Literature DB >> 32367947

Phenotypes, antibacterial-resistant profile, and virulence-associated genes of Salmonella serovars isolated from retail chicken meat in Egypt.

Amal Awad1, Mayada Gwida2, Eman Khalifa3, Asmaa Sadat1.   

Abstract

AIM: The present study was designed to investigate the occurrence and distribution of Salmonella serotypes in chicken meat samples, and to explore the susceptibility of the strains to antimicrobials, as well as their virulence-associated genes.
MATERIALS AND METHODS: Two-hundred retail chicken meat samples from different shops, as well as 25 stool specimens from retail shop workers, were included in the study. The collected samples were examined bacteriologically for the presence of salmonellae. Salmonella isolates were serotyped using a slide agglutination test for O and H antigens and were screened for the presence of five virulence genes (stn, pef, inv A , sop B , and avrA) using a uniplex polymerase chain reaction assay and for their susceptibility to 18 antimicrobial agents using the disk diffusion method.
RESULTS: Thirty-one Salmonella isolates belonging to 12 different serovars were identified. Salmonella Enteritidis and Salmonella Kentucky were the dominant serovars (22.6% each). Salmonella isolates displayed a high antibiotic resistance against erythromycin, sulfamethoxazole/trimethoprim, doxycycline, cephalexin, cefaclor, tetracycline, polymyxin B, cefuroxime, vancomycin, and streptomycin. All Salmonella isolates exhibited multidrug resistance (MDR) and demonstrated different virulence genes. The majority of Salmonella serovars (87.1%) harbored sopB gene, 54.8% carried avrA and pef genes, while all isolates carried invA and stn genes.
CONCLUSION: The presence of virulent MDR Salmonellae in raw chicken meat could allow the possibility of transmission of these resistant serovars to humans. Therefore, strict hygienic measures should be followed on the whole poultry production chain to decrease the potential transmission of Salmonella infection from poultry meat to humans. Copyright: © Awad, et al.

Entities:  

Keywords:  Salmonella; antibacterial susceptibility; broilers meat; multidrug resistance; virulence

Year:  2020        PMID: 32367947      PMCID: PMC7183463          DOI: 10.14202/vetworld.2020.440-445

Source DB:  PubMed          Journal:  Vet World        ISSN: 0972-8988


Introduction

Foodborne pathogens such as Salmonella (S) enterica species represent an important worldwide public health problem. Salmonella remains one of the major zoonotic bacterial foodborne pathogens, resulting in 93.8 million annual cases among patients having gastroenteritis, with an estimated 155,000 deaths each year [1]. Poultry is considered the main reservoir for a significant number of infections with S. enterica species, involving cross-contamination events at both the farm and retail levels [2]. A diverse incidence of salmonellosis has been reported recently [3]. The clinical manifestations of the disease among human patients ranged from self-limiting gastroenteritis to severe invasive meningitis, septicemia, and osteomyelitis [4]. The majority of cases are caused by the fecal contamination of foods of animal origin or the consumption of poultry or its products [5]. Monitoring Salmonella infection on poultry farms is a challenging problem and relies mainly on the application of biosecurity measures in the farm setting and the use of antibacterial agents [6]. However, the excessive use of antibacterial medications in the poultry industry, either as growth promoters or to treat disease, could result in the emergence of antibacterial resistance among Salmonella isolates with potential health hazards [7]. Multidrug-resistant (MDR) bacteria from poultry origins have the potential to transfer to humans through the food chain, a danger that has triggered serious public concern [8]. The degree of the pathogenicity of Salmonella infections in the host cell has been attributed to the presence of virulence genes which have a significant role in the occurrence of systemic infections [9]. The presence of the invA gene in Salmonella pathogenicity islands is associated with epithelial invasion and the production of proteins of the type III secretion system (T3SS) [10], while the stn gene mediates enterotoxin production and is often associated with acute gastroenteritis [11]. The plasmid-encoded fimbriae (pef) mediates intestinal adhesion in certain Salmonella serotypes [12], while the multiple function effector proteins encoded by the avrA and sopB genes in the T3SS could facilitate endothelial uptake and invasion [13]. Therefore, recognizing the existence and characterization of Salmonella in retail chicken meat is important for emerging effective treatment approaches to control salmonellosis. Currently, it is difficult to assess the impact of retail chicken meat MDR on public health due to the limited availability of data in the study area. MDR in retail chicken meat is not systematically monitored in most Egyptian governorates, and the existing data are scarce. The present study was designed to investigate the occurrence and distribution of Salmonella serotypes in chicken meat samples, and to explore the susceptibility of the strains to antimicrobials, as well as their virulence-associated genes

Materials and Methods

Ethical approval

This study did not need ethical approval. However, the procedures performed in the current study were in accordance with the ethical standards of the institutional and/or national research committee and those of Mansoura University.

Samples collection

A total of 200 samples were collected from 100 chicken carcasses (two samples from each carcass) from local retail chicken meat shops at Mansoura city, Dakahlia Province, Egypt, during the period between September 2017 and December 2017. In addition, 25 stool specimens were collected from retail shops workers in sterile cups. For chicken meat, the samples were collected separately in sterile polyethylene bags to prevent cross-contamination and kept in clean sterile containers to be transferred within an hour through insulated coolers containing cold packs bag to the laboratory for Salmonella isolation and identification.

Bacteriological examination

The procedures of Salmonella isolation and identification were performed, according to standard methods (ISO6579:2002; International Organization for Standardization 2002). Briefly, 25 g from each chicken meat sample were cut into small pieces by sterile scissors. Then add to a stomach bag containing 225 mL sterile Buffered Peptone Water (BPW) (Oxoid, Hampshire, England). For the stool samples, 1 g was added to 9 ml BPW, then all the samples were incubated at 37°C for 18 h. 0.1 mL of the pre-enriched broth was transferred to 10 mL of Rappaport-Vassiliadis broth (Oxoid, Hampshire, England) and incubated at 42°C for 24 h. A loopful of the enriched broth was then streaked on xylose lysine desoxycholate agar and incubated for 24 h at 37°C. Biochemical examination of the suspected Salmonella colonies was performed, according to the (ISO6579:2002; International Organization for Standardization 2002) guidelines [14].

Serotyping

Serotyping of the biochemically identified Salmonella isolates was accomplished according to the Kauffmann–White–Le Minor technique on the basis of surface antigen identification using polyclonal antisera (Difco Laboratories, Detroit, USA) to determine the O (somatic) and H (flagellar) antigenic epitopes at the Department of Food Hygiene and Control, Faculty of Veterinary Medicine, Benha University.

Molecular identification of Salmonella virulence-associated genes

Genomic DNA was extracted from the identified Salmonella serovars, according to Ramadan et al. [15]. The polymerase chain reaction (PCR) assays were conducted in individual reactions using an applied Biosystems 96-well Thermal Cycler to detect five Salmonella associated virulence genes (stn, pef, inv A , sopB, and avrA). The sets of primer sequences and corresponding amplicon sizes are illustrated in Table-1. All PCR reactions were performed in a total volume of 25 μL consisting of 12.5 μL of 2×PCR master mixes (Promega, Madison, USA), 6 µL DNA templates, and 1 μL of each primer (Metabion, Germany) brought to 25 μL using DNA/RNA free water. PCR reactions and thermal conditions used were performed, according to the referenced authors (Table-1) [9,16,17]. An aliquot of each amplified product was subjected to electrophoresis in a 1.5% agarose gel. The separated bands were visualized and photographed under an ultraviolet transilluminator.
Table-1

Primers sequences used in PCR for detection of virulence genes in Salmonella serovars.

PrimerSequenceVirulence factorAmplified productReferences
stnTTG TGT CGC TAT CAC TGG CAA CCEnterotoxin/Chromosome617 bp[9]
ATT CGT AAC CCG CTC TCG TCC
PefTGT TTC CGG GCT TGT GCTPlasmid encoded fimbriae/Plasmid700 bp
CAG GGC ATT TGC TGA TTC C
invAGTGAAATTATCGCCACGTTCGGGCAASalmonella species/SPI-1284 bp[16]
TCATCGCACCGTCAAAGGAACC
sopBTCA GAA GRC GTC TAA CCA CTCTranslocated effector protein/SPI-5517 bp[17]
TAC CGT CCT CAT GCA CAC TC
avrACCT GTA TTG AGC GTC TGGEffector protein/SPI-1422 bp
AGA GCT TCG TTG AAT GTC C

PCR=Polymerase chain reaction

Primers sequences used in PCR for detection of virulence genes in Salmonella serovars. PCR=Polymerase chain reaction

Antibacterial susceptibility testing

Salmonella serovars were tested for their antibiotic susceptibility against 18 different antimicrobial agents belonging to different antimicrobial classes through the disk diffusion method following Clinical and Laboratory Standards Institute guidelines [18]. The following antibiotic disks (Oxoid, Basingstoke, Hampshire, UK) were used: Polymyxin B (PB; 300 μg), azithromycin (AZM; 15 μg), cephalexin (CL; 30 μg), cefuroxime (CXM; 30 μg), cefaclor (CEC; 30 μg), erythromycin (E; 15 μg), sulfamethoxazole/trimethoprim (SXT; 23.75/1.25 μg), streptomycin (S; 10 μg), neomycin (N; 30 μg), vancomycin (VA; 30 μg), norfloxacin (NOR; 10 μg), doxycycline (DO; 30 μg), penicillin (P; 10 μg), gentamycin (CN; 10 μg), tetracycline (TE; 30 μg), amoxicillin (AX; 25 μg), AX/clavulanic acid (AMC; 30 μg), and rifampin (RA; 5 μg). The isolates were defined as MDR if they exhibited resistance to three or more antimicrobial classes.

Results

Out of the total examined chicken samples (n=200), 31 (15.5%) Salmonella isolates were recovered. None of the examined workers stool samples’ yielded positive results. The identified serogroups among Salmonella isolates were B, C1, C2, C3, and D. Group C3 was the predominant group in the obtained isolates (Table-2). Twelve serotypes were identified including, Salmonella Enteritidis (n=7), Salmonella Kentucky (n=7), Salmonella Typhimurium (n=6), Salmonella Molade (n=2), Salmonella Labadi (n=2), Salmonella Takoradi (n=1), Salmonella Papuana (n=1), Salmonella Tamale (n=1), Salmonella Larochelle (n=1), Salmonella Infantis (n=1), Salmonella Inganda (n=1), and Salmonella Bargny (n=1). The Salmonella isolates demonstrated a high resistance against E (96.78%), followed by SXT (93.55%), DO and CL (93.55%), CXM (83.33%), CEC (87.19%), S (80.65%), PB (83.33%), TE (83.88%), P (70.97%), AX (67.8%), AMC (83.88%), VA (83.88%), RA (70.97%), and AZM (58.07%) (Table-3). In contrast, all recovered Salmonella isolates displayed a high sensitivity to NOR (100%), CN (96.77%), and N (83.87%). MDR (resistance to three or more antimicrobials) was observed in all tested isolates (Table-4).
Table-2

Distribution of Salmonella serovars in retail chicken meat samples.

Identified serotypesNumber of serotypes (31)Prevalence %GroupAntigenic structure

OH
Salmonella Kentucky722.6C38,20i:Z6
Salmonella Enteritidis722.6D11,9,12g,m:-
Salmonella Typhimurium619.4B1,4,5,12i:1,2
Salmonella Labadi26.5C38,20d:Z6
Salmonella Molade26.5C28,20Z10:Z6
Salmonella Larochelle13.2C16,7e,h:1,2
Salmonella Takoradi13.2C28,20i:1,5
Salmonella Tamale13.2C38,20Z29:e,n,Z15
Salmonella Papuana13.2C16,7r,e,n,z15
Salmonella Infantis13.2C16,7r:1,5
Salmonella Inganda13.2C16,7Z10:1,5
Salmonella Bargny13.2C38,20i:1,5
Table-3

Percentages of antimicrobial resistance among Salmonella serovars.

Antibiotic used (µg/disc)Disk codeSensitivity (%)Resistant (%)
Erythromycin (15 μg)E3.2296.78
Azithromycin (15 μg)AZM41.9358.07
Cephalexin (30 μg)CL6.4593.55
Cefuroxime (30 μg)CXM16.1283.33
Cefaclor (30 μg)CEC12.9087.19
sulfamethoxazole trimethoprim, (23.75/1.25 μg)SXT6.4593.55
Doxycycline (30 μg)DO6.4593.55
Tetracycline (30 μg)TE16.1283.88
Polymyxin B (300 μg)PB16.1283.33
Streptomycin (10 μg)S19.3580.65
Gentamycin (10 μg)CN96.773.23
Neomycin (30 μg)N83.8716.13
Pencillin G (10 μg)P29.0370.97
Amoxacillin (25 μg)AX32.2667.8
Amoxacillin/clavulanic acid (30 μg)AMC16.1283.88
Norfloxacin (10 μg)NOR1000.00
Rifampin (5 μg)RA29.0370.97
Vancomycin (30 μg)VA16.1283.88

E=Erythromycin, AZM=Azithromycin, CL=Cephalexin, CXM=Cefuroxime, CEC=Cefaclor, SXT=Sulfamethoxazole/trimethoprim, DO=Doxycycline, TE=Tetracycline, PB=Polymyxin B, S=Streptomycin, CN=Gentamycin, N=Neomycin, P=Penicillin, AX=Amoxicillin, AMC=AX/clavulanic acid, NOR=Norfloxacin, RA=Rifampin, VA=Vancomycin

Table-4

Virulence genes and antibiotic resistance profiles of Salmonella serovars.

PatternSerovarsVirulence genesAntimicrobial resistance profile
1S. Kentuckystn, pef, invATE, CXM, VA, E, PB, CEC, S, STX, P, CL
2S. KentuckysopB, stn, invARA, CXM, VA, E, PB, CEC, DO, S, AMC, STX, AX, P, CL
3S. KentuckysopB, stn, invACN, TE, CXM, E, AZM, CEC, DO, S, AMC, ATX, P, CL
4S. KentuckysopB, stn, invARA, CXM, VA, E, AZM, PB, CEC, DO, S, AMC, STX, AX, P, CL
5S. KentuckysopB, stn, avr, pef, invACN, RA, TE, CXM, VA, E, AZM, PB, CEC, DO, S, AMC, STX, AX, P, CL
6S. KentuckysopB, stn, avr, pef, invAN, TE, CXM, PB, DO, STX, CL
7S. KentuckysopB, stn, pef, avr, invACN, N, RA, TE, CXM, VA, E, AZM, PB, CEC, DO, AMC, STX, AX, P, CL
8S. EnteritidissopB, stn, avr, pef, invARA, TE, CXM, VA, E, AZM, PB, CEC, DO, S, AMC, STX, AX, P, CL
9S. EnteritidissopB, stn, avr, invARA, TE, VA, E, PB, CEC, DO, S, AMC, AX, P, CL
10S. EnteritidissopB, stn, pef, invACN, RA, TE, CXM, VA, E, PB, CEC, DO, S, AMC, STX, AX, CL
11S. EnteritidissopB, stn, pef, invATE, CXM, VA, E, AZM, PB, CEC, DO, S, AMC, STX, AX, CL
12S. EnteritidissopB, stn, avr, invATE, CXM, E, AZM, PB, CEC, DO, S, AMC, STX, AX, CL
13S. EnteritidissopB, stn, avr, pef, invAN, RA, TE, CXM, VA, E, PB, CEC, DO, S, AMC, STX, AX, P, CL
14S. EnteritidissopB, stn, avr, pef, invARA, TE, CXM, VA, E, AZM, PB, CEC, DO, S, AMC, STX, AX, P, CL
15S. TyphimuriumsopB, stn, pef, invATE, VA, E, DO, AMC, STX, P, CL
16S. TyphimuriumsopB, stn, pef, avr, invATE, CXM, VA, E, S, STX, P
17S. TyphimuriumsopB, stn, invARA, TE, CXM, E, AZM, PB, CEC, DO, S, AMC, STX, CL
18S. TyphimuriumsopB, stn, avr, invARA, TE, VA, E, PB, CEC, DO, S, AMC, AX, P, CL
19S. TyphimuriumsopB, stn, avr, invARA, CXM, VA, E, AZM, PB, CEC, DO, S, AMC, STX, AX, P, CL
20S. Typhimuriumstn, pef, invACN, RA, TE, CXM, VA, E, AZM, PB, CEC, DO, S, AMC, STX, AX, P, CL
21S. LabadisopB, stn, invARA, TE, CXM, VA, E, AZM, PB, CEC, DO, S, AMC, STX, AX, P, CL
22S. LabadisopB, stn, avr, pef, invACN, N, RA, TE, CXM, VA, E, PB, CEC, DO, S, STX, AX, CL
23S. MoladesopB, stn, invARA, TE, CXM, VA, E, AZM, CEC, DO, S, AMC, STX, CL
24S. MoladesopB, stn, avr, pef, invARA, TE, CXM, VA, E, AZM, PB, CEC, DO, S, AMC, STX, AX, P, CL
25S. IngandasopB, stn, avr, invARA, TE, CXM, VA, E, AZM, PB, CEC, DO, S, STX, CL
26S. BargnysopB, stn, avr, pef, invARA, TE, CXM, VA, E, PB, CEC, DO, AMC, STX, AX, CL
27S. Larochellestn, invARA, TE, CXM, VA, E, PB, DO, S, AMC, STX, P, CL
28S. TakoradisopB, stn, pef, invAVA, E, PB, CEC, DO, S, AMC, STX, P, CL
29S. TamalesopB, stn, avr, invAE, PB, CEC, DO, AMC, AX, P
30S. PapuanasopB, stn, avr, pef, invARA, TE, CXM, VA, E, AZM, CEC, DO, S, AMC, STX, AX, P, CL
31S. Infantisstn, invACN, N, RA, TE, CXM, VA, E, AZM, PB, CEC, DO, AMC, STX, AX, P, CL

S. Kentucky=Salmonella Kentucky, S. Enteritidis=Salmonella Enteritidis, S. Typhimurium=Salmonella Typhimurium, S. Labadi=Salmonella Labadi, S. Molade= Salmonella Molade, S. Inganda=Salmonella Inganda, S. Bargny=Salmonella Bargny, S. Larochelle=Salmonella Larochelle, S. Takoradi=Salmonella Takoradi, S. Tamale=Salmonella Tamale, S. Papuana=Salmonella Papuana, S. Infantis=Salmonella Infantis, TE=Tetracycline, CXM=Cefuroxime, VA=Vancomycin, E=Erythromycin, PB=Polymyxin B, CEC=Cefaclor, S=Streptomycin, STX=Trimethoprim/sulfamethoxazole, P=Penicillin, CL=Cephalexin, RA=Rifampin, DO=Doxycycline, AMC=AX/clavulanic acid, CN=Gentamycin, AZM=Azithromycin, N=Neomycin

Distribution of Salmonella serovars in retail chicken meat samples. Percentages of antimicrobial resistance among Salmonella serovars. E=Erythromycin, AZM=Azithromycin, CL=Cephalexin, CXM=Cefuroxime, CEC=Cefaclor, SXT=Sulfamethoxazole/trimethoprim, DO=Doxycycline, TE=Tetracycline, PB=Polymyxin B, S=Streptomycin, CN=Gentamycin, N=Neomycin, P=Penicillin, AX=Amoxicillin, AMC=AX/clavulanic acid, NOR=Norfloxacin, RA=Rifampin, VA=Vancomycin Virulence genes and antibiotic resistance profiles of Salmonella serovars. S. Kentucky=Salmonella Kentucky, S. Enteritidis=Salmonella Enteritidis, S. Typhimurium=Salmonella Typhimurium, S. Labadi=Salmonella Labadi, S. Molade= Salmonella Molade, S. Inganda=Salmonella Inganda, S. Bargny=Salmonella Bargny, S. Larochelle=Salmonella Larochelle, S. Takoradi=Salmonella Takoradi, S. Tamale=Salmonella Tamale, S. Papuana=Salmonella Papuana, S. Infantis=Salmonella Infantis, TE=Tetracycline, CXM=Cefuroxime, VA=Vancomycin, E=Erythromycin, PB=Polymyxin B, CEC=Cefaclor, S=Streptomycin, STX=Trimethoprim/sulfamethoxazole, P=Penicillin, CL=Cephalexin, RA=Rifampin, DO=Doxycycline, AMC=AX/clavulanic acid, CN=Gentamycin, AZM=Azithromycin, N=Neomycin All Salmonella isolates were screened by uniplex PCR for the identification of virulence-associated genes (invA, stn, sopB, avrA, and pef) and all were positive for at least two of the screened genes. Both invA and stn genes were detected in 100% of the tested isolates, while sopB was harbored by 27 isolates (87.1%) and both avrA and pef were found in 17 isolates (54.8%). Interestingly, S. Enteritidis and S. Kentucky harbored high percentages of the virulence genes (Table-4).

Discussion

S. enterica infections are considered an economically relevant disease in the poultry industry in Egypt and a serious public health potential worldwide. Currently, there are over 2500 recognized Salmonella serovars [19]. In the present study, 15.5% (31/200) of the examined chicken meat samples were Salmonella positive. Similar results were previously reported from Central Ethiopia [20]. The frequency of S. Typhimurium in poultry meat has been reported previously in Egypt from Assiut city markets [21] and from Mansoura city [22]. In the former study, the authors have isolated Salmonella from 44% of the examined raw chicken meat; while in the latter study, the authors have isolated different Salmonella serotypes (including S. Typhimurium, S. Kentucky, S. Molade, and S. Bargny) from processed chicken in a percent of 25.6% (30/120). On the other side, Tarabees et al. [23] isolated S. Enteritidis from 2% (2/100) and S. Typhimurium from 3% (3/100) of chicken meats. In contrast, a higher prevalence of Salmonella contamination was recorded in South Thailand (67.5%) [24] and China (54.0%) [25]. According to a meta-analysis of European Published surveys, the incidence of Salmonella spp. in poultry meat commercialized in Europe is estimated to be 7.10% (95% confidence interval: 4.60-10.8%) [26]. The diversity in the prevalence rates of Salmonella from retail chicken meat could reflect the differences in the level of hygiene followed during chicken handling and processing, the sampling time of the year, the sampling design, as well as diagnostic methods followed. The predominant Salmonella serovars identified in the present study were S. Enteritidis (n=7), S. Kentucky (n=7), and S. Typhimurium (n=6). Similar findings were previously reported in Egypt [22,27]. In the latter study, 77.4% (24/31) of the Salmonella isolates belonged to serogroups C and B, aligning with results previously reported by Abdel-Maksoud et al. [28]. In the current study, seven isolates were serotyped as S. Enteritidis. According to the European Food Safety Authority report, approximately 74% of human zoonotic salmonellosis is caused by S. Enteritidis and S. Typhimurium [29]. It is imperative to discover the most common serotypes in the examined raw chicken meat to determine the point (s) of contamination at different stages during slaughtering, scalding, defeathering, evisceration, processing and handling, particularly in low hygienic poultry retail outlets. The antibacterial susceptibility testing revealed that the identified Salmonella serovars were sensitive to NOR (100%), CN (96.77%), and N (83.87%). Nearly, similar data were previously reported [30], while 83.88% of the obtained Salmonella serovars were resistant to AMC and 96.78% were resistant to E. Several studies have demonstrated that various patterns of antibacterial resistance exist in Salmonella isolates [27,30]. A high rate of MDR was found against most of the commonly used antibiotics. These findings should alert the farm owners to use alternative medications to combat the bacteria instead of using the traditional antibiotics against which bacterial resistance has become common. The current findings are similar to those previously reported in Spain and Turkey [31,32], and MDR Salmonella isolates from poultry origin have been reported worldwide [4,33,34]. The pattern of MDR observed in the present study highlights the drawbacks of the uncontrolled use of antimicrobials, which contributes to increasing the incidence of resistant pathogens among human infections. Hence, a continuous surveillance of antimicrobial resistance of zoonotic bacterial strains such as Salmonella spp. isolated from food and production environments will contribute to a successful control program. The virulence of the obtained Salmonella strains is associated with a series of genes which is responsible for invasion, colonization, and spread within the infected host. The present study demonstrated various virulence genes among Salmonella serovars. For example, the invA and stn genes were harbored by 100% of Salmonella serovars, which are in agreement with Osman et al. [35] and Ahmed et al. [36]. It has been suggested that the invA gene is a specific marker for the molecular detection of Salmonella serotypes, while the stn gene is responsible for enterotoxin production [36]. In the current study, the prevalence of the sopB gene was 87.1%. This gene plays a significant role in the occurrence of diarrhea through activating secretory pathways or facilitating inflammation and altering ion balances within cells [36]. The avrA gene was detected in 54.8% of the obtained isolates. Other reports have indicated that this gene was only observed in serovars that cause severe salmonellosis in humans [37]. The pef gene was also identified in 54.8% of the isolates, highlighting the significance of fimbriae in the infection process. A similar detection rate (68%) was previously reported by Hudson et al. [37]. In contrast, a low frequency (6.7%) of the pef gene in Salmonella isolates was previously detected [36]. Interestingly, none of the examined stool samples yielded positive results, notwithstanding the fact that the risk of contracting the infection from contaminated products cannot be excluded.

Conclusion

Our findings provide evidence for the presence of MDR Salmonella serovars with a wide distribution of virulence genes in chicken meat. These findings raise the suspicion that retail chicken meat often harbors zoonotic Salmonella serovars, representing a potential public health hazard. The possibility of transmission of these MDR serovars to humans requires regular monitoring of the production chain and amended farming practices, with particularly strict regulation of antibiotic usage.

Authors’ Contributions

AA designed the study, conducted the experiments, and revised the manuscript, MG wrote the manuscript and participated in carrying out experiments, and EK and AS shared in performing the experiments and reviewing the manuscript. All authors read and approved the final manuscript for publication.
  26 in total

Review 1.  Antimicrobial resistance: a global multifaceted phenomenon.

Authors:  Francesca Prestinaci; Patrizio Pezzotti; Annalisa Pantosti
Journal:  Pathog Glob Health       Date:  2015-09-07       Impact factor: 2.894

2.  Molecular characterization of Salmonella enterica serotype Enteritidis isolates from humans by antimicrobial resistance, virulence genes, and pulsed-field gel electrophoresis.

Authors:  Ming Zou; Shivaramu Keelara; Siddhartha Thakur
Journal:  Foodborne Pathog Dis       Date:  2012-01-27       Impact factor: 3.171

3.  Genetic relatedness of Salmonella isolates from nondomestic birds in Southeastern United States.

Authors:  C R Hudson; C Quist; M D Lee; K Keyes; S V Dodson; C Morales; S Sanchez; D G White; J J Maurer
Journal:  J Clin Microbiol       Date:  2000-05       Impact factor: 5.948

4.  Prevalence of extended-spectrum b-lactamase-producing Salmonella on retail chicken in six provinces and two national cities in the People's Republic of China.

Authors:  Haiyun Wu; Xiaodong Xia; Yue Cui; Yuanyuan Hu; Meili Xi; Xin Wang; Xianming Shi; Dapeng Wang; Jianghong Meng; Baowei Yang
Journal:  J Food Prot       Date:  2013-12       Impact factor: 2.077

5.  Virulence genotypes of clinical SalmonellaSerovars from broilers in Egypt.

Authors:  Ahmed Mohamed Ammar; Adel Attia Mohamed; Marwa Ibrahim Abd El-Hamid; Mona Mohamed El-Azzouny
Journal:  J Infect Dev Ctries       Date:  2016-04-28       Impact factor: 0.968

6.  Detection of phenotypes, virulence genes and phylotypes of avian pathogenic and human diarrheagenic Escherichia coli in Egypt.

Authors:  Hazem Ramadan; Amal Awad; Ahmed Ateya
Journal:  J Infect Dev Ctries       Date:  2016-06-30       Impact factor: 0.968

Review 7.  Salmonella challenges: prevalence in swine and poultry and potential pathogenicity of such isolates.

Authors:  S L Foley; A M Lynne; R Nayak
Journal:  J Anim Sci       Date:  2007-10-02       Impact factor: 3.159

8.  Virulence gene profiling and pathogenicity characterization of non-typhoidal Salmonella accounted for invasive disease in humans.

Authors:  Jotham Suez; Steffen Porwollik; Amir Dagan; Alex Marzel; Yosef Ilan Schorr; Prerak T Desai; Vered Agmon; Michael McClelland; Galia Rahav; Ohad Gal-Mor
Journal:  PLoS One       Date:  2013-03-07       Impact factor: 3.240

9.  Prevalence, risk factors, and antimicrobial resistance profiles of Salmonella from commercial broiler farms in two important poultry-producing regions of Colombia.

Authors:  P Donado-Godoy; I Gardner; B A Byrne; M Leon; E Perez-Gutierrez; M V Ovalle; M A Tafur; W Miller
Journal:  J Food Prot       Date:  2012-05       Impact factor: 2.077

10.  World Health Organization Estimates of the Relative Contributions of Food to the Burden of Disease Due to Selected Foodborne Hazards: A Structured Expert Elicitation.

Authors:  Tine Hald; Willy Aspinall; Brecht Devleesschauwer; Roger Cooke; Tim Corrigan; Arie H Havelaar; Herman J Gibb; Paul R Torgerson; Martyn D Kirk; Fred J Angulo; Robin J Lake; Niko Speybroeck; Sandra Hoffmann
Journal:  PLoS One       Date:  2016-01-19       Impact factor: 3.240

View more
  1 in total

1.  Silver nanoparticle effect on Salmonella enterica isolated from Northern West Egypt food, poultry, and calves.

Authors:  Helmy Ahmed Torky; Samy Abd-Elsalam Khaliel; Eman Khalifa Sedeek; Rasha Gomaa Tawfik; Ahmad Abo Elmagd Bkheet; Sawsan Khamees Ebied; Heba Said Amin; Samir Ibrahim Zahran; Hadeer Abd-Elhady Emara; Abeer Mohamad Nofal; Eman Moneer Elghazaly
Journal:  Appl Microbiol Biotechnol       Date:  2022-08-10       Impact factor: 5.560

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.