Literature DB >> 32397408

Prevalence, Antimicrobial Resistance Profiles, Virulence and Enterotoxins-Determinant Genes of MRSA Isolated from Subclinical Bovine Mastitis in Egypt.

Abdelazeem M Algammal1, Mohamed E Enany1, Reham M El-Tarabili1, Madeha O I Ghobashy2,3, Yosra A Helmy4,5.   

Abstract

Subclinical mastitis caused by Staphylococcus aureus has worldwide public health significance. Here, we aimed to determine the prevalence of S. aureus, antimicrobial resistance profiles, and the virulence and enterotoxins determinant genes of MRSA strains that caused subclinical bovine mastitis. Milk samples were collected from 120 lactating animals (50 buffaloes and 70 dairy cattle) from different farms located in Ismailia Province (Egypt). The collected samples were investigated for subclinical mastitis using a California mastitis test. The total prevalence of S. aureus was 35.9% (84/234) with 36.3% (53/146) in cattle and 31% (31/88) in buffaloes. Antimicrobial susceptibility testing showed that 35.7% (30/84) of the isolated strains were resistant to cefoxitin, defined as methicillin-resistant S. aureus (MRSA), with 37.7% (20/53) in cattle and 32.2% (10/31) in buffaloes. Using PCR, 100% of the tested strains harbored coa and mecA genes, while 86.6% were positive for spa gene, with remarkable gene size polymorphism. Additionally, 10% of the tested strains contained the pvl gene. Further, using multiplex PCR, 26.6% of the tested samples had sea gene, two strains had sec gene and only one strain had sea and sec genes. The seb and sed genes were absent in the tested strains. In conclusion, mecA, coa and spa virulence genes were widely distributed in MRSA strains isolated from bovine milk, whereas the sea gene was the most predominant enterotoxin gene. Notably, this is the first report that emphasizes the prevalence of pvl gene of MRSA isolated from bovine milk in Egypt.

Entities:  

Keywords:  MRSA; antimicrobial resistance; enterotoxins genes; prevalence; subclinical bovine mastitis; virulence genes

Year:  2020        PMID: 32397408      PMCID: PMC7281566          DOI: 10.3390/pathogens9050362

Source DB:  PubMed          Journal:  Pathogens        ISSN: 2076-0817


1. Introduction

Staphylococcus aureus is a significant public health bacterial pathogen, causing mastitis in dairy animals including cattle, buffalo, sheep and goats [1]. S. aureus mastitis and its produced toxins lead to great economic losses in dairy farms due to: (1) reduction in the milk production, (2) alteration in the composition and quality of the produced milk, (3) the need to discard the produced milk, (4) early culling of infected animals, and (5) high cost of treatment and control [2]. Resistance of S. aureus to several antimicrobials complicates the treatment of these pathogenic bacteria, which is considered an increasing challenge. Methicillin-resistant S. aureus (MRSA) strains can cause nosocomial infections and consequently high mortality in humans [3]. In Egypt, there was high prevalence of resistance among S. aureus in bovine species to antimicrobial agents such as β-lactams, which are used to treat mastitis [4,5]. This high prevalence is caused by the uncontrolled widespread use of antibiotics. Therefore, MRSA has high clinical significance and poses a potential public health hazard. The ability of S. aureus to cause infections is due to virulence factors, such as the secretion of several toxins and presence of cell wall adhesion proteins. Thus the bacteria can survive in the udder, causing chronic inflammation [6]. Coagulase is one of the S. aureus virulence factors that stimulates prothrombin, resulting in blood clotting [7,8]. Additionally, protein A is a cell wall component that hinders phagocytosis by neutrophils and contains the Fc-portion, X-segment, and C-terminal portion. This X-region of spa gene usually undergoes repetition (up to 24 repeats) and differs from one strain to another [9,10]. Another virulence factor of S. aureus is leukotoxin which is very toxic to WBCs, especially neutrophils. The most important S. aureus leukotoxin is Panton-Valentine leukocidin (PVL) which is composed of S and F proteins and destroys the neutrophil’s cell membrane. PVL and SEs are the most potent virulence determinants of S. aureus with a significant role in the initiation and pathogenesis of the disease [11,12]. Milk ingredients enhance the growth of S. aureus and subsequently the production of enterotoxins which are heat stable and resist pasteurization. Therefore, raw milk with improper storage standards has an increased rate of food intoxication. For example, S. aureus enterotoxin A, considered as a potent virulence markers, can resist heating temperature up to 121 °C for 20 min [13]. Further, staphylococcal enterotoxins (A, B, C, D, and E) are the primary cause of food poisoning outbreaks, while the other types are responsible for sporadic cases [8,14]. The estimated population of cattle and buffaloes in Egypt by 2019 was 9.3 million head, with more than 7.2 million tons of milk production [15]. Therefore, in this study, we aimed to investigate the prevalence and antimicrobial resistance of S. aureus in tested milk samples, and investigate the prevalence virulence determinant (coa, spa, pvl and mecA) and enterotoxins (sea, seb, sec and sed) genes of MRSA isolated from bovine species milk in Egypt.

2. Materials and Methods

2.1. Collection of Milk Samples

Four hundred eighty milk samples were collected in the period between December 2018 and February 2019 under aseptic conditions. Milk samples were collected from 120 clinically healthy lactating animals from two farms (50 local breed buffaloes from one farm and 70 dairy cattle from the other farm) located in Ismailia Province, Egypt. The selected farms use manual milking regimes and practice intensive management systems. Four milk samples were collected from each animal (one sample per quarter of the udder). Subclinical mastitis animals were selected based on specific characteristics including: (1) being apparently unaffected by the illness, and (2) exhibiting a reduction in milk yield, which might result in high somatic cell count. The handling of animals was done as described by the Animal Ethics Board Committee of Suez Canal University, Egypt. Before sample collection, the udder of each animal was palpated for the detection of any abnormalities such as swelling, hotness, asymmetry, and any physical changes. Animal’s udder, teats, and hands of the examiner were washed using running water and soap and were dried with a clean towel. The udder, teats, and tester hands were then sterilized with 70% ethyl alcohol to ensure that there was no external contamination. The first strips of milk were excluded and thrown away as they may be contaminated from the teat orifice, then 15–20 mL of milk samples were collected from each quarter into sterile screw-capped McCartney bottles (Thermo Fisher Scientific, Waltham, MA, USA). Milk samples were immediately transported to the laboratory in an ice container [16].

2.2. California Mastitis Test (CMT)

In order to determine the milk samples infected with subclinical mastitis, CMT (screening test) was used. The test procedures were conducted as previously mentioned [17,18]. The test depends on the interaction of the reagent with DNA of somatic cells present in milk. Briefly, in a cup of the white plastic paddle, 2 mL of scam reagent was added to an equal volume of milk sample from each quarter of the udder and mixed by a gentle circular motion. The test results were evaluated visually within 20 s and interpreted as; − (0), ± (T), + (1), + + (2), and + + + (3) based on the amount of gel formation. Milk samples from individual quarters with positive CMT scores were subjected to bacteriological examination.

2.3. Isolation and Identification of S. aureus

The screened positive milk samples were incubated at 37 °C for 24 h, and then centrifuged at 3000 rpm for 5 min. The cream layer was discarded and sediments were streaked onto blood agar, nutrient agar, and mannitol salt agar plates (Oxoid, Hampshire, UK). The streaked plates were then incubated at 37 °C for 24–48 h. The suspected grown colonies were identified morphologically and biochemically as previously mentioned [17]. S. aureus circular convex golden-yellow colonies were collected and preserved at −80 °C in media containing 10% glycerol (v/v) for further analysis. The confirmation of the retrieved colonies was performed using PCR for 16Sr RNA gene identification as previously described [19].

2.4. Antimicrobial Susceptibility Testing of S. aureus

Antimicrobial susceptibility testing was carried out using disc diffusion technique [20]. The isolated strains were tested for their susceptibility to cefoxitin (Cef; indicative for MRSA), penicillin (Pen), ampicillin-sulbactam (Amp-Sul), amoxicillin-clavulanic acid (Amo-Cla), tetracycline (Tet), cefotaxime (Ceft), and erythromycine (Ery) (Oxoid). The selected antimicrobials are representative of the drugs used for humans and in the animal industry and were chosen according to the National Antimicrobial Resistance Monitoring System (NARMS) records. The reference strain (S. aureus ATCC 25923) was used as a control for the disc diffusion technique. The test was conducted on Muller Hinton agar plates (MH, Oxoid) and the plates were incubated at 37 °C for 24 h. The test was performed in accordance with the recommendations of the Clinical Laboratory Standards Institute (CLSI) criteria using the available CLSI interpretive criteria (Table 1).
Table 1

Interpretive criteria for inhibition zone diameter [20,21].

Antimicrobial AgentDisc Conc.Diameter of Inhibition Zone (mm)
RIS
Pen10 units28 or less-29 or more
Amo-Cla10–20 µg19 or less -20 or more
Amp-Sul10 µg11or less12–1415 or more
Tet30 µg14 or less15–1819 or more
Ceft30 µg14 or less15–2223 or more
Cef30 µg≤21 mm--
Ery15 µg13 or less14–1718 or more

R: Resistant, I: Intermediate, S: Sensitive. According to the National Committee for Clinical Laboratory standards. Cefoxitin (Cef); Penicillin (Pen); Ampicillin-sulbactam (Amp-Sul); Amoxicillin-clavulanic acid (Amo-Cla); Tetracycline (Tet); Cefotaxime (Ceft); Erythromycine (Ery).

2.5. Detection of Virulence and Enterotoxins Genes of MRSA Strains Using PCR

2.5.1. Genomic DNA Extraction

DNA of MRSA strains was extracted using the boiling method. Briefly, a half loopfull from S. aureus plate cultures were suspended in 100 μL of DNase-free water, heated at 95 °C for 10 min, cooled, and then centrifuged at 5000× g for 10 min. The supernatant containing the genomic DNA was collected in a new tube and stored at −20 °C for further use. DNA was quantified using a Nanodrop 1000 instrument (Thermo Scientific, Loughborough, UK).

2.5.2. Polymerase Chain Reaction (PCR)

The extracted DNA from MRSA strains were screened for virulence genes (coa, spa, pvl and mecA) and enterotoxins genes (sea, seb, sec and sed) detection. Amplification was performed in PCR tubes, in a 25 µL reaction volume, containing 200 µM of dNTPS buffer (dATP, dGTP, dCTP and dTTP), 50 picomol of each forward and reverse primers, and 0.5 units of taq DNA polymerase (NZYtech, Lisbon, Portugal). The PCR reaction mixtures were amplified in the MJ MiniTM Gradient Thermocycler apparatus (Biometra, Göttingen, Germany). Primers sequence, expected amplicon size, and annealing temperature are described in Table 2. Nuclease-free water was used as a negative control. Positive controls DNA were obtained from the Department of Microbiology, Faculty of Veterinary Medicine, Suez Canal University, Egypt. PCR products were visualized on a 1.5% agarose gel containing ethidium bromide under UV light and 100 bp ladder (Fermentas, Thermo Scientific, Darmstadt, Germany) was used.
Table 2

List of primers and recycling conditions of PCR assay.

PrimerPrimer Sequence.Annealing TemperatureRecycling ConditionsReferences
coa1 ATA GAG ATG CTG GTA CAG G58 °C39 cycles; 94 °C for 1 min, 58 °C for 1 min, 72 °C for 1 min[22]
coa 2 GCT TCC GAT TGT TCG ATG C
sea-3b CCT TTG GAA ACG GTT AAA ACG55 °C30 cycles; 95 °C for 1 min, 55 °C for 1 min, 72 °C for 2 min[23]
sea-4b TCT GAA CCT TCC CAT CAA AAA C
seb-1c TCG CAT CAA ACT GAC AAA CG55 °C
seb-4b GCA GGT ACT CTA TAA GTG CCT GC
sec-3b CTC AAG AAC TAG ACA TAA AAG CTA GG55 °C
sec-4b TCA AAA TCG GAT TAA CAT TAT CC
sed-3b CTA GTT TGG TAA TAT CTC CTT TAA ACG55 °C
sed-4b TTA ATG CTA TAT CTT ATA GGG TAA ACA TC
spa-III CAA GCA CCA AAA GAG GAA60 °C30 cycles; 94 °C for 1 min, 60 °C for 1 min, 72 °C for 1 min [24]
spa-IV CAC CAG GTT TAA CGA CAT
luk-PV-1 ATCATTAGGTAAAATGTCTGGACATGATCCA66 °C34 cycles; 94 °C for 30 s, 66 °C for 30 s, 72 °C for 1 min 30 s[25]
luk-PV-2GCATCAACTGTATTGGATAGCAAAAGC
mecA-1 TGGCATTCGTGTCACAATCG53 °C34 cycles; 94 °C for 1 min, 53 °C for 50 s, 72 °C for 1 min[25]
mecA-2 CTGGAACTTGTTGAGCAGAG

2.6. Statistical Analysis

The Chi-square test was used for the analysis of the recovered frequencies using SAS® software (version 9.4, SAS Institute, Cary, NC, USA) to test the null hypothesis of various treatments. A p-value of <0.05 was considered statistically significant.

3. Results

3.1. Prevalence of S. aureus Subclinical Bovine Mastitis

The prevalence of subclinical mastitis in the collected milk samples from individual quarters using CMT was 44% (88/200) and 52.1% (146/280) in buffaloes and cattle, respectively (Table 3). There was no significant differences between the prevalence of subclinical mastitis between buffaloes and cattle (p > 0.05). Additionally, the total prevalence of S. aureus in the collected milk samples from individual quarters using CMT was 35.9% (84/234) with 36.3%% (53/146) in cattle and 31% (31/88) in buffaloes and no significant difference between cattle and buffaloes (p = 0.8654; X2 = 0.029). Out of them, the prevalence of MRSA was 35.7% (30/84) with 37.7% (20/53) in cattle and 32.2% (10/31) in buffaloes and no significant difference between cattle and buffaloes (p = 0.6203; X2 = 0.245). Detailed results of CMT screening in the collected milk samples are shown in Table 4.
Table 3

Prevalence of subclinical mastitis in buffaloes and cattle (based on CMT).

Animal SpeciesTotal Animals (No.)Total Samples (No.)Negative Samples (No.)Positive Samples (No.)Positive Samples (%)Chi-Square Value
Buffaloes5020011288443.057 NS *p = 0.0804
Cows7028013414652.1
Total12048024623448.75

* NS = non-significant.

Table 4

Results of CMT screening in the collected milk samples.

CMT GradsExamined Quarters (No.)Positive S. aureus Isolates (No.)S. aureusIsolates (%)
+++574375.4
++393282
+13896.5
Total2348435.9

Percentages were calculated in comparison to the total number of examined samples of each grade.

3.2. Antimicrobial Susceptibility Phenotypic Profiles of the S. aureus Isolates

The antimicrobials susceptibility test for S. aureus strains showed that 64.3% (54/84) of the samples were resistant to penicillin, 59.5% (50/84) were resistant to tetracycline and 35.7% (30/84) of the strains were resistant to cefoxitin (defined as MRSA). In addition, 58.3% (49/84) of the tested strains exhibited intermediate sensitivity to cefotaxime, whereas 64.3% (54/84) of the tested strains were sensitive to cefoxitin. Our results also showed that 78.6% (66/84) of the strains were sensitive to amoxicillin-clavulanic acid, 72.6% (61/84) to ampicillin-sulbactam, and 63.1% (53/84) were sensitive to erythromycin. Details about the antimicrobial susceptibility phenotypic profiles of the S. aureus strains are shown in Table 5.
Table 5

Antimicrobial sensitivity test of the isolated S. aureus strains.

Antimicrobial AgentsResistantIntermediateSensitive
No.%No.%No.%
Cef30 (MRSA)35.7--5464.3
Pen5464.3--3035.7
Amo- Cla1821.4--6678.6
Amp-Sul1113.11214.36172.6
Tet5059.51517.91922.6
Ceft1315.54958.32226.2
Ery2630.955.95363.1
Chi-square value94.7860 *p < 0.0001186.19 *p < 0.0001104.25 *p < 0.0001

* Significant differences in the prevalence between the antimicrobial agents. Cefoxitin (Cef); Penicillin (Pen); Ampicillin-sulbactam (Amp-Sul); Amoxicillin-clavulanic acid (Amo-Cla); Tetracycline (Tet); Cefotaxime (Ceft); Erythromycin (Ery). There was significant differences between Cef and Pen: X2 = 13.660, p = 0.0002, Cef and Amp-Sul: X2 = 11.560, p = 0.0007; Cef and Tet: X2 = 9.481, p = 0.0021; Pen and Amo-Cla: X2 = 31.376, p < 0.0001; Pen and Amp-Sul: X2 = 46.134, p < 0.0001; Pen and Ceft: X2 = 41.462, p < 0.0001; Pen and Ery: X2 =18.673, p < 0.0001; Amo-Cla and Tet: X2 = 25.160, p < 0.0001; Amp-Sul and Tet: X2 = 38.873, p < 0.0001; Tet and Ceft: X2 = 34.487, p < 0.0001; and Tet and Ery: X2 = 13.787, p = 0.0002.

3.3. Virulence Determinant Genes of MRSA Strains

Thirty isolates of MRSA strains were subjected to PCR for the detection of coa, spa, pvl and mecA genes. All the 30 tested strains (100%) were positive for coa gene that showed no gene polymorphism, while 26 out of 30 strains (86.6%) were positive for spa gene and showed a remarkable gene polymorphism with different amplicons size (140 bp, 270 bp and 290 bp). Only 3 out of 30 strains (10%) were positive for pvl gene. Furthermore, all the examined strains (100%) were positive for mecA gene. There is a significant difference in the prevalence of virulence determinant genes (p < 0.0001) among the examined MRSA strains (Table 6).
Table 6

Prevalence of virulence and enterotoxins determinant genes of MRSA strains isolated from bovine milk.

GenesNo%Chi-Square Value
Virulence Genes coa 3010062.6900 *p < 0.0001
spa 2686.6
pvl 310
mecA30100
Enterotoxins Genes sea 826.621.9751 *p < 0.001
sea+sec 13.3
sec 26.6
seb 00
sed 00
Chi-square value168.0403 *p < 0.0001

No of the examined MRSA strains= 30. There were significant differences between spa and pvl at X2 = 34.659, between coa and pvl at X2 = 48.273; and between mecA and pvl virulence genes at X2 = 48.273 (p < 0.0001). There were significant differences between sea and seb/sed enterotoxins genes at X2 = 9.051 and p = 0.0026. * Significant difference in the prevalence between different virulence genes and between different enterotoxins genes.

3.4. Prevalence of Enterotoxins Genes among MRSA Strains

The prevalence of enterotoxins genes (sea, seb, sec and sed) among MRSA strains were detected using multiplex PCR. Our results showed that eight out of 30 strains (26.6%) were positive for sea gene, two out of 30 strains were positive for sec gene, one out of 30 strains (3.3%) was positive for both sea and sec genes, and none of the tested strains harbored seb and sed genes. Hence, 11 out of 30 strains (36.6%) were enterotoxignic (Table 6). The prevalence of the enterotoxins genes showed a significant difference (p < 0.0001) among the examined MRSA strains.

4. Discussion

Subclinical mastitis is a significantly important disease, causing economic losses in the livestock industry, not only in Egypt, but also worldwide. Antibiotic resistance has increased among various bacterial pathogens, which is considered an emerging problem with a major public health concern due to the risk of resistance transmission to human as well as its influence on the effectiveness of the current antibiotic therapy [26,27,28,29]. Further, MRSA strains can cause nosocomial infections and high mortality in humans [3]. In this study, the detected prevalence of subclinical mastitis was 44% and 52.1% in buffaloes and cattle, respectively, with a total prevalence of 48.6% and no significant difference in the prevalence between both animal species (Table 3). This high prevalence of bovine subclinical mastitis was similar to the results obtained in other previous studies [16,30]. The increased incidence of subclinical mastitis in dairy livestock is attributed to multiple predisposing factors including: (1) contaminated milking machines, (2) improper housing, (3) bad sanitation, and (4) bad handling of animals. Furthermore, the failure in the treatment always occurred due to: (1) chronic infection accompanied with fibrosis, (2) inadequate dose of antibiotics, and (3) emergence of multidrug-resistant bacterial pathogens [31]. The prevalence of S. aureus recovered from subclinical mastitis infected animals was 36% (p < 0.0001). This result was similar to previous studies [16,32] and lower than the prevalence (6.5%) reported by Haltia, et al. [33]. S. aureus transmission between animals is due to using of contaminated milk utensils and is also due to contaminated milker’s hands [34]. Additionally, cefoxitin resistance (MRSA) was used determine the methicillin-resistant S. aureus isolates, and antimicrobial susceptibility testing showed that 35.7% of the recovered S. aureus strains were resistant to cefoxitin (Table 5). Further, the identified MRSA strains were confirmed using PCR for detection of mecA gene, where all the tested strains (100%) harbored this gene (Table 6) conferred marked resistance to various antimicrobial agents such as cefoxitin, penicillins, cephalosporins, macrolides, aminoglycosides and tetracyclines. Since the 1990s, most MRSA isolates possessed a multidrug-resistant phenotype and carried many resistant determinants in chromosome and plasmids. Resistance to methicillin is attributed to the existence of mecA gene on the S. aureus chromosome, which is encoded for the synthesis of PBP2a. Methicillin is stable in the presence of β-lactamase enzymes and is effective in the treatment of S. aureus infection, but not against MRSA that resist methicillin [35,36,37]. In this study, 64.3% S. aureus strains were resistant to penicillin which was in agreement with other studies (more than 50%) [38] and lower than resistance rate (7.1%) determined by Bengtsson, et al. [39]. The failure of treatment of subclinical mastitis with penicillin was mainly due to the release of β-lactamase by S. aureus, which causes hydrolysis of β-lactam rings. The majority of S. aureus strains release penicillinases which consequently make S. aureus resistant to the β-lactam group of antibiotics [40]. Furthermore, 78.57% S. aureus strains were sensitive to amoxicillin-clavulanic acid, while 72.62% was sensitive to ampicillin-sulbactam. The isolation of a naturally occurring β-lactamase inhibitor (clavulanic acid) from Streptomyces clavuligerus was a major step in the formulation of new antibiotic combinations. Sulbactam and clavulanic acid (β-lactam antibiotics) have very poor bactericidal ability, however, they are a very strong β -lactamase inhibitors [41]. We observed that 59.5% of the strains were resistant to tetracyclin, a broad-spectrum antibiotic groups that, due to its extensive use, resulted in the development of resistant strains. Resistance to tetracyclines resulted from the production of ribosomal protection protein by S. aureus that makes a competitive binding to tetracycline. The tet gene that is carried on conjugative plasmids of S. aureus is responsible for their production [42]. In addition, 58.3% of the S. aureus strains were moderately sensitive to cefotaxime, while 63.1% were sensitive to erythromycin. In general, third-generation cephalosporins have strong activity against Gram-negative bacteria and moderate activity against Gram-positives, such as S. aureus and Streptococci. Unlike penicillin, third-generation cephalosporins have stable activity in presence of β-lactamase enzyme. Erythromycin belongs to the macrolide class and showed a potent antibacterial activity against both Gram-positive and Gram-negative bacteria, including Staphylococci, Streptococci and E. coli [41,43]. The coa gene was 100% prevalent in the tested MRSA strains. These results are similar to those reported by Akineden, Annemüller, Hassan, Lämmler, Wolter and Zschöck [24]. This gene exhibited no size polymorphisms [44]. However, in other studies, coagulase gene amplification resulted in different amplicons, indicating coagulase gene size polymorphism [34]. The spa gene displayed remarkable gene polymorphisms where different sized amplicons were found (140, 270, and 290 bp). The X region of spa gene usually undergoes variable repetitions (up to 24 repeats) which might be different in different strains [10]. Number of repeats is associated with the dissemination potential of S. aureus, where strains that have more than seven repeats in the X region were considered as epidemic, whereas the presence of seven or less repeats were considered as non-epidemic MRSA [14]. Further, the pvl gene was detected in 10% of the tested strains. The presence of pvl gene in S. aureus was similar to that obtained previously [45] and disagrees with the results obtained by Ikawaty, et al. [46]. The pvl gene is considered as the most powerful staphylococcal leukotoxin that could resist bovine neutrophils [47]. Therefore, pvl may contribute to resistance by attacking the bovine polymorph-nuclear cells and increase pathogenicity against the host [46]. Interestingly, the sea gene was detected in 26.6% of the tested strains followed by sec gene (6.6%) then mixed (sea and sec) genes in 3.3%, while none of MRSA strains harbored seb and sed genes (Table 6). The high prevalence of sea and sec gene was previously reported by Rall, et al. [48]. The sea gene was the most predominant enterotoxins gene isolated in other studies conducted on S. aureus [49]. This gene is very resistant to pasteurization heat and maintain some biological activity after 28 min at 121 °C [50]. It’s also considered as the most frequently detected gene in the US food poisoning outbreaks followed by sed and seb and 95% of these outbreaks have sea and see enterotoxins [51].

5. Conclusions

In conclusion, subclinical mastitis caused by S. aureus is considered as one of the major economically important diseases with public health significance. The most predominant virulence genes associated with MRSA strains in bovine milk were coa, mecA and spa, whereas, the most predominant enterotoxin gene is sea that causes food poisoning in human consumers after ingestion of contaminated milk. Based on our knowledge, this is the first study that emphasizes the occurrence of pvl in MRSA strains originating from bovine species milk in Egypt. The continuous application of the antimicrobial susceptibility testing of S. aureus in the future will be necessary to determine the drug choice for disease control.
  42 in total

1.  Coagulase-positive Staphylococci and Staphylococcus aureus in food products marketed in Italy.

Authors:  G Normanno; A Firinu; S Virgilio; G Mula; A Dambrosio; A Poggiu; L Decastelli; R Mioni; S Scuota; G Bolzoni; E Di Giannatale; A P Salinetti; G La Salandra; M Bartoli; F Zuccon; T Pirino; S Sias; A Parisi; N C Quaglia; G V Celano
Journal:  Int J Food Microbiol       Date:  2005-01-15       Impact factor: 5.277

2.  Potential efficiency of conventional and advanced approaches used to detect Mycobacterium bovis in cattle.

Authors:  Abdelazeem M Algammal; Ali Wahdan; Mahmoud M Elhaig
Journal:  Microb Pathog       Date:  2019-06-04       Impact factor: 3.738

3.  Immunosuppression by T regulatory cells in cows infected with Staphylococcal superantigen.

Authors:  Byoung Sun Chang; Gregory A Bohach; Sang Un Lee; William C Davis; Lawrence K Fox; Witold A Ferens; Keun Seok Seo; Hye Cheong Koo; Nam Hoon Kwon; Yong Ho Park
Journal:  J Vet Sci       Date:  2005-09       Impact factor: 1.672

4.  Genetic variation among Staphylococcus aureus strains from bovine milk and their relevance to methicillin-resistant isolates from humans.

Authors:  Eiji Hata; Ken Katsuda; Hideki Kobayashi; Ikuo Uchida; Kiyoshi Tanaka; Masashi Eguchi
Journal:  J Clin Microbiol       Date:  2010-04-14       Impact factor: 5.948

5.  Toxin genes and other characteristics of Staphylococcus aureus isolates from milk of cows with mastitis.

Authors:  C Annemüller; A A Hassan; C Lämmler; W Wolter; M Zschöck
Journal:  Clin Diagn Lab Immunol       Date:  2001-09

6.  Rapid and specific detection of toxigenic Staphylococcus aureus: use of two multiplex PCR enzyme immunoassays for amplification and hybridization of staphylococcal enterotoxin genes, exfoliative toxin genes, and toxic shock syndrome toxin 1 gene.

Authors:  K Becker; R Roth; G Peters
Journal:  J Clin Microbiol       Date:  1998-09       Impact factor: 5.948

7.  Phenotypic and genotypic characteristics of Staphylococcus aureus isolates from raw bulk-tank milk samples of goats and sheep.

Authors:  D Scherrer; S Corti; J E Muehlherr; C Zweifel; R Stephan
Journal:  Vet Microbiol       Date:  2004-06-21       Impact factor: 3.293

Review 8.  Pathogenesis of methicillin-resistant Staphylococcus aureus infection.

Authors:  Rachel J Gordon; Franklin D Lowy
Journal:  Clin Infect Dis       Date:  2008-06-01       Impact factor: 9.079

9.  Prevalence, molecular typing, and antimicrobial resistance of bacterial pathogens isolated from ducks.

Authors:  Hamza M Eid; Abdelazeem M Algammal; Wael K Elfeil; Fatma M Youssef; Sawsan M Harb; Ehab M Abd-Allah
Journal:  Vet World       Date:  2019-05-18

10.  The occurrence of the multidrug resistance (MDR) and the prevalence of virulence genes and QACs resistance genes in E. coli isolated from environmental and avian sources.

Authors:  Mohamed E Enany; Abdelazeem M Algammal; Soad A Nasef; Sara A M Abo-Eillil; May Bin-Jumah; Ayman E Taha; Ahmed A Allam
Journal:  AMB Express       Date:  2019-12-03       Impact factor: 3.298

View more
  23 in total

1.  Bacteriological Quality and Antimicrobial Susceptibility Patterns Among Raw Milk Producers and Vendors in Gomole District, Borena Zone, Southern Ethiopia.

Authors:  Alqeer Aliyo; Ayichew Seyoum; Zelalem Teklemariam
Journal:  Infect Drug Resist       Date:  2022-05-20       Impact factor: 4.177

2.  Is Multidrug Resistance in Acute Otitis Media with Streptococcus pneumoniae Associated with a More Severe Disease?

Authors:  Raluca Horhat; Florin-Raul Horhat; Valeria Mocanu
Journal:  Med Princ Pract       Date:  2021-07-29       Impact factor: 1.927

3.  Virulence-determinants and antibiotic-resistance genes of MDR-E. coli isolated from secondary infections following FMD-outbreak in cattle.

Authors:  Abdelazeem M Algammal; Helal F Hetta; Gaber E Batiha; Wael N Hozzein; Waleed M El Kazzaz; Hany R Hashem; Ayat M Tawfik; Reham M El-Tarabili
Journal:  Sci Rep       Date:  2020-11-13       Impact factor: 4.379

4.  Antibiogram and Genetic Characterization of Carbapenem-Resistant Gram-Negative Pathogens Incriminated in Healthcare-Associated Infections.

Authors:  Rabab R Makharita; Iman El-Kholy; Helal F Hetta; Moahmed H Abdelaziz; Fatma I Hagagy; Amera A Ahmed; Abdelazeem M Algammal
Journal:  Infect Drug Resist       Date:  2020-11-04       Impact factor: 4.003

5.  MBLs, Rather Than Efflux Pumps, Led to Carbapenem Resistance in Fosfomycin and Aztreonam/Avibactam Resistant Elizabethkingia anophelis.

Authors:  Yanbin Chang; Daiqin Zhang; Siqiang Niu; Qian Chen; Qiuxia Lin; Xiaobing Zhang
Journal:  Infect Drug Resist       Date:  2021-01-29       Impact factor: 4.003

6.  Detection of gyrA and parC Mutations and Prevalence of Plasmid-Mediated Quinolone Resistance Genes in Klebsiella pneumoniae.

Authors:  Sawsan Mohammed Kareem; Israa M S Al-Kadmy; Saba S Kazaal; Alaa N Mohammed Ali; Sarah Naji Aziz; Rabab R Makharita; Abdelazeem M Algammal; Salim Al-Rejaie; Tapan Behl; Gaber El-Saber Batiha; Mohamed A El-Mokhtar; Helal F Hetta
Journal:  Infect Drug Resist       Date:  2021-02-12       Impact factor: 4.003

7.  Identification and antimicrobial susceptibility of methicillin-resistant Staphylococcus aureus-associated subclinical mastitis isolated from dairy cows in Bogor, Indonesia.

Authors:  Evi Nur Qolbaini; Miftahudin Majid Khoeri; Korrie Salsabila; Wisiva Tofriska Paramaiswari; Wisnu Tafroji; I Made Artika; Dodi Safari
Journal:  Vet World       Date:  2021-05-13

8.  Prevalence of methicillin-resistant Staphylococcus aureus and pattern of antimicrobial resistance in mastitis milk of cattle in Chitwan, Nepal.

Authors:  Asmita Shrestha; Rebanta Kumar Bhattarai; Himal Luitel; Surendra Karki; Hom Bahadur Basnet
Journal:  BMC Vet Res       Date:  2021-07-07       Impact factor: 2.741

9.  Subclinical Mastitis in Selected Bovine Dairy Herds in North Upper Egypt: Assessment of Prevalence, Causative Bacterial Pathogens, Antimicrobial Resistance and Virulence-Associated Genes.

Authors:  Ahmed H Abed; Ahmed M S Menshawy; Mohamed M A Zeinhom; Delower Hossain; Eman Khalifa; Gamal Wareth; Mohamed F Awad
Journal:  Microorganisms       Date:  2021-05-29

10.  Emerging MDR-Pseudomonas aeruginosa in fish commonly harbor oprL and toxA virulence genes and blaTEM, blaCTX-M, and tetA antibiotic-resistance genes.

Authors:  Abdelazeem M Algammal; Mahmoud Mabrok; Elayaraja Sivaramasamy; Fatma M Youssef; Mona H Atwa; Ali W El-Kholy; Helal F Hetta; Wael N Hozzein
Journal:  Sci Rep       Date:  2020-09-29       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.