| Literature DB >> 32414206 |
Enric Cuevas-Ferrando1, Antonio Martínez-Murcia2, Alba Pérez-Cataluña1, Gloria Sánchez1, Walter Randazzo1,3.
Abstract
Hepatitis E virus (HEV) is one of the causative agents of water-borne human viral hepatitis and considered in Europe an emerging zoonotic pathogen. Analysis of bottled water through a standard method validated for HEV can contribute towards the risk management of this hazard. Putting some recent reports by the European Food Safety Authority in place, this study aimed to assess the performance of the concentration and extraction procedures described in ISO 15216-1:2017 for norovirus and hepatitis A virus on HEV detection. Following the ISO recommendation, the bottled water samples were spiked using serially diluted HEV fecal suspensions together with mengovirus as process control and concentrated by filtration via positively charged nylon membranes. In order to extract viral RNA from the resulting concentrates, two different methods were compared in this study: The one recommended in the ISO norm, NucliSens® MiniMag® system (NS), and an alternative commercially available kit NucleoSpin®RNA virus kit (MN). Finally, three reverse transcription quantitative PCR (RT-qPCR) assays were used to quantify HEV titers. The evaluated procedures resulted in average HEV recoveries of 14.08 ± 4.90% and 3.58 ± 0.30% for the MN and NS methods, respectively. The limit of detection (LoD95%) was 1.25 × 104 IU/L for both extraction methods combined with the three RT-qPCR assays tested, with the exception of NS extraction coupled with RT-qPCR1 that showed a LoD95% of 4.26 × 103 IU/L. The method characteristics generated in this study support the limited suitability of the ISO 15216-1:2017 concentration procedure coupled with the evaluated RT-qPCR assays for detecting HEV in bottled water.Entities:
Keywords: RT-qPCR; bottled water; concentration method; hepatitis e virus (HEV)
Year: 2020 PMID: 32414206 PMCID: PMC7284727 DOI: 10.3390/microorganisms8050730
Source DB: PubMed Journal: Microorganisms ISSN: 2076-2607
Primers and probes used in this study.
| Assay | Amplification Region | Primers and Probe | Sequence 5’-3’ | RT-qPCR Conditions | Location * | Reference |
|---|---|---|---|---|---|---|
| RT-qPCR1 | ORF3 | HEV.Fa | GTGCCGGCGGTGGTTTC | RT 50 °C for 30’ | 5296–5377 | [ |
| Hev.Fb | GTGCCGGCGGTGGTTTCTG | 95 °C for 15’ | ||||
| HEV.R | GCGAAGGGGTTGGTTGGATG | PCR (45x) | ||||
| HEV.P | FAM-TGACMGGGT/ZEN/TGATTCTCAGCC/3IABkFQ | 95 °C for 10’’ | ||||
| 55 °C for 20’’ | ||||||
| 72 °C for 15’’ | ||||||
| RT-qPCR2 | ORF3 | N/A | N/A | RT 45 °C for 10’ | N/A | Ceeram (hepatitis@ceeramTools) |
| 95 °C for 10’ | ||||||
| PCR (40x) | ||||||
| 95 °C for 15’’ | ||||||
| 60 °C for 45’’ | ||||||
| RT-qPCR3 | ORF3 | JVHEVF | GGTGGTTTCTGGGGTGAC | RT 50 °C for 30’ | 5304–5373 | [ |
| JVHEVRmod | AGGGGTTGGTTGGRTGRA | 95 °C for 2’ | ||||
| JVHEVPmod | TGATTCTCAGCCCTTCGC | PCR (45x) | ||||
| 95 °C for 15’’ | ||||||
| 60 °C for 40’’ |
F: Forward primer; R: Reverse primer; and P: Probe.* Location in reference to WHO International Standard for HEV RNA, HRC-HE104 strain, accession no. AB630970 [18].
Figure 1Hepatitis E virus (HEV) recovery in bottled water samples using the ISO 15216-1:2017 procedure and comparing two extraction kits and three RT-qPCRs assays. MN: NucleoSpin®RNA virus kit (Macherey-Nagel GmbH & Co.); NS: NucliSens® MiniMag® system (BioMerieux SA); RT-qPCR1: modified from [20]; RT-qPCR2: CeeramTools® Hepatitis E Virus Detection KHEV kit (BioMérieux SA); and RT-qPCR3: Described in [21] and modified in [22]. Different letters denote significant differences among methods for each virus (p < 0.05).
Limit of detection of HEV in bottled water according to ISO 15216-1:2017 virus concentration procedure and comparing two extraction kits and three RT-qPCRs assays.
| Extraction Method | RT-qPCR | Levels of Inoculated HEV (IU/L) | LoD95%a | ||
|---|---|---|---|---|---|
| 1 × 105 | 1 × 104 | 1 × 103 | |||
| MN | RT-qPCR1 | 4/4 b | 4/4 | 0/4 | 1.25 × 104 |
| RT-qPCR2 | 4/4 | 4/4 | 0/4 | 1.25 × 104 | |
| RT-qPCR3 | 4/4 | 4/4 | 0/4 | 1.25 × 104 | |
| NS | RT-qPCR1 | 4/4 | 4/4 | 2/4 | 4.26 × 103 |
| RT-qPCR2 | 4/4 | 4/4 | 0/4 | 1.25 × 104 | |
| RT-qPCR3 | 4/4 | 4/4 | 0/4 | 1.25 × 104 | |
a Calculated according to (24); b HEV positive/total numbers of samples.