square, MSM-SW HBsAg positive sequences.

Discussion

Africa is an intermediate endemic region for hepatitis B infection, with an estimated prevalence of 6.1% [6]. An increased probability of infection is associated with certain populations at high risk, such as female sex workers [31], MSM [32, 33], or patients presenting for medical care with jaundice [19, 34, 35]. The findings of this study describe the high prevalence of HBsAg positivity in MSM-SW at 10.1%, and provide the first description of OBI in Kenya. None of the MSM-SW participants tested seropositive for HCV, comparable to other investigations describing a low HCV prevalence in Africa [19, 36, 37].

OBI is defined as the presence of HBV DNA in the liver or serum in the absence of detectable HBsAg, either in the presence or absence of other serological markers of HBV infection or exposure [38]. OBI is most often associated with very low quantitative HBV DNA levels (<200 IU/mL) [2] in the patient serum, consistent with a subclinical infection in which HBsAg levels may have fallen below the limit of diagnostic detection [39]. Although mutations within the HBsAg coding region which affect diagnostic detection are also a cause of “false” OBI [1], these mutations were infrequently observed among OBI-defined HBV sequences in this study. The risk of OBI is dependent on various factors including population prevalence and HIV co-infection; however, OBI detection is also dependent on test sensitivity and specificity [40]. Expert recommendations for OBI detection state that very sensitive DNA amplification procedures (nested PCR or real-time PCR) should be employed using multiple primer sets specific for highly conserved regions of the genome [1]. The present study followed this recommendation and determined OBI by a positive signal within at least two different genomic regions by real-time PCR, followed by nested PCR to obtain sequence information. Consistent with the intermediate endemicity of HBV in Africa, high rates (>6%) of OBI have been reported, in Nigerian blood donors [10, 41] and HIV positive patients in Botswana [14] or Cameroon [13]. Therefore the OBI rate of 18.7% (31/166; 95% CI 13.5–25.3) among HBsAg negative individuals analyzed in the present study would be expected in keeping with prior studies conducted in sub-Saharan Africa, and considering the population tested comprised individuals at high risk of HBV infection.

A difference in OBI prevalence among the MSM-SW and jaundiced cohorts was observed, such that the jaundiced patient group exhibited a nearly 3-fold higher rate of OBI (20/65; 30.8%, 95% CI 20.9–42.8) compared to the MSM-SW group (10/89; 11.2%, 95% CI 6.2–19.5). Risk factors associated with transmission may be an influence on this proportional difference. Universal HBV vaccination in Kenya was initiated in 2001 with provision of the pentavalent (DPT-HepB-Hib) vaccine at 6, 10, and 14 weeks of age [42]. Prior to vaccination program implementation, high rates of chronic hepatitis B infection in Africa likely resulted from transmission during childhood before the age of 5 years [6], leading to a higher risk of developing chronic infection (30% to 50% in childhood). Despite the increased risk of HBV transmission with high-risk sexual activity among the MSM-SW cohort, the risk of developing chronic infection in adulthood is decreased (5 to 15%) compared to infection in childhood. Thus, although both groups are drawn from the general population, symptomatic patients are more likely to harbour overt and subclinical infection. HBsAg prevalence in the original jaundiced cohort was 50.6% [19], so the overall risk of HBV infection appears to be higher in patients presenting with jaundice for medical care compared to MSM-SW individuals. A rise in OBI prevalence has been associated with increasing age among certain populations [43], which may in part explain the 3-fold increased rate of OBI among the jaundiced cohort, as the mean age of individuals in this group was approximately a decade greater (37.8 years) than the mean age of participants of the MSM-SW cohort (28.6 years). There were no significant associations between HBV DNA positivity and demographic, treatment or behavioural characteristics of MSM-SW cohort participants other than an association with HIV antiretroviral therapy (P = 0.0042; Fisher’s exact test). The lack of significant association with HBV DNA positivity may be due to the very small numbers of participants with available data. The association between HIV treatment and detectable HBV DNA may be due to lower CD4 cell counts, increased HIV viral load (≥ 300 copies/mL), or less time since antiretroviral therapy initiation within this population, as was observed in a study of Cameroonian HBV/HIV co-infected persons [44]. Furthermore, individuals may more readily accept and comply with treatment if undiagnosed HBV co-infection results in increased symptoms or adverse clinical outcomes.

All OBI participants as well as HBsAg positive MSM-SW individuals, were determined to be infected with HBV genotype A, which has been shown to be highly prevalent in high-risk groups in Kenya, based on reports from jaundiced [19], HIV-coinfected [45, 46] or PWID [47] cohorts. However, there were unexpected differences in phylogenetic clustering of OBI sequences among MSM-SW and jaundiced patients. All sequences from MSM-SW OBI and most from HBsAg positive MSM-SW persons clustered with GenBank subgenotype A2 reference sequences, with branch support of 98%, whereas sequences from jaundiced OBI were dispersed throughout the tree among subgenotype A1 reference sequences. HBV subgenotype A1 is highly predominant in Africa [48], including Kenya [18, 19] while subgenotype A2 is normally observed outside of Africa. Strikingly, all MSM-SW sequences clustering with A2 reference sequences showed complete sequence identity over 327 bp of alignment. This suggests that a common source or network transmission may be occurring with involvement of a non-African HBV transmission source within the MSM-SW cohort. However, it is important to consider that the relatively short HBsAg-coding region alignment used in this analysis is fairly well conserved and so inadvertent clustering may occur, as is evidenced by sequence identity of several study specimens with GenBank reference sequences, including several originating from Kenya. Thus phylogenetic analysis with full genome sequence is required to completely delineate HBV case relationships and resolve subgenotype classification.

A lack of mutations associated with resistance to antiviral therapy among the viral sequences investigated in this study was observed. Participants in all 3 cohorts were not known to have been treated with antiviral therapy for HBV, and thus would be considered treatment naïve, although 83 MSM-SW reported being treated for HIV infection and we cannot exclude the possibility that other participants may have been exposed to antiviral therapy in the past. Several HIV therapies are effective against HBV, and it has been suggested that transmission of drug-resistant HBV strains is likely occurring within Africa [28], partly due to the early widespread use of lamivudine as a treatment for HIV. Although tenofovir disoproxil fumarate (TDF) is the currently recommended first-line treatment for HBV/HIV coinfection in Africa, depending on the dosage, patient compliance, and prior use of other monotherapies, such as lamivudine, the risk of developing HBV resistance mutations resulting in viral breakthrough increases in HBV/HIV coinfection [49]. Furthermore, cross-resistance among therapies is common, thus the use of therapies having a high genetic barrier to resistance, such as TDF, is crucial for controlling HBV viral breakthrough. At present, the availability of TDF for HBV mono-infection in Africa is not reliable [28].

The HBsAg-coding region mutations associated with immune escape [28, 50], T116N, T118A and D144E, were observed in several participants within the jaundiced cohort. The vaccination status of jaundiced participants was not known, nor were other possible sources of immune pressure that could result in HBsAg mutations. As the reverse transcriptase region of the HBV polymerase gene overlaps with the HBsAg-coding region, random mutations in either open reading frame may lead to changes in HBsAg expression, release or immunogenicity, potentially affecting vaccine response, HBsAg detection, and increased fitness of drug-resistant strains [51]. The study data does not provide sufficient evidence to understand whether drug-resistant or immune escape mutations pose an increased risk to high-risk individuals in Kenya; however, it would be prudent to diagnose and monitor HBV infection in all HIV-positive individuals prior to treatment initiation [49].

Limitations

There were several limitations within the study which may have affected results and interpretation. Specimens were selected from archived sera related to studies of MSM-SW and jaundiced patients in Kenya based on a remaining sufficient volume for the study of OBI, which may have introduced selection bias. Insufficient participant numbers were available for statistical analysis, such that only major associations could be observed. Thus although a significant association among OBI and mutations or behavioral variables was not observed in this study, it may exist in a study with appropriate power. Although specimens were tested by a validated real-time PCR method targeting 3 unique HBV genome regions, specimens testing negative were not re-extracted or re-tested using a different approach. Thus, there is a possibility that prevalence estimates are under-reported.

Conclusions/implications

OBI was determined to be highly prevalent among Kenyan individuals at high risk of HBV infection, including jaundiced patients presenting for medical care (30.8%; 95% CI 20.9–42.8), male sex workers (11.2%; 95% CI 6.2–19.5) and non-MSM men at high risk of HIV infection (8.3%; 95% CI 0.4–35.4). HBsAg positive chronic infection was also observed at a similar high rate (10.1%; 95% CI 5.6–17.6) in MSM-SW. A majority (58.8%; 95% CI 36.0–78.4) of MSM-SW were found to be co-infected with HIV, emphasizing the suggested practice of screening all HIV positive patients for HBV infection to establish appropriate treatment and patient management [49]. As OBI was significantly associated with anti-HBc positive status among patients at high risk for HBV infection, suspect cases of viral hepatitis should include screening by anti-HBc and HBV DNA, using highly sensitive methods to detect the low HBV DNA levels associated with OBI [2]. Due to the high risk of HBV infection in sex workers, screening and HBV vaccination of susceptible individuals should be implemented in MSM-SW cohorts to prevent the transmission of HBV and allow linkage to care for those infected [6]. The HBV genotype distribution differed among jaundiced and MSM-SW participants consistent with differing risk factors for transmission and suggests a possible common non-African source circulating among the cohort, resulting in overt and subclinical infection. As OBI remains a risk for HBV transmission and the development of severe liver disease [3], acknowledging the burden of infection represented by OBI in Kenya is necessary to develop national prevention and control measures.

Flow charts of study specimen HBV testing and results.

Shaded boxes denote OBI positive results. The total number of specimen results or specimens tested is noted within the box. MSM-SW specimens (A), non-MSM specimens (B), jaundiced patient specimens (C). HIV-reactivity results were determined during the original cohort study [20]. neg, Negative; pos, Positive.

(PDF)

Click here for additional data file.

HBsAg-coding region sequences included in phylogenetic analysis, by cohort or reference.

(PDF)

Click here for additional data file.

30 Mar 2020

PONE-D-20-02941

Characterization of occult hepatitis B in high-risk populations in Kenya

PLOS ONE

Dear Dr. Osiowy,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by May 14 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Jason Blackard, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (if provided):

This is a cross-sectional (convenience sampling) study of occult HBV infection in Kenya.  Overall, the methods and results are clear and the writing is concise.  A few minor revisions would further strengthen this manuscript, including:

The prevalence of occult HBV observed (18.7%) was about what would be expected based on other studies conducted in sub-Saharan Africa.

Were samples that were found negative for HBV DNA tested a second time using a new extraction or different PCR approach?

Were ALT values available for any of the sub-populations studied?  What is the associated between detection of HBV DNA and ALT levels?

It is unclear what specific mutations were screened for . . . perhaps list them explicitly in the methods?  Similarly, what specific resistance mutations were screened for?

The discussion should include a statement that the statistical analyses were almost certainly not powered to find anything more than the largest associations.  No significant associations does not mean they don’t exist if the study was not powered appropriately.

Can additional sequences from Kenya be included in the phylogenetic analysis?

Journal Requirements:

When submitting your revision, we need you to address these additional requirements:

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Thank you for inlcuding your ethics statement; "Ethical approval for collection and investigation of specimens from jaundiced patients seeking medical care was obtained from the Kenya Medical Research Institute’s National Ethical Review committee, approval number SSC 2436. Informed consent was given by each participant or guardian through a signed consent form prior to drawing a blood sample and obtaining demographic information. Ethical approval for collection and investigation of specimens from MSM and non-MSM participants was obtained through approval of institutional review boards at the Kenyatta National Hospital ERC and the University of Manitoba with the collection of signed consent. "

Please amend your current ethics statement to confirm that your named institutional review board or ethics committee specifically approved this study.

Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

For additional information about PLOS ONE ethical requirements for human subjects research, please refer to http://journals.plos.org/plosone/s/submission-guidelines#loc-human-subjects-research.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: No

Reviewer #2: I Don't Know

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This is an interesting and relevant piece of research on the phenomenon of occult HBV in high-risk populations in Kenya. As occult HBV can lead to significant morbidity, particularly in otherwise vulnerable populations, understanding of its transmission and prevalence remains useful, even in an era of near-universal vaccination.

However, there are some challenges with this manuscript that require additional focus prior to publication.

First, please ensure an appropriate definition of "endemic." The paper cited for that definition suggests >8% prevalence, yet multiple times in the manuscript HBV is reported as "endemic" in sub-Saharan Africa and Kenya at a prevalence of 6%.

Second, the patient populations selected are clear in their characterization, but these appear to be convenience cohorts from prior studies. Rather than using Figure 1 to show serological marker outcomes (which can be fully displayed in Table 2 instead), perhaps Figure 1 can show what cohort is what. How many patients were MSM-SW in total? Were all serum samples in that cohort tested? What about non-MSM with known HIV+ partners, and those with jaundice? Were these all previously identified for a study, and again, were all patients included in this retrospective analysis? If the answer to this is "yes", this should be clarified. If "no", please explain how samples were selected.

Third, why were only the first cohort tested for HCV (MSM-SW)?

Fourth, sample size does limit statistical analysis but it would be helpful to have a short paragraph on what stats were run and why (Fisher's Exact was the only test mentioned, I believe).

Fifth, the association with ART deserves a bit more consideration. Please put into context with current literature. Likewise, mutations causing HBV to escape detection, particularly in the setting of HIV, can be better described. See some of the work stemming from the Sherman lab.

Finally, conclusions should discuss implications of this work. Should patients presenting with jaundice be screened for HBV DNA, regardless of other markers? Same for MSM-SW? What are the challenges with that approach?

Reviewer #2: The study determined the prevalence and molecular characteristics of occult hepatitis B infections in populations at high risk of occult HBV infections in Kenya. Hepatitis B markers were screened for in 99 male sex workers having sex with men, 13 Non –MSM having HIV positive partners and 65 patients presenting with jaundice. The study reported a high occult HBV prevalence of 31 (18.7%). The predominant subgenotype circulating amongst jaundiced patients was A1 while for MSM-SW it was A2.

The study addressed important gaps in an under researched field. Occult HBV is becoming clinically relevant and more data is needed in this area. The study was well conducted. However, the definition of HBsAg positive chronic HBV is missing leading to confusion of some of the results. The study recommendations/implications are missing in both the abstract and the conclusion section. The study did not discuss any limitations.

ABSTRACT

1. Line 23: Correct the occult hepatitis B infection definition to presence of hepatitis B virus DNA.

2. Line 31: Write anti-HBc in full since it is the first mention

3. Line 33: Write HCV in full for the same reason as above

4. Line 33 and 36. Include confidence intervals in prevalence data. Here and elsewhere

5. Line 36: Please confirm HBsAg positive prevalence. In Figure 1A there are 10 HBsAg MSM-SW

6. Lines 31 and 32 implies that all samples were tested for HBsAg in this study but the 65 jaundiced patients were pre-screened as shown in Figure 1C. Please rephrase.

7. The abstract lacks study recommendation or implications of the study results.

INTRODUCTION

The introduction is well written.

MATERIALS AND METHODS

8. Line 95: Company address for Qiagen is missing

9. Line 115: Inconsistency , use of occult HBV versus OBI here and elsewhere.

10. Line 119: ThermoFisher Scientific address missing.

RESULTS

11. Line 154-155: How was chronic HBV infection defined in this study? There were 10 HBsAg MSM-SW but the prevalence of HBsAg positive chronic HBV infection is stated as 7/99.

12. Some of the results are presented in a confusing manner. It would be better to present all prevalence data for the high risk groups and then the associations between demographics and other parameters with OBI later. That is finish discussing table 2 and then move to table 3 instead of moving back and forth between the 2 tables.

13. Line 193. Please include the high risk group breakdown of the 24 samples which were genotyped. The information in lines 220-221 should be within text, not only in legend.

DISCUSSION

14. Line 233 , 234 and 239 the abbreviations (MSM-SW, MSM, OBI) have been previously defined in the manuscript and does not need to be defined again here.

15. The study did not describe any limitations

CONCLUSION

The recommendations or implications of the study results is missing

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

22 Apr 2020

A response to reviewers file has been uploaded. The contents of the file are copied below:

Response to Editor and Reviewers

We thank the Academic Editor and Reviewers for their helpful comments and suggestions to correct, clarify and improve the manuscript. All page and line descriptions of revisions refer to the unmarked “Manuscript” file. Please see responses to the comments as follows.

Academic Editor Comments:

The prevalence of occult HBV observed (18.7%) was about what would be expected based on other studies conducted in sub-Saharan Africa.

As suggested, we have included a statement stating that the prevalence observed “…would be expected in keeping with prior studies conducted in sub-Saharan Africa…” (page 16, lines 284-285).

Were samples that were found negative for HBV DNA tested a second time using a new extraction or different PCR approach?

All specimens were tested using a highly sensitive real-time PCR assay targeting 3 different HBV genomic regions, with a positive result determined by at least 2 regions having Ct values below a specified cut-off. Therefore, samples negative by real-time PCR were not tested or extracted a second time. The possibility that this lack of secondary testing may have resulted in under-reporting of the prevalence estimate was added as a limitation to the revised manuscript (page 20, lines 371-374).

Were ALT values available for any of the sub-populations studied? What is the associated between detection of HBV DNA and ALT levels?

Unfortunately ALT levels were not available for the sub-populations studied. The ALT levels of HBV-infected individuals will fluctuate depending on the phase of infection of the patient. For example, ALT levels will be persistently normal during the HBeAg-positive chronic infection or ‘immunotolerant’ phase of infection, in which HBV DNA levels are very high. Yet once HBV viral load levels start to decrease in the HBeAg-positive chronic hepatitis phase of infection, ALT levels will fluctuate and flare above normal. This is due to the host immune response recognizing the virus and destroying infected hepatocytes, resulting in increases in detectable liver enzymes. A sentence was added to the Materials and Methods section (Page 4, lines 79-81) to state that ALT levels were not available for analysis.

It is unclear what specific mutations were screened for . . . perhaps list them explicitly in the methods? Similarly, what specific resistance mutations were screened for?

Thank you for this suggestion to help improve the manuscript. The specific amino acid mutations that were screened for both the HBsAg (immune escape) and polymerase reverse transcriptase region (drug resistance) was added to the revised Materials and Methods section along with citations describing the mutations (page 8, lines 132-138).

The discussion should include a statement that the statistical analyses were almost certainly not powered to find anything more than the largest associations. No significant associations does not mean they don’t exist if the study was not powered appropriately.

We appreciate this excellent suggestion. The following statement was added to the Limitations section (page 20, lines 368-371): “Insufficient participant numbers were available for statistical analysis, such that only major associations could be observed. Thus although a significant association among OBI and mutations or behavioral variables was not observed in this study, they may exist in a study with appropriate power.”

Can additional sequences from Kenya be included in the phylogenetic analysis?

Yes, we have re-analyzed the phylogenetic tree, adding an additional 31 genotype A GenBank sequences originating from Kenya above the original 11 Kenyan reference sequences. All of the sequences within the tree have been tabulated by Kenyan GenBank reference, non-Kenyan GenBank reference, MSM-SW OBI, MSM-SW HBsAg positive, non-MSM OBI, and Jaundiced OBI (S1 Table and Fig 1).

Journal Requirements: Please amend your current ethics statement to confirm that your named institutional review board or ethics committee specifically approved this study. Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

The Ethics statement in the manuscript and the submission form has been revised to include the statement: “Both institutional research ethics boards approved the investigation of infectious pathogens in consenting participants, including the detection and characterization of hepatitis B and hepatitis C viruses.” (Page 9, lines 152-154).

Reviewer #1 Comments:

First, please ensure an appropriate definition of "endemic." The paper cited for that definition suggests >8% prevalence, yet multiple times in the manuscript HBV is reported as "endemic" in sub-Saharan Africa and Kenya at a prevalence of 6%.

Thank you for this correction. This has been revised throughout the manuscript to state the prevalence in sub-Saharan Africa and Kenya meets intermediate endemicity levels, with the definition provided in the Introduction (2% to 7%; page 3, line 51).

Second, the patient populations selected are clear in their characterization, but these appear to be convenience cohorts from prior studies. Rather than using Figure 1 to show serological marker outcomes (which can be fully displayed in Table 2 instead), perhaps Figure 1 can show what cohort is what. How many patients were MSM-SW in total? Were all serum samples in that cohort tested? What about non-MSM with known HIV+ partners, and those with jaundice? Were these all previously identified for a study, and again, were all patients included in this retrospective analysis? If the answer to this is "yes", this should be clarified. If "no", please explain how samples were selected.

Thank you for the opportunity to clarify. The total numbers of each cohort in the original study were provided in the revised manuscript Materials and Methods Specimen Collection paragraph (page 4, lines 67 to 74 and page 5, lines 84 to 87). This added information provides the clarification that not all of the original study samples were tested for OBI (or HBsAg positivity for MSM-SW) due to sample exhaustion and that only specimens having sufficient serum volume for OBI investigation were selected.

As Figure 1 was suggested to be redundant, it was moved to Supplementary Information (S1 Fig) to provide a complementary breakdown of samples and results to Table 2.

Third, why were only the first cohort tested for HCV (MSM-SW)?

The lack of anti-HCV testing in jaundiced individuals was explained in the revised Materials and Methods section (page 5, lines 87-88): “All jaundiced patients included in this study had been tested for antibody to hepatitis C virus (HCV) in the original study and were found to be negative [19].”

Fourth, sample size does limit statistical analysis but it would be helpful to have a short paragraph on what stats were run and why (Fisher's Exact was the only test mentioned, I believe).

Thank you for this opportunity to correct and improve the manuscript. The statistical analysis section of the Materials and Methods has been revised to describe the statistical tests used for all analyses, including confidence intervals (page 9, lines 157-162).

Fifth, the association with ART deserves a bit more consideration. Please put into context with current literature. Likewise, mutations causing HBV to escape detection, particularly in the setting of HIV, can be better described. See some of the work stemming from the Sherman lab.

As suggested, we have included a discussion regarding the association of HBV DNA with antiretroviral therapy in the Discussion (page 17, lines 310-315). An expanded discussion of polymerase and HBsAg mutations associated with drug resistance and immune escape, respectively, in the context of HIV infection has also been added to the Discussion (pages 18-19, lines 336-362), as suggested.

Finally, conclusions should discuss implications of this work. Should patients presenting with jaundice be screened for HBV DNA, regardless of other markers? Same for MSM-SW? What are the challenges with that approach?

We thank the reviewer for this comment to improve the manuscript. As suggested we have added a section at the end of the manuscript “Conclusions/Implications” (page 20-21, lines 376-394), which discusses suggested measures for screening, treatment and control of HBV infection in Kenya based on the data presented. Similar implications of the data were further provided during the discussion of drug resistance and immune escape (page 19, lines 347-350 and 359-362) and a sentence was added to the end of the Abstract (page 2, lines 38-41).

Reviewer #2 Comments:

However, the definition of HBsAg positive chronic HBV is missing leading to confusion of some of the results.

We thank the reviewer very much for catching this glaring oversight! We had incorrectly calculated the prevalence of “chronic” HBV infection due to our focus on HBV DNA alone. However, by including a definition of chronic HBV infection (defined as HBsAg positivity; Page 9, line 167) the correct prevalence calculation, including all MSM-SW individuals positive for HBsAg, was provided (10/99; 10.1%, 95% CI 5.6-17.6). This correction was made throughout the manuscript, including the Abstract.

The study recommendations/implications are missing in both the abstract and the conclusion section.

We thank the reviewer for this comment to improve the manuscript. As suggested we have added a section at the end of the manuscript “Conclusions/Implications” (page 20-21, lines 376-394), which discusses suggested measures for screening, treatment and control of HBV infection in Kenya based on the data presented. Similar implications of the data were further provided during the discussion of drug resistance and immune escape (page 19, lines 347-350 and 359-362) and a sentence was added to the end of the Abstract (page 2, lines 38-41).

The study did not discuss any limitations.

As suggested, a section on study limitations was added to the manuscript, expanding on comments and limitations noted by the academic editor and reviewers (page 20, lines 364-374).

ABSTRACT

1. Line 23: Correct the occult hepatitis B infection definition to presence of hepatitis B virus DNA.

We thank the reviewer for catching this oversight. The definition was corrected to state “Occult hepatitis B infection (OBI) is defined as the presence of hepatitis B virus (HBV) DNA in the liver or serum in the absence of detectable HBV surface antigen (HBsAg).” (page 2, lines 23-24). This was also corrected in the Discussion (page 15, lines 267-268).

2. Line 31: Write anti-HBc in full since it is the first mention

The line in the Abstract was changed to “…which were HBV core protein antibody positive.” (page 2, line 34) and the first mention of anti-HBc was written in full in the Introduction “…antibody to the core (anti-HBc) or surface (anti-HBs) proteins…” (page 3, lines 44-45).

3. Line 33: Write HCV in full for the same reason as above

The first instance of HCV was written in full in the Abstract (page 2, line 32) and the manuscript text (Materials and Methods; page 5, lines 87-88).

4. Line 33 and 36. Include confidence intervals in prevalence data. Here and elsewhere

We thank the reviewer for the opportunity to correct and improve the manuscript. Confidence intervals of prevalence estimates were calculated by computing the confidence interval of a proportion by the Wilson/Brown method (this statement was added to page 9, lines 160-161). Throughout the text, prevalence values were followed by the calculated 95% CI range.

5. Line 36: Please confirm HBsAg positive prevalence. In Figure 1A there are 10 HBsAg MSM-SW

As mentioned above, we had incorrectly calculated the prevalence of HBsAg positivity due to our focus on HBV DNA alone. The HBsAg positive prevalence for study MSM-SW participants was corrected (10/99; 10.1%, 95% CI 5.6-17.6). This correction was made throughout the manuscript, including the Abstract.

6. Lines 31 and 32 implies that all samples were tested for HBsAg in this study but the 65 jaundiced patients were pre-screened as shown in Figure 1C. Please rephrase.

Thank you for this comment. As suggested, the methods portion of the Abstract was re-phrased to correct and clarify this point: “Sera from two Nairobi cohorts, 99 male sex workers, primarily having sex with men (MSM-SW), and 13 non-MSM men having HIV-positive partners, as well as 65 HBsAg-negative patients presenting with jaundice at Kenyan medical facilities, were tested for HBV serological markers, including HBV DNA by real-time PCR.” (page 2, lines 27-31).

7. The abstract lacks study recommendation or implications of the study results.

As suggested, we have included a sentence at the end of the Abstract (page 2, lines 38-41) to provide recommended measures for screening, treatment and control of HBV infection in Kenya based on the data presented.

MATERIALS AND METHODS

8. Line 95: Company address for Qiagen is missing

The company address for Qiagen was added (page 5, line 101).

9. Line 115: Inconsistency , use of occult HBV versus OBI here and elsewhere.

We have corrected the use of OBI throughout the manuscript, with only the initial mention of occult HBV fully spelled out in the manuscript text on page 3, lines 43-44.

10. Line 119: ThermoFisher Scientific address missing.

The company address for ThermoFisher Scientific was added (page 7, line 125).

RESULTS

11. Line 154-155: How was chronic HBV infection defined in this study? There were 10 HBsAg MSM-SW but the prevalence of HBsAg positive chronic HBV infection is stated as 7/99.

As mentioned above, we thank the reviewer very much for catching this glaring oversight! We had incorrectly calculated the prevalence of “chronic” HBV infection due to our focus on HBV DNA alone. However, by including a definition of chronic HBV infection (defined as HBsAg positivity; Page 9, line 167) the correct prevalence calculation, including all MSM-SW individuals positive for HBsAg, was provided (10/99; 10.1%, 95% CI 5.6-17.6). This correction was made throughout the manuscript, including the Abstract.

12. Some of the results are presented in a confusing manner. It would be better to present all prevalence data for the high risk groups and then the associations between demographics and other parameters with OBI later. That is finish discussing table 2 and then move to table 3 instead of moving back and forth between the 2 tables.

We thank the reviewer for this comment to improve the manuscript. As suggested, we have moved the results of OBI in the jaundiced Kenyan cohort and the association of anti-HBc positivity with OBI directly following the results of OBI in MSM-SW and non-MSM cohorts (Page 10-11, lines 186-192), prior to the mention of Table 3.

13. Line 193. Please include the high risk group breakdown of the 24 samples which were genotyped. The information in lines 220-221 should be within text, not only in legend.

Thank you for this comment. As suggested, a list of all cohort study samples that were sequenced, as well as GenBank reference sequences that were included in phylogenetic analysis was included as a supplementary Table (S1 Table). This information was also added to the text (Page 13, lines 220-223).

DISCUSSION

14. Line 233 , 234 and 239 the abbreviations (MSM-SW, MSM, OBI) have been previously defined in the manuscript and does not need to be defined again here.

The abbreviation definitions have been removed.

15. The study did not describe any limitations

Thank you. As mentioned above, a section on study limitations was added to the manuscript, expanding on comments and limitations noted by the academic editor and reviewers (page 20, lines 364-374).

CONCLUSION

The recommendations or implications of the study results is missing

We thank the reviewer for this comment to improve the manuscript. As suggested we have added a section at the end of the manuscript “Conclusions/Implications” (page 20-21, lines 376-394), which discusses suggested measures for screening, treatment and control of HBV infection in Kenya based on the data presented. Similar implications of the data were further provided during the discussion of drug resistance and immune escape (page 19, lines 347-350 and 359-362).

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

12 May 2020

Characterization of occult hepatitis B in high-risk populations in Kenya

PONE-D-20-02941R1

Dear Dr. Osiowy,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Jason Blackard, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

None

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No

15 May 2020

PONE-D-20-02941R1

Characterization of occult hepatitis B in high-risk populations in Kenya

Dear Dr. Osiowy:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Jason Blackard

Academic Editor

PLOS ONE