Ismail Sari1, Erkan Gumus2, Ahmet Sevki Taskiran3, Lale Karakoc Sokmensuer4. 1. Department of Medical Biochemistry, Faculty of Medicine, Nigde Omer Halis Demir University, Nigde, Turkey. 2. Department of Histology and Embryology, Faculty of Medicine, Aydın Adnan Menderes University, Aydın, Turkey. 3. Department of Physiology, Faculty of Medicine, Sivas Cumhuriyet University, Sivas, Turkey. 4. Department of Histology and Embryology, Faculty of Medicine, Hacettepe University, Ankara, Turkey.
Abstract
PIWI-interacting RNAs (piRNAs) play an important role in gametogenesis, fertility and embryonic development. The current study investigated the effect of different doses of pregnant mare serum gonadotrophin/human chorionic gonadotrophin (PMSG/hCG) and repeated ovarian stimulation (OS) on the expression of the Mili, Miwi, Mael, Tdrd1, Tdrd9, qnd Mitopld genes, which have crucial roles in the biogenesis and function of piRNAs. Here, we found that after treatment with 7.5 I.U. PMSG/hCG and two repeated rounds of OS, both the mRNA and protein levels of Tdrd9, Tdrd1 and Mael showed the greatest decrease in the ovarian tissue, but the plasma E2 levels showed the strongest increases (p<0.05). However, we found that the Mitopld, Miwi and Mili gene levels were decreased significantly after treatment with 12.5 I.U. PMSG/hCG. Our results suggested that exogenous gonadotropin administration leads to a significant decrease in the expression of the Mili, Miwi, Mael, Tdrd1, Tdrd9 and Mitopld genes, which are critically important in the piRNA pathway, and the changes in the expression levels of Tdrd9, Tdrd1 and Mael may be associated with plasma E2 levels. New comprehensive studies are needed to reduce the potential effects of OS on the piRNA pathway, which silences transposable elements and maintains genome integrity, and to contribute to the safety of OS.
PIWI-interacting RNAs (piRNAs) play an important role in gametogenesis, fertility and embryonic development. The current study investigated the effect of different doses of pregnant mare serum gonadotrophin/human chorionic gonadotrophin (PMSG/hCG) and repeated ovarian stimulation (OS) on the expression of the Mili, Miwi, Mael, Tdrd1, Tdrd9, qnd Mitopld genes, which have crucial roles in the biogenesis and function of piRNAs. Here, we found that after treatment with 7.5 I.U. PMSG/hCG and two repeated rounds of OS, both the mRNA and protein levels of Tdrd9, Tdrd1 and Mael showed the greatest decrease in the ovarian tissue, but the plasma E2 levels showed the strongest increases (p<0.05). However, we found that the Mitopld, Miwi and Mili gene levels were decreased significantly after treatment with 12.5 I.U. PMSG/hCG. Our results suggested that exogenous gonadotropin administration leads to a significant decrease in the expression of the Mili, Miwi, Mael, Tdrd1, Tdrd9 and Mitopld genes, which are critically important in the piRNA pathway, and the changes in the expression levels of Tdrd9, Tdrd1 and Mael may be associated with plasma E2 levels. New comprehensive studies are needed to reduce the potential effects of OS on the piRNA pathway, which silences transposable elements and maintains genome integrity, and to contribute to the safety of OS.
Ovarian stimulation (OS) with exogenous gonadotropin injections has been used for many years as a method for increasing oocytes in animal and humans. Gonadotropins are also used in infertility treatments. Although considerable progress in in vitro fertilization (IVF) has been achieved in recent years, the pregnancy rate per embryo transferred is still low [1]. Many studies comparing natural and stimulated ovarian cycles have indicated some detrimental effects of gonadotropin stimulation, and there may be a relationship between treatment with gonadotropins and a low pregnancy rate. Furthermore, increased chromosomal abnormalities were found in gonadotropin-treated mice and rats, suggesting that genetic factors may be implicated in embryonic mortality [2-4]. Since such potential abnormalities in embryos and offspring are elicited by OS, it is necessary to determine the underlying defects associated with this procedure. Because OS is essential in the treatment of infertility, elucidation of the exact mechanisms responsible for these detrimental effects of OS is urgently needed to increase the success of IVF.In recent years, many studies have shown that small noncoding RNAs (sncRNAs), including microRNAs (miRNAs), small endogenous interfering RNAs (siRNAs), and piwi-interacting RNAs (piRNAs), have crucial roles in reproductive functions [5]. piRNAs have a special function in reproductive biology among these sncRNAs. piRNAs are a novel class of noncoding small single-stranded RNAs abundant in the germline across animal species. Previous studies have demonstrated that piRNAs play crucial roles in gametogenesis, tumorigenesis, epigenetic regulation, germline development, transposon silencing and regulation of gene expression [6]. Host-defense mechanisms against transposable elements are essential to protect genome information. The piRNA pathway, which contains PIWI proteins, piRNAs and proteins that have a role in piRNA biogenesis, can maintain genome integrity by transposon silencing. Thus, piRNAs are also considered “the guardians of the genome”. Furthermore, it has also been shown that piRNAs and PIWI proteins are expressed and function in somatic cells [7, 8].The main effector complex of the piRNA pathway is named the piRNA-inducing silencing complex (RISC), which includes piRNAs and PIWI proteins. In this complex, piRNAs guide PIWI-clade proteins to complementary target RNAs to initiate silencing. The PIWI proteins belong to the argonaute superfamily and have highly conserved PIWI, PAZ, and MID domains. The PAZ domain includes an oligonucleotide-binding fold that interacts with the 3' ends of piRNAs, and the PIWI domain is homologous to RNase H and shows endonuclease activity [9]. Mice have three PIWI-clade argonaute proteins; MIWI (PIWIL1), MILI (PIWIL2) and MIWI2 (PIWIL4) [10]. MIWI and MILI are cytosolic proteins and have piRNA-guided endoribonuclease or slicer activity, while MIWI2 is a nuclear protein and is proposed to recruit the histone or DNA methylation machinery to target genomic loci for transcriptional repression [11].Although the proteins and/or enzymes involved in piRNA biogenesis are different between species, they have been conserved in the animal kingdom, and biogenesis occurs through almost the same mechanisms [12]. In mice, piRNAs are generated in two different ways, called primary and secondary (ping-pong cycle) pathways. The primary pathway may occur in the germline and somatic cells, and in this pathway, “long, single-stranded transcripts” are first generated from small RNA generative loci, piRNA clusters, and exported to the cytoplasmic granules termed “nuages”, where several piRNA pathway components reside (Fig 1A) [10]. There are two different nuage types: the first consists of granules that contain MILI and its binding partner tudor protein 1 (TDRD1). These granules are also known as intramitochondrial cement-like granules or processing bodies (pi-bodies). The second one consists of MIWI2 and its binding partner TDRD9-containing granules, which are piP bodies [13]. TUDOR proteins were reported to have a selective role in correct binding of piRNAs to PIWI proteins [14]. Furthermore, a conserved protein called maelstrom (MAEL) is a nuage component and is essential for primary piRNA biogenesis, transposon silencing, and fertility in both flies and mice. The nucleocytoplasmic shuttling protein MAEL can bind RNA substrates such as transposons or piRNA precursors and deliver them to cytoplasmic nuages [15].
Fig 1
Schematic representation of the role of TDRD9, TDRD1, MAELLE, MITOPLD, MILI and MIWI proteins in the piRNA biogenesis and the effect of the ovarian stimulation on the gene expression.
(A) Schematic illustration of the role of investigated proteins in the primary and secondary (ping-pong cycle) piRNA biogenesis. In the primary pathway, long, single-stranded transcripts (black) produced from piRNA clusters are processed by the endonuclease activity of mitochondrial protein MITOPLD, generating the pre-piRNAs (purple) with uridine at the first nucleotide position (1U) and are loaded onto MILI, a Nuage protein [10, 13, 16]. At these stages, the nucleocytoplasmic shuttling protein MAEL binds piRNA precursors and delivers them to pi-bodies that contain MILI and its binding partner TDRD1 [13, 15]. The 3’ end of pre- piRNAs is trimmed by a nuclease, PNLDC1, and modified by the methyltransferase HEN1 to generate mature primary piRNAs (blue). The mature primary piRNAs guide MILI to slice their complementary target RNAs such as retrotransposons transcripts and these processes cause the production of a series of secondary piRNAs (green) that associate with MILI and also MIWI2 (ping-pong cycle) [13,16]. MIWI2 and its interaction partner TDRD9 are found in piP bodies and don’t have a slicer activity, but the MIWI2–piRNA complexes can regulate gene transcription by epigenetic mechanisms including histone modification and DNA methylation of target genes [12, 13]. (B) Effects of OS on the expression of Tdrd9, Tdrd1, Mael, Mitopld, Mili, and Miwi. 1–2 (↓), 2–4 (↓↓), 4–8 (↓↓↓), and 8–15 (↓↓↓↓) times significantly decrease in the expression levels of studied genes compared to control.
Schematic representation of the role of TDRD9, TDRD1, MAELLE, MITOPLD, MILI and MIWI proteins in the piRNA biogenesis and the effect of the ovarian stimulation on the gene expression.
(A) Schematic illustration of the role of investigated proteins in the primary and secondary (ping-pong cycle) piRNA biogenesis. In the primary pathway, long, single-stranded transcripts (black) produced from piRNA clusters are processed by the endonuclease activity of mitochondrial protein MITOPLD, generating the pre-piRNAs (purple) with uridine at the first nucleotide position (1U) and are loaded onto MILI, a Nuage protein [10, 13, 16]. At these stages, the nucleocytoplasmic shuttling protein MAEL binds piRNA precursors and delivers them to pi-bodies that contain MILI and its binding partner TDRD1 [13, 15]. The 3’ end of pre- piRNAs is trimmed by a nuclease, PNLDC1, and modified by the methyltransferase HEN1 to generate mature primary piRNAs (blue). The mature primary piRNAs guide MILI to slice their complementary target RNAs such as retrotransposons transcripts and these processes cause the production of a series of secondary piRNAs (green) that associate with MILI and also MIWI2 (ping-pong cycle) [13,16]. MIWI2 and its interaction partner TDRD9 are found in piP bodies and don’t have a slicer activity, but the MIWI2–piRNA complexes can regulate gene transcription by epigenetic mechanisms including histone modification and DNA methylation of target genes [12, 13]. (B) Effects of OS on the expression of Tdrd9, Tdrd1, Mael, Mitopld, Mili, and Miwi. 1–2 (↓), 2–4 (↓↓), 4–8 (↓↓↓), and 8–15 (↓↓↓↓) times significantly decrease in the expression levels of studied genes compared to control.It has been suggested that long piRNA precursors created at the initial stage of the primary piRNA pathway are fragmented by the endonuclease activity of the mitochondrial protein PLD6 (MITOPLD), generating the 5' ends of piRNAs (“pre-piRNAs”). Furthermore, PLD6 is involved in the formation of nuages and has phospholipase activity, which hydrolyzes cardiolipin to generate phosphatidic acid and plays a role in the regulation of mitochondrial morphology [16]. The generated “pre-piRNAs” from small RNA generative loci bound to a PIWI protein (MILI), where it matures as a piRNA after the cleavage of the 3' end of pre-piRNAs by a single-stranded-RNA exonuclease (PNLDC1 enzyme) and then 2′-O-Me modification at its 3′-ends by a methyltransferase (Hen1/HENMT1) [13]. The MILI-primary piRNA complexes slice retrotransposon-derived RNAs or target RNAs according to the guide sequence of primary piRNAs and produce both MILI-bound and MIWI2-bound secondary piRNAs (Fig 1A) [16]. These secondary piRNAs are generally derived from retrotransposons, and such repeated piRNA production is named the ping-pong cycle [17]. The ping pong cycle occurs mainly between MILI and MIWI2, where MILI slices the target RNAs via primary piRNAs to guide the generation of piRNAs that bind to MIWI2. Binding of the secondary piRNA to MIWI2 provides the silencing of transposon repeats by direct DNA methylation [12].In summary, the proteins involved in the biogenesis and function of piRNAs are critical for the biogenesis and/or correct functioning of piRNAs [18]. Defects in the function or expression of these proteins can affect the function or production of piRNAs. Consistent with this hypothesis, many studies have revealed that defective expression of the genes in piRNA biogenesis can result in infertility, gametogenic dysfunction and increased accumulation of retrotransposon transcripts [19-21].Some studies have reported that the piRNA pathway is regulated by sex hormones such as estrogen and testosterone [22, 23]. Estrogen was shown to downregulate the expression of Miwi and Mili. Moreover, many studies have demonstrated that exogenous gonadotropin treatment can increase the estradiol (E2) levels [24, 25]. Therefore, OS may have an effect on the piRNA pathway. However, no study has examined the effect of exogenous gonadotropin treatment on the piRNA pathway, which is vital for genome stability. Thus, in the present study, we examined whether different doses of pregnant mare serum gonadotrophin (PMSG)/human chorionic gonadotrophin (hCG) and repeated OS affect the expression of the Mili, Miwi, Mael, Tdrd1, Tdrd9, and Mitopld genes in mouse M2 (metaphase II) oocytes and ovarian tissue. In addition, we investigated the effect of OS on plasma E2 levels and whether there is a relationship between E2 levels and the expression of the genes involved in the piRNA pathway.
Materials and methods
Animals
All experimental protocols were performed according to the guidelines for the ethical procedures of experimental animals and were approved by the local animal ethics committee of Cumhuriyet University, Sivas, Turkey (approval No: 29.12.2015–92). Female BALB/c mice (n = 56) were used for the experimental procedures at the age of 8–10 weeks. The mice were kept under a 12-h light/dark cycle with a temperature of 20–22°C and relative humidity of 50–65% and had free access to standard laboratory food and water.
Study groups and gonadotropin stimulation
Our study was divided into two experimental stages to investigate the effects of both different doses of exogenous gonadotropin (experiment 1) and repeated OS (experiment 2) on the expression of some proteins involved in the PIWI-piRNA pathway. Mice in experiment 1 were injected with 5 (group I), 7.5 (group II), 10 (group III) and 12.5 I.U. (group IV) PMSG (Sigma, St Louis, MO, USA), followed 48 hours later by 5, 7.5, 10, and 12.5 I.U. hCG (Sigma, St Louis, MO, USA) intraperitoneally (i.p.) in each group, respectively [26,27]. Hormones were administered i.p. in 0.1 mL of 0.9% sterile NaCl solution. Controls were injected twice with 0.1 mL sterile serum physiologic isotonic solution. The mice in experiment 2 were injected i.p. with 5 I.U. PMSG and 48 hours later with 5 I.U. hCG, and 2 to 4 rounds (2R, 3R and 4R groups) of stimulations were performed with intervals of 1 week between each. Each group contained seven mice, and daily vaginal smears were taken from the female mice to establish the estrous cycle.
Collection of blood samples, MII oocytes and ovarian tissues
Mice from each group were anesthetized with an i.p. injection of diazepam (5 mg/kg, Stesohid; Dumex, Copenhagen, Denmark) and ketamine (200 mg/kg, Sante Animale, Brussels, Belgium). Blood samples were collected from the left ventricle of the heart in a heparinized syringe. Plasma samples were obtained by centrifuging the blood samples at 3000 rpm for 10 min and then were stored at -80°C until E2 assays by the enzyme linked immunosorbent assay (ELISA) method. After the collection of blood samples, the mice from all the study groups were euthanized by i.p. injection of sodium pentothal (200 mg/kg). MII oocytes (at least 20) were collected from the oviducts of superovulated mice 16 hour after an hCG injection and were placed in RNAlater buffer (Qiagen, Hilden, Germany). Moreover, the ovarian tissues were taken from all the groups in experiments 1 and 2. One ovary from each animal was stored in 10% buffered neutral formalin for immunofluorescence analysis, and the other was stored in RNAlater buffer for quantitative real-time polymerase chain reaction (qPCR) studies. The tissues and oocytes in RNAlater buffer were stored at −80°C before RNA extraction.
Measurement of 17-β-estradiol
The plasma E2 levels were measured with an ELISA kit (17-β-estradiolmice, Elabscience) according to the instructions of the manufacturers.
RNA extraction and cDNA synthesis
Total RNAs were isolated from MII oocytes and ovarian tissues of all the groups by using an RNeasy Plus Micro Kit and RNeasy Mini Kit (Qiagen, Hilden, Germany), respectively, according to the instructions of the manufacturers. The concentration and quality of the RNA samples were determined by using a microplate spectrophotometer (Epoch, Biotek, USA), and then, equivalent quantities of RNA from each sample were reverse-transcribed to cDNA using an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s recommendation.
qPCR for Mili, Miwi, Mael, Tdrd1, Tdrd9 and Mitopld
qPCR was carried out on a Rotor Gene 6000 real-time PCR instrument (Qiagen, Doncaster, Australia) using Luna Universal qPCR Master Mix (New England BioLabs®, Inc.) according to the manufacturer's specifications. For amplification, 2 μl of diluted cDNA was added to each real-time qPCR mixture, containing 10 μl of Luna Universal qPCR Master mix and 1 μM of the target gene-specific forward and reverse primers in a final volume of 20 μl. The primer sequences used in amplification are shown in Table 1. qPCR consisted of 95°C for 1 min to activate the polymerase, followed by 40 cycles at 95°C for 15 s and 60°C for 30 s. MouseGapdh was used as a housekeeping gene control. The specificity of the qPCR products was confirmed by analysis of melting curves. The relative gene expression data were analyzed using the 2- ΔΔCt method. The samples were analyzed in triplicate, and cycle threshold (Ct) values greater than 35 were excluded from the statistical evaluation.
Table 1
List of primers used for qRT-PCR.
Genea
Primer sequence (5′ → 3′)
Mili (Piwil 2)
FW
CAGAAGTGTTTTGAAGCCTTTGATA
RV
TGGTGCTGATTTTCTTCTGAACTAC
Miwi (Piwil 1)
FW
Optimized and specific PCR primers were used (Qiagen QuantiTect primer assays; Cat no: QT00130473)
RV
Mael (Maelstrom)
FW
GAAGCTAAGAGTTGAGAGTCCAGGAT
RV
GATGCTCTCTAGTAAGCGGGTAATTC
Tdrd1
FW
TTGAATCAGTCCTTAGCAGACTACTGT
RV
ACTTGGTAAGATCTCCTTGACTAGAGC
Tdrd9
FW
TCCAGTGTGACTTTAGAAGAACAGAA
RV
ACATATTTGACATCAGGAACTGTGAC
Mitopld (Pld6)
FW
CTAGGCTACATGCACCACAAGTT
RV
ACATACTCGGTGTCCTCCATAATC
Gapdh
FW
Optimized and specific PCR primers were used (Qiagen QuantiTect primer assays; Cat no: PPM02946E)
RV
FW, forward primer; RV, reverse primer
FW, forward primer; RV, reverse primer
Immunofluorescence labeling
MILI, MIWI, MAEL, TDRD1, TDRD9 and MITOPLD proteins in the ovarian tissues were determined using immunofluorescence staining. Ovarian tissues of all the study groups were fixed in 10% buffered neutral formalin for 30–36 hours. After dehydration, clearing and paraffin embedding, the tissues were cut by a microtome into 5-μm thick sections and placed on poly-L-lysine-coated slide glasses. Following deparaffinization in xylene and hydration through a series of graded ethanol, the sections were washed in distilled water. After the sections were heated in 10 mM Tris/ 1 mM EDTA buffer, pH = 9, (anti-TDRD9, anti-TDRD1, and anti-MILI staining) or EDTA buffer, pH = 8, (anti-MAEL, anti-MITOPLD, and anti-MIWI staining) two times for 30 min at maximum power and for 10 min at medium power, respectively, in a domestic microwave oven, they were cooled to RT and rinsed three times in phosphate-buffered saline with Tween-20 (PBS-Tween-20). For inhibition of endogenous peroxidase activity, the sections were treated with 3% hydrogen peroxide in PBS for 30 min at RT and then washed 3 times with PBS-Tween-20. Later, the sections were blocked with blocking solution with 5% normal goat serum, 1% BSA, 0.1% Triton X-100, and 0.05% Tween 20 in PBS for 45 min at RT. After blocking, the sections were incubated overnight at 4 ºC with primary antibodies against mouseTDRD9 (ab118427, Abcam, 20 μg/mL), TDRD1 (739206, Invitrogen, 20 μg/mL), MAEL (sc-398925, Santa Cruz 1/100), MITOPLD (CAC07666, Biomatik, 1/50), MILI (MBS8245645, MyBioSource, 1/100) and MIWI (MBS 8245645, MyBioSource, 1/100). Then, the sections were washed 3 times with PBS-Tween-20 for 5 min each time and incubated with FITC-conjugated anti-rabbit (sc-2012, Santa Cruz) and anti-mouse (sc-2010, Santa Cruz) secondary antibodies (dilution 1:250) for 1 hour at RT. Last, these sections were washed again 3 times with PBS for 5 min each, and then, nuclear staining was performed with 0.5 μg/mL DAPI (4', 6'-diamidino-2-phenylindole dihydrochloride, Fluka, USA) for 10 min at RT and evaluated on a fluorescence microscope (Olympus BX51, Tokyo, Japan). At least three different sections of each sample were analyzed. The tissue sections without the primary antibody served as the negative control for each staining. The sections were visualized and photographed with a fluorescence microscope (BX-51 Olympus, Japan).
Image analysis
Quantification of immunofluorescence staining in the ovary was performed by ImageJ software (National Institute of Mental Health, Bethesda, Maryland, USA). The intensity settings were constant for all sections. The ovarian sections from each animal were evaluated. The relative fluorescence for each protein was quantified as previously described [28-30]. Briefly, after channel separation (RGB) of color images, each protein labeled in the green channel was quantified for the mean pixel intensity. The selected area (region of interest) was measured at least from five randomly selected regions (in square pixels were equal) of each section. Values from all analyses were entered into one-way analysis of variance (ANOVA), followed by pairwise comparisons in Tukey's HSD test.
Statistical analysis
Statistical evaluation was performed using SPSS version 22 (SPSS, Inc., Chicago, IL, USA). The E2 levels were compared between all groups by one-way ANOVA, and paired comparisons were performed with Tukey t tests. The qPCR data were analyzed with the ΔΔCt method, and ANOVA and Student’s t tests were used as appropriate. The relative quantification of the gene expression levels was determined by the ΔΔCt method using the RT2 profiler RT-PCR Array Data Analysis Programme (Qiagen, Inc., Valencia, CA, USA, version 3.5) with Student’s t tests. The statistical significance level was set at p≤0.05.
Results
Plasma 17-β estradiol levels
The comparison of E2 levels measured in all groups in experiments 1 and 2 is shown in Table 2. A significant difference was determined in terms of the E2 levels between the groups in both experiments 1 and 2 (p = 0.0001; p<0.05). Paired comparisons with Tukey's test revealed a significant difference between the control group and groups 1, 2 and 3 in experiment 1 (p = 0.0080, 0.0001 and 0.0050, respectively). There was also a statistically significant difference between group 1 and group 4 (p = 0.045), but no significant differences were found in the paired comparison between the other groups in experiment 1 (p > 0.05). In experiment 2, a significant difference was found between the control and 2R groups (p = 0.0001). However, the difference between the control and 3R and 4R groups (p = 0.078 and 0.957, respectively) was not significant.
Table 2
Plasma E2 levels in the groups in experiments 1 and 2.
Control (n = 7)
Experiment 1
Experiment 2
p
Group1 (n = 7)
Group2 (n = 7)
Group3 (n = 7)
Group4 (n = 7)
2R (n = 7)
3R (n = 7)
4R (n = 7)
E2 (pg/mL;X±S)
92.9±14
134.3±15
147.8±20
135.0±21
115.0±27
160.3±20
119.3±21
98.2±15
0.0001*
Data are expressed as the mean ±standard deviation. E2, 17-β estradiol.
*p<0.05
Data are expressed as the mean ±standard deviation. E2, 17-β estradiol.*p<0.05
The effects of OS on the expression of the Mili, Miwi, Mael, Tdrd1, Tdrd9 and Mitopld genes
The effect of OS on the expression of Mili, Miwi, Mael, Tdrd1, Tdrd9 and Mitopld was examined by qPCR, both in ovarian tissues and MII oocytes. Fig 2 shows the comparison of these genes in the ovarian tissues between the control group and the groups with different doses of exogenous gonadotropin (experiment 1) and repeated OS (experiment 2) in ovarian tissue.
Fig 2
Effects of ovarian stimulation on Tdrd9, Tdrd1, Mael, Mitopld, Mili, and Miwi mRNA levels in ovarian tissue of the study groups.
Fold-Regulation (FR) represents fold-change results in a biologically meaningful way. Fold-change values greater than one indicates a positive- or an up-regulation, and the FR is equal to the fold-change. Fold-change values less than one indicate a negative or down-regulation, and the FR is the negative inverse of the fold-change. *p<0.05.
Effects of ovarian stimulation on Tdrd9, Tdrd1, Mael, Mitopld, Mili, and Miwi mRNA levels in ovarian tissue of the study groups.
Fold-Regulation (FR) represents fold-change results in a biologically meaningful way. Fold-change values greater than one indicates a positive- or an up-regulation, and the FR is equal to the fold-change. Fold-change values less than one indicate a negative or down-regulation, and the FR is the negative inverse of the fold-change. *p<0.05.In experiment 1, the mRNA expression of Tdrd1 was 2.47-, 8.09-, and 5.30-fold and that of Tdrd9 was 2.39-, 3.09-, 2.81-fold lower than that of the controls in groups 1, 2, and 3, respectively. The ovarian Mael mRNA expression of mice in experiment 1 had a 5.55- and 4.75-fold decrease in groups 2 and 3, respectively (p<0.05). However, the decreases in Tdrd1 and Tdrd9 expression in group 4 and in Mael expression in groups 1 and 4 were not significant. In addition, in experiment 1, the highest decrease in the expression of Tdrd1, Tdrd9 and Mael was clearly observed in group 2 (3.09-, 8.09-, and 5.55-fold decreases, respectively). Furthermore, when the expression of Mitopld, Mili and Miwi was evaluated according to the groups in experiment 1, a significant decrease was found only in group 4 (2.44-, 2.80-, and 2.10-fold decreases, respectively).In experiment 2, the Tdrd1, Tdrd9, and Mael mRNA levels were 4.29-, 14.34- and 11.63-fold lower in the 2R group and 4.59-, 3.72-, and 2.91-fold lower in the 3R group than in the control group, respectively. Although the expression levels of these three genes in the 4R group decreased slightly, these changes were not statistically significant. The Tdrd1, Tdrd9 and Mael expression levels showed the strongest decreases in 2R among all the groups in experiment 1 and experiment 2. Moreover, the relative expression levels of the Mili genes decreased significantly only in the 4R group (-1.45-fold). However, no significant differences were found in the expression levels of Mitopld and Miwi between the control group and the groups in experiment 2.Finally, when the expression levels of these 6 genes were examined in MII oocytes, we found they were expressed at relatively low levels compared to those in the ovarian tissue. Exogenous gonadotropin administration further reduced the expression levels that were already low, and the reduction rates were consistent with the gene expression data of the ovarian tissues in terms of the groups (data not shown). However, since the Ct values of these genes in M2 oocytes were generally 30 and above, they could not be statistically evaluated.
Effect of OS on the immunostaining intensity of MILI, MIWI, MAEL, TDRD1, TDRD9 and MITOPLD in the ovarian tissues
The expression of the MILI, MIWI, MAEL, TDRD1, TDRD9 and MITOPLD proteins was investigated in mouse ovarian tissues and visualized by fluorescence microscopy. As shown in Fig 3A–3L, all six proteins were expressed in the interstitial stromal cells, which are distributed in the spaces between follicles, and in the medulla region of the ovary, but no expression was observed in the granulosa cells and oocytes. These proteins were expressed mostly in the theca internal layers of growing preantral and antral follicles (red arrow) and stromal cells (white arrow) surrounding the follicles.
Fig 3
Immunofluorescence analysis of TDRD9, TDRD1, MAEL, MITOPLD, MILI, and MIWI in the ovarian tissue sections of the control group.
Representative immunofluorescence images of TDRD9 (A-B), TDRD1 (C-D), MAEL (E-F), MITOPLD (G-H), MILI (I-J), and MIWI (K-L) (400X magnification). Red arrow, theca interna; Red arrow heads, theca externa; white arrow, stromal cells. MILI, MIWI, MAEL, TDRD1, TDRD9 and MITOPLD stained with FITC. Blue = DAPI nuclear counterstain, green = FITC.
Immunofluorescence analysis of TDRD9, TDRD1, MAEL, MITOPLD, MILI, and MIWI in the ovarian tissue sections of the control group.
Representative immunofluorescence images of TDRD9 (A-B), TDRD1 (C-D), MAEL (E-F), MITOPLD (G-H), MILI (I-J), and MIWI (K-L) (400X magnification). Red arrow, theca interna; Red arrow heads, theca externa; white arrow, stromal cells. MILI, MIWI, MAEL, TDRD1, TDRD9 and MITOPLD stained with FITC. Blue = DAPI nuclear counterstain, green = FITC.ImageJ analysis showed that in experiment 1, there was a significant decrease in the TDRD1 and TDRD 9 protein levels in groups 1, 2, and 3. In experiment 2, TDRD1 expression decreased significantly in the 2R group as did TDRD 9 expression in the 2R and 3R groups compared to the control group (Fig 4A and 4B). Furthermore, the level of MAEL expression in groups 2, 3, and 4 in experiment 1 and group 2R in experiment 2 was significantly lower than that in the control group, but the decrease observed in groups 1, 3R and 4R was not significant (Fig 4C). Similar to the qPCR results, the lowest levels of TDRD1, TDRD 9 and MAEL for experiment 1 and experiment 2 were detected in groups 2 and 2R, respectively. Although there was a reduction in the expression levels of MITOPLD in all experimental groups, only the decrease in group 4 was significant (Fig 4D). There was a mild decrease in MILI expression in groups 4 and 4R compared to the control group, but this change did not reach statistical significance (Fig 4E). Finally, the MIWI expression levels were similar in all groups (Fig 4F).
Fig 4
The intensity of immunoexpression of TDRD9, TDRD1, MAEL, MITOPLD, MILI, and MIWI in the ovarian tissue sections of the study groups.
Comparison of the expression of TDRD9 (A), TDRD1 (B), MAEL (C), MITOPLD (D), MILI (E), and MIWI (F) in the ovarian tissue between the control and the study groups. Data are presented as the mean ± SD. C, Control; G, Group.*p<0.05.
The intensity of immunoexpression of TDRD9, TDRD1, MAEL, MITOPLD, MILI, and MIWI in the ovarian tissue sections of the study groups.
Comparison of the expression of TDRD9 (A), TDRD1 (B), MAEL (C), MITOPLD (D), MILI (E), and MIWI (F) in the ovarian tissue between the control and the study groups. Data are presented as the mean ± SD. C, Control; G, Group.*p<0.05.
Discussion
In this study, the effect of different doses of PMSG and hCG treatment and repeated OS on the expression levels of the Mili, Miwi, Mael, Tdrd1, Tdrd9, and Mitopld genes, which are involved in biogenesis and function of piRNAs were examined for the first time. Furthermore, the effect of controlled OS on the plasma E2 levels and the relationship between the E2 levels and the expression of these genes was also investigated.Several previous studies showed that the stimulation of ovaries with exogenous gonadotropins led to high levels of E2 secretion [25, 31]. Our results demonstrated that although increases were observed in the E2 levels in all groups both in experiment 1 and in experiment 2, the levels increased significantly after treatment with 5, 7.5 and 10 I.U. PMSG/hCG and two repeated rounds of OS. We observed that the highest reduction rate in E2 levels was in groups 2R and 2, respectively, but the difference between groups 1, 2 and 3 was not significant (Table 1).In previous studies, it was found that high levels of E2 decreased the quality of the oocytes and embryos [32, 33] and prevented implantation of the fertilized ovum through negative effects on the endometrium [31]. Given the negative effects of high E2 levels on reproductive biology, exogenous gonadotropin doses, which are widely used in assisted reproductive techniques, should be evaluated and optimized.In our study, when the effects of OS on the expression levels of the genes involved in the piRNA pathway were evaluated by qPCR in ovarian tissues depending on both the dose of exogenous gonadotropin administration and the number of OS cycles performed, we found that the Tdrd1, Tdrd9, and Mael expression levels decreased in all groups. However, the decreases observed in groups 2, 3, 2R, and 3R for all 3 genes were significant (Fig 2). Furthermore, the immunostaining results of these proteins were broadly consistent with the qPCR findings. According to the results of both qPCR and immunofluorescence analysis, the highest decreases in the expression of Tdrd9, Tdrd1, and Mael were found in 7.5 I.U. PMSG/hCG treatment group among the dose-dependent groups and in the 2R group among the repeated OS groups (Figs 2 and 4A-4C and S1–S6 Figs). Moreover, the highest reduction of mRNA and protein expression of these three genes was found in group 2R among all the study groups. In parallel with these results, the observation that the increase in plasma E2 levels was the highest in group 2R, then next highest in group 2 and the lowest in groups 4 and 4R, suggested that the expression levels of these genes may be associated with plasma E2 levels. In a recent study, E2 injection was shown to suppress the transcription levels of Miwi and Mili in the ovary of female Dabry’s sturgeon [34]. Furthermore, Wang et al. demonstrated that hCG and E2 suppressed the expression of Mili in ovarian tissue in vivo and in vitro [23]. In another study, it was found that administration of hCG and luteinizing hormone-releasing hormone reduced Mili and Miwi expression at both the protein and mRNA levels in the ovaries of Odontobutis potamophila [35]. These findings and the data of our study indicated that the expression of the genes involved in the piRNA pathway may be regulated by both estradiol and gonadotropins. These hormones play an important role in germline development and embryogenesis via their impacts on the piRNA pathway, in addition to their known effects on the reproductive system.In some reports, the proteins examined in our study were shown to be expressed at a moderate level in ovarian tissue [35-38]. In our study, as a result of the immunofluorescence analysis of ovarian tissues, we observed that the expression of these proteins was generally low (Figs 3A–3L and 4, S1–S6 Figs). Furthermore, we found that the MILI, MIWI, MAEL, TDRD1, TDRD9, and MITOPLD proteins were expressed in interstitial stromal cells, which are distributed in the spaces between follicles and in the medulla region of the ovary, but no expression was observed in the granulosa cells and oocytes (Fig 3A–3L). According to the two-cell/two-gonadotropin theory, granulosa cells are special cells in which estrogen synthesis takes place [39]. The observation that the proteins examined in our study were not expressed in these cells supports the idea that the expression of these proteins was regulated by E2 levels.In the present study, when changes in the expression of the Mitopld, Mili, and Miwi genes were examined in ovarian tissues, we found that all 3 genes significantly decreased only in the 10 I.U. PMSG/hCG treatment group among the groups treated with different doses of PMSG/hCG, and the immunohistochemical analysis results of these 3 proteins were largely similar to the gene expression data. Furthermore, in the groups receiving repeated injections of PMSG/hCG, only the Mili gene significantly decreased in group 4R. All these findings suggest that the effect of plasma E2 levels on the expression of these proteins may vary from protein to protein in the piRNA pathway or there may be a complex regulatory pattern between these proteins. We found that the expression levels of all the genes we examined were the least affected in the 5 I.U. PMSG/hCG treatment group among the study groups (p>0.05). However, collectively, the administration of exogenous gonadotropin led to substantial changes in the expression of these genes that play a crucial role in piRNA functions and biogenesis (Fig 1A and 1B). piRNAs have strong effects on the occurrence of embryo implantation and they mediate the formation of healthy gametogenesis, especially in terms of genome integrity [5]. In a study, the purpose of which was to analyze the sncRNA expression profile of the spent culture media after fertilization and to investigate the relationship between the sncRNA and morphofunctional properties of gametes and the resulting embryos, it was revealed that some piRNAs have a significant effect on the occurrence of implantation, oocyte-cumulus complex and two pronuclei embryo numbers [40]. In other studies, it has been shown that abnormal conditions that cause defects in piRNA functions can lead to some important negative effects on the reproductive system, such as increased embryonic lethality [41] and infertility [19]. Furthermore, a number of piRNA pathway proteins are essential for the function and biogenesis of piRNAs and retrotransposon silencing [17]. Therefore, potential defects in the functions and/or expression of these proteins can affect the activity or levels of piRNAs, and such situations may cause genome instability, inducing failure in gametogenesis and infertility. Kabayama et al. found that when the expression of Mitopld, Mili, and Miwi was depleted by gene knockout, it resulted in a significant decrease in piRNA levels compared to those of the wild type, accompanied by an increase in retrotransposon transcripts [16]. Sienski et al. demonstrated impaired transposon silencing and female fertility in mutant flies lacking the HBG box domain of the MAEL protein [42]. Furthermore, Castaneda et al. found that the piRNA levels in Mael mutant mice showed an approximately 10-fold reduction [43]. It was reported that loss-of-function mutations in another piRNA pathway protein, MITOPLD, which is involved in the formation of nuages and has endonuclease activity, caused significant defects in piRNA biogenesis and spermatogenesis in mice [36,44]. Based on these results, we concluded that significant reductions in the expression of these genes in our study groups, especially in groups 2 and 2R and groups 4 and 4R, may lead to changes in piRNA biogenesis and the function of piRNAs. Such a situation may lead to some risks for genome integrity and chromosome number stability and consequently may have negative effects on the perfect occurrence of gametogenesis. In many studies, it was reported that in Miwi, Mili, Mitopld, and Tudor mutant and/or knockout mice, there were defects in germ cell formation, some of which cause infertility [14, 45–48]. Therefore, these results are consistent with our last hypothesis.
Conclusions
In conclusion, it was observed that OS performed with exogenous gonadotropins significantly reduced the expression of the Mili, Miwi, Mael, Tdrd1, Tdrd9, and Mitopld genes in some groups. These reduction rates were the highest in the group 2R and then 7.5 I.U. PMSG/hCG treatment group in terms of Tdrd1, Tdrd9 and Mael expression both at the protein and mRNA levels. The fact that the highest increase in plasma E2 levels was found in these groups, and these proteins were not observed in granulosa cells where estrogen synthesis occurs, indicates that changes in the expression levels of these 3 genes may be related to E2 levels. When the effects of proteins involved in biogenesis and functions of piRNA on gametogenesis, embryogenesis and maintenance of genome integrity are considered, exogenous gonadotropin administration may increase the risk of genetic instability depending on the dose and the number of repetitions. Further studies are needed to examine the effects of exogenous gonadotropin administration on this pathway to help prevent the potential detrimental effect of OS, which is also used in IVF, especially on genome integrity and gametogenesis.
Immunolocalization of the TDRD9 protein in the ovarian tissue sections of the control and study groups.
The expression and distribution of TDRD9 (stained with FITC, green) in the control (a), group 1 (b), group 2 (c), group 3 (d), group 4 (e), group 2R (f), group 3R (g), and group 4R (h) were evaluated by immunofluorescence staining (200X magnification). Green = FITC.(TIF)Click here for additional data file.
Immunolocalization of the TDRD1 protein in the ovarian tissue sections of control and study groups.
The expression and distribution of TDRD1 (stained with FITC, green) in the control (a), group 1 (b), group 2 (c), group 3 (d), group 4 (e), group 2R (f), group 3R (g), and group 4R (h) were evaluated by immunofluorescence staining (200X magnification). Green = FITC.(TIF)Click here for additional data file.
Immunolocalization of the MAEL protein in the ovarian tissue sections of the control and study groups.
The expression and distribution of MAEL (stained with FITC, green) in the control (a), group 1 (b), group 2 (c), group 3 (d), group 4 (e), group 2R (f), group 3R (g), and group 4R (h) were evaluated by immunofluorescence staining (200X magnification). Green = FITC.(TIF)Click here for additional data file.
Immunolocalization of the MITOPLD protein in the ovarian tissue sections of the control and study groups.
The expression and distribution of MITOPLD (stained with FITC, green) in the control (a), group 1 (b), group 2 (c), group 3 (d), group 4 (e), group 2R (f), group 3R (g), and group 4R (h) were evaluated by immunofluorescence staining (200X magnification). Green = FITC.(TIF)Click here for additional data file.
Immunolocalization of the MILI protein in the ovarian tissue sections of the control and study groups.
The expression and distribution of MILI (stained with FITC, green) in the control (a), group 1 (b), group 2 (c), group 3 (d), group 4 (e), group 2R (f), group 3R (g), and group 4R (h) were evaluated by immunofluorescence staining (200X magnification). Green = FITC.(TIF)Click here for additional data file.
Immunolocalization of the MIWI protein in the ovarian tissue sections of the control and study groups.
The expression and distribution of MIWI (stained with FITC, green) in the control (a), group 1 (b), group 2 (c), group 3 (d), group 4 (e), group 2R (f), group 3R (g), and group 4R (h) were evaluated by immunofluorescence staining (200X magnification).Green = FITC.(TIF)Click here for additional data file.8 Jan 2020PONE-D-19-34298Effect of ovarian stimulation on the expression of piRNA pathway proteinsPLOS ONEDear Dr. Sari,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Rationale of the work, experimental design, choice of doses need to be explained well. The analyses and significant data obtained are limited to gene and protein expression related to piRNA. Hence author should add additional experiments or discuss more about the relevant publications to co-relate the study results to support the conclusion specifically.We would appreciate receiving your revised manuscript by Feb 22 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Academic EditorPLOS ONEAdditional Editor Comments:Rationale of the work, experimental design, choice of doses need to be explained well. The analyses and significant data obtained are limited to gene and protein expression related to piRNA. Hence author should add additional experiments or discuss more about the relevant publications to co-relate the study results to support the conclusion specifically.Journal Requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website (http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services. If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.Upon resubmission, please provide the following:The name of the colleague or the details of the professional service that edited your manuscriptA copy of your manuscript showing your changes by either highlighting them or using track changes (uploaded as a *supporting information* file)A clean copy of the edited manuscript (uploaded as the new *manuscript* file)3. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: PartlyReviewer #2: NoReviewer #3: PartlyReviewer #4: PartlyReviewer #5: Partly**********2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: I Don't KnowReviewer #3: YesReviewer #4: YesReviewer #5: I Don't Know**********3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #2: YesReviewer #3: NoReviewer #4: YesReviewer #5: No**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: NoReviewer #3: YesReviewer #4: NoReviewer #5: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: The manuscript is about the influence of ovarian stimulation on the genes that are involved in piRNA biogenesis. Though their findings are interesting, manuscript lacks clear and stronger experiments that are required in various parts of the manuscript making the manuscript technically flawed.1. As reproductive cycle and age are correlated, why mice of 8-10 weeks were chosen for the study is not explained anywhere in the manuscript.2. What’s the reason for dose and time period for hCG and PMSG? Dose and intervals might have induced detrimental effects. There is no strong basis or explanation provided from the authors side in this context.3. Why FSH and LH levels , body weights were not measured as a control for ovarian stimulation occurance.4. The exact function of Mili, Miwi, MaeI, Tdrd1, Tdrd9 , Mitopld genes in the piRNA pathway is not very well explained in the manuscript.5. The authors should consider making an illustration or model figure for piRNA pathway and corresponding changes upon ovarian stimulation.6. The authors should present qPCR results in the form of a bar /column chart.7. The manuscript carries typos and grammatical errors at various places which has to be keenly addressed For eg. in abstract line 9 “ remarkable decreases”, Page 2 line 10 “piRANA”, Page 9 , Page 19 “was found that” and reference 6 “ editor” etc. Hence it has to be proof read.8. The images are not very clear, hence a zoomed portion in the tissue section has to be included.9. Image analysis can be well explained separately in the methods.10. It has been said in the conclusion that genome instability occurs on external gonadotrophin administration depending on the dose and the repetition of administration. Did author test on any genome instability that arises out of disrupted piRNA biogenesis (for eg microsatellite) detection like using PCR were done on the tissues ?11. It has been found that piRNA has different roles in cytoplasm and nucleus. The author has to experimentally or theoretically address pathway in which compartment Mili, Miwi, MaeI, Tdrd1, Tdrd9 , Mitopld genes are specifically affected.12. The molecular mechanisms underlying piRNA biogenesis and functions are complex and diverse,the paper must provide more emphasis on step by step piRNA biogenesis and overall biological impact of the study.Reviewer #2: This manuscripts studies effect of PMSG/hCG and ovarian stimulation on the piRNA pathway. Despite the interesting observations, the manuscript lacks detailed reasoning for the design of the experiments. Additionally, the manuscript should be carefully proofread for grammatical errors and typos which are present throughout the manuscript.1. How were dose ranges for PMSG and hCG decided? Would the authors see difference in protein expression levels in other dose concentrations?2. Pictorial summarization/representation of the observed data pathway would help comprehend the data with ease.3. Immunofluorescence data could be better represented by enlarged images.4. Typos and grammatical errors are abundant. For eg. in abstract line 5, “ 7.5 PMSG/hCG” – IU is missing, page 2 line 4, “ embryo and offspring elicited by OS”, page 2 line 15 “transposons, regulation of some gene expression”, page 6 line 21, “investigated in our study examined in MII oocytes”, page 7 line 18 and 20 “ 1.u”, page 7 line 29 “caused to an increase”, page 9 line 19 “ Kabayama et al…..retrotransposon transcripts [36]”- please rephrase this sentence.5. Please pay attention to Author contribution in page 13. Who is J.L?Reviewer #3: In this manuscript, the authors have attempted to investigate the effect of exogenous gonadotropin injections and ovarian stimulation (OS) on the expression of genes/proteins involved in piRNA biogenesis. Given that OS is essential for infertility treatment, it is important to know the exact mechanisms responsible for these detrimental effects of OS in order to increase the success of IVF. The experimental design is logical but the analysis is limited to expression of proteins/genes related to piRNA. Based on the results presented and references cited, the expression of the proteins involved with piRNA may be regulated by both estradiol and gonadotropins. However, the authors have not shown the mechanism of this connection.Below are some experimental suggestions and questions, which when addressed appropriately would make the manuscript commendable for publication.Introduction and methods:1. The phrase ‘piRNA pathway’ is not clearly defined, whether it refers to biogenesis of piRNA or functions hereafter. Also, piRNA and hormones should be elaborated with appropriate references.2. What is the difference between ‘controlled OS’ and ‘OS’? it is not clear what was followed in the experimental setup as the terms are used interchangeably in the manuscript.3. Immunofluorescence labelling in methods is not clear. “After the sections were heated in 10 mM……. phosphate-buffered saline with tween-20 (PBS-Tween-20)” – consider simplifying and rephrasing this sentence.Results:1. It is not clear why the authors compare the results of both the experiments 1 and 2 together only in the immunoexpression studies.2. Table 3 results would be better if represented as a bar graph to highlight the differential expression levels.3. The sentence “Based on this studies and the obtained data from the ……………………………………and these increasing rates were similar in groups 1, 2 and 3” needs clarification. The authors have not explained the relationship between the different hormone injections and their respective effect on receptors. Rather they have just made statements about hormone injections and receptors with cited references. As mentioned by the authors, the relationship between E2, FSH, LH and the receptor regulation of these hormones is complex and requires valid experimental evidence. The authors should include experimental data on the expression levels of these receptors under the current experimental conditions to make a relevant connection.4. What is the quality of the oocyte and embryo developed under the tested experimental conditions. This result along with the data on FSH, LH, E2 hormone/receptor levels will help to connect the dots.5. Why are expression levels of Tdrd 9, Tdrd1, and Mael decreased in 2R but not in 3R and 4R. There seems to be a positive correlation between the rounds of OS and the rescue in expression levels compared to the control. What is the reason for this?6. Fig1 legend is not clear. What is control (a) and control (j), (k)?7. Also in Fig 1, the authors have not commented about the distinct differences in the ovarian tissue sections of control (a), (d) and (e).Minor corrections1. ‘I.U.’ should be consistently presented in upper case throughout the manuscript.2. Gene and protein names should be consistently represented (italized upper case for genes, lower case for proteins).3. Spell check manuscript thoroughly, eg. SatinedReviewer #4: This manuscript investigated the effect of PMSG/hCG induced ovarian stimulation (OS) on the expression of selected Piwi protein genes. Two set of experiments were conducted using either increasing dose of PMSG/hCG or multiple rounds of OS. Number of samples for each treatment group in both experiments were sufficient to allow confidence in the statistical analysis.The authors concluded that exogenous administration of gonadotrophin led to down-regulation of several Piwi protein genes with suggestion that it was associated with plasma E2 level. This conclusion was most probably based on the fact that the three most down-regulated Piwi protein genes were from the groups with highest level of plasma E2 (Table 3). However, other and more Piwi protein genes were significantly down-regulated in Group 4 in Experiment 1 (Table 3) which had no significant difference in plasma E2 level compared to the control (Table 2). Hence, from the result it seems that only expression level for three of the Piwi protein studied were affected by plasma E2 level. The conclusion should be more specific to prevent misleading the readers.To make the figure more reader-friendly I would like to suggest the following:Combine panels i, j and k of Figure 1 to 6 into a single figure showing the localization of the proteins.Move panels a to h of Figure 1 to 6 to supplementary since the fluorescence intensity data is already presented in the form of bar chart in Figure 7.Other minor comments:According to MIQE guidelines (Bustin et al 2009) abbreviation for quantitative PCR should be qPCR to avoid confusion with reverse transcription PCR (RT-PCR).There are some grammatical errors in the manuscript.Reviewer #5: The manuscript titled “Effect of ovarian stimulation on the expression of piRNA pathway proteins” is a preliminary expression analysis of piRNA interacting proteins after PMSG/hCG/OS in muse ovary. Though authors fail to draw correlative conclusions and summary with respect to pi RNA biosynthesis other than relative expression.Specific comments:-There are many grammatical errors and typos throughout the manuscript.-Introduction is much focused on general information on the topics in the manuscript and it needs specific input and more correlation why authors have chosen respective treatments to focus their studies on.-What’s the reason for time variations chosen for OS stimulations?-The fluorescence images of expression are hard to locate, may need counter stain and arrows/ symbols.**********6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: NoReviewer #3: NoReviewer #4: NoReviewer #5: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.2 Mar 2020Response to reviewer and editor comments(PONE-D-19-34298)Dear Editor,First of all, we thank the editor and the reviewers for their thoughtful and supportive comments on our manuscript. We discussed these comments and made some changes on the manuscript according to your recommendations. Our answers to the comments are as follows.Editor CommentsComment 1: Rationale of the work, experimental design, choice of doses need to be explained well. The analyses and significant data obtained are limited to gene and protein expression related to piRNA. Hence author should add additional experiments or discuss more about the relevant publications to co-relate the study results to support the conclusion specifically.Response 1: We reevaluated the discussion section and discussed our results more about the relevant publications according to your recommendations. Thus, a new discussion section was added with new references (marked with red)Comment 2:Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.plosone.org/attachments/PLOSOne_formatting_sample_main_body.pdf and http://www.plosone.org/attachments/PLOSOne_formatting_sample_title_authors_affiliations.pdfResponse 2: We reviewed the manuscript according to PLOS ONE author instructions to meet PLOS ONE’s style requirement.Comment 3:We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service.Response 3: As recommended by the Editor and the reviewers, we submitted our revised manuscript to the American Journal Experts for professional editing (edited for language usage, spelling, and grammar). A certificate provided from American Journal Experts is attached at the end of this file. A copy of our manuscript showing our changes was uploaded as a "supporting information" file, and a clean copy of the edited manuscript was uploaded as the new “manuscript" file.Comment 4:We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data.Response 4: As suggested, phrases that our findings did not concretely support were removed from the manuscript. The removed sentences were in the second paragraph of the discussion section and were marked with grey and “_ “.Review Comments to the Author:Reviewer #1:Comment 1: As reproductive cycle and age are correlated, why mice of 8-10 weeks were chosen for the study is not explained anywhere in the manuscript.Comment 2: What’s the reason for dose and time period for hCG and PMSG? Dose and intervals might have induced detrimental effects. There is no strong basis or explanation provided from the authors side in this context.Response 1 and 2:Superovulation of mice is routinely used to increase the number of obtainable oocytes. Overall, 6-12-weeks old age mice can be used for superovulation procedure. In this study, we wanted to investigate the expression of piRNA pathway protein on mature individuals. Doses of 5.0 to 10.0 international units (IU) of PMSG per mouse are very commonly used for superovulation protocols to in the literature [1-3]. That is why, we preferred low-dose 5.0, medium-dose 7.5, high-dose 10.0, and over-dose 12.5 IU PMSG/hCG groups. Furthermore, superovulation by exogenous gonadotropin is a widely used method to produce in vivo‐derived embryos for embryo transfer in women, and in recent years, it has become an important part of IVF. In IVF treatment or reproductive studies, different OS protocols can be used, for instance, sometimes IVFpatients or experimental animals used in reproductive studies undergo OS using higher doses of exogenous gonadotrophins to obtain multiple oocytes in a single cycle. Moreover, depending on the success of IVF, some women may undergo repeated ovarian stimulation with exogenous gonadotropins. Therefore, we want to examined whether there is an effect of different doses of exogenous gonadotropin and repeated OS on the expression of piRNA pathway genes and formed study groups for this purpose.1. Vaseghi H, Mogheiseh A, Sepehrimanesh M, Kafi M, Nooranizadeh MH. Super pregnancy in a BALB/c mouse superovulated with PMSG. Lab Anim Res. 2017;33(3):280–282. doi:10.5625/lar.2017.33.3.2802. Uysal F, Ozturk S, Akkoyunlu G. Superovulation alters DNA methyltransferase protein expression in mouse oocytes and early embryos. J Assist Reprod Genet. 2018;35(3):503–513. doi:10.1007/s10815-017-1087-z3. Ozturk S, Yaba-Ucar A, Sozen B, Mutlu D, Demir N. Superovulation alters embryonic poly(A)-binding protein (Epab) and poly(A)-binding protein, cytoplasmic 1 (Pabpc1) gene expression in mouse oocytes and early embryos. ReprodFertil Dev. 2016;28(3):375–383. doi:10.1071/RD141064. Combelles, Catherine MH, and David F. Albertini. "Assessment of oocyte quality following repeated gonadotropin stimulation in the mouse." Biology of Reproduction 68.3 (2003): 812-821Comment 3 Why FSH and LH levels, body weights were not measured as a control for ovarian stimulation occurance.Comment 10. It has been said in the conclusion that genome instability occurs on external gonadotrophin administration depending on the dose and the repetition of administration. Did author test on any genome instability that arises out of disrupted piRNA biogenesis (for eg microsatellite) detection like using PCR were done on the tissues?Response 3 and 10We appreciate the reviewer’s comments on the above concern. However, the financial support of this project was limited to conducting relevant experiments only for the purpose of this research. In order to make more detailed investigations, we are currently working on the preparation of a grant proposal that focuses on the piRNA pathway and high-throughput sequencing of piRNAs after the treatment of different doses of exogenous gonadotropin and repeated rounds of OS. While planning this project, your valuable suggestions will be taken into consideration.Comment 4: The exact function of Mili, Miwi, MaeI, Tdrd1, Tdrd9, Mitopld genes in the piRNA pathway is not very well explained in the manuscript.Comment 12. The molecular mechanisms underlying piRNA biogenesis and functions are complex and diverse, the paper must provide more emphasis on step by step piRNA biogenesis and overall biological impact of the study.Response 4 and 12: We agree with the comment and have added 4 paragraphs in the introduction (paragraphs 4, 5, 6 and 7 in the 'Revised Manuscript with Track Changes' file) to better explain the functions of these genes and the piRNA biogenesis. Taking into account the suggestions, the introduction was revised; new sentences have been added and some sentences have been deleted (marked with purple and “_ “).Comment 5: The authors should consider making an illustration or model figure for piRNA pathway and corresponding changes upon ovarian stimulation.Response 5: We appreciate the reviewer’s constructive comments. We believe that this will also contribute to easier understanding of the piRNA biogenesis and the purpose and result of the study. As suggested by the reviewer, we added an overview figure (S7 Fig) for piRNA pathway to the supporting information.Comment 6: The authors should present qPCR results in the form of a bar /column chart.Response 6: As suggested by the reviewer, we presented qPCR results in the form of a bar/column chart (Fig 1).Comment 7: The manuscript carries typos and grammatical errors at various places which has to be keenly addressed For eg. in abstract line 9 “ remarkable decreases”, Page 2 line 10 “piRANA”, Page 9 , Page 19 “was found that” and reference 6 “ editor” etc. Hence it has to be proof read.Response 7: We apologize for the mistakes in line 9, page 2 line 10 and page 19 and reference 6. Typos and grammatical errors in these sections were corrected. Furthermore, as recommended by the Editor and the reviewers, we submitted our revised manuscript to the American Journal Experts for professional editing (edited for language usage, spelling, and grammar).Comment 8. The images are not very clear; hence a zoomed portion in the tissue section has to be included.Response 8: As per reviewer’s advice, high quality figures with 30-600 dpi resolution were produced and incorporated in the manuscript.Comment 9: Image analysis can be well explained separately in the methods.Response 9: Thank you for this advice. As the reviewer stated, we revised Immunofluorescence labeling in the methods and added a subtitle called “Image analysis” with a brief detailing of this analysis.Comment 11: It has been found that piRNA has different roles in cytoplasm and nucleus. The author has to experimentally or theoretically address pathway in which compartment Mili, Miwi, MaeI, Tdrd1, Tdrd9, Mitopld genes are specifically affected?Response 11: In paragraphs 3, 4 and 5, sentences containing information about the cellular compartments or locations of these proteins were added (e.g. miwi and mili are cytosolic proteins- miwi2 is a nuclear protein- mitochondrial protein mitopld- mael is a nucleo-cytoplasmic shuttling protein- tudor proteins are localized in cytoplasmic granules termed “nuages”).Reviewer #2:Comment 1: How were dose ranges for PMSG and hCG decided? Would the authors see difference in protein expression levels in other dose concentrations?Response 1: Superovulation of mice is routinely used to increase the number of obtainable oocytes. Overall, 6-12-weeks old mice can be used for superovulation. In this study, we wanted to investigate the expression of piRNA pathway protein on mature individuals. Doses of 5.0 to 10.0 international units (IU) of PMSG per mouse are very commonly used for superovulation protocols in the literature [1-3]. That is why we preferred low-dose 5.0, medium-dose 7.5, high-dose 10.0, and over-dose 12.5 IU PMSG groups.1. Vaseghi H, Mogheiseh A, Sepehrimanesh M, Kafi M, Nooranizadeh MH. Super pregnancy in a BALB/c mouse superovulated with PMSG. Lab Anim Res. 2017;33(3):280–282. doi:10.5625/lar.2017.33.3.2802. Uysal F, Ozturk S, Akkoyunlu G. Superovulation alters DNA methyltransferase protein expression in mouse oocytes and early embryos. J Assist Reprod Genet. 2018;35(3):503–513. doi:10.1007/s10815-017-1087-z3. Ozturk S, Yaba-Ucar A, Sozen B, Mutlu D, Demir N. Superovulation alters embryonic poly(A)-binding protein (Epab) and poly(A)-binding protein, cytoplasmic 1 (Pabpc1) gene expression in mouse oocytes and early embryos. ReprodFertil Dev. 2016;28(3):375–383. doi:10.1071/RD14106Comment 2: Pictorial summarization/representation of the observed data pathway would help comprehend the data with ease.Response 2: Thank you for this remark. As suggested by the reviewer, we added an overview figure for of the observed data pathway to the supporting information. We believe that this will also contribute to easier understanding of the piRNA biogenesis and the purpose and result of the study.Comment 3. Immunofluorescence data could be better represented by enlarged images.As per the reviewer’s advice, immunofluorescence images were revised, and high quality figures with 30-600 dpi resolution were produced and incorporated in the manuscript.Comment 4. Typos and grammatical errors are abundant. For eg. in abstract line 5, “ 7.5 PMSG/hCG” – IU is missing, page 2 line 4, “ embryo and offspring elicited by OS”, page 2 line 15 “transposons, regulation of some gene expression”, page 6 line 21, “investigated in our study examined in MII oocytes”, page 7 line 18 and 20 “ 1.u”, page 7 line 29 “caused to an increase”, page 9 line 19 “ Kabayama et al…..retrotransposon transcripts [36]”- please rephrase this sentence.Response 4: We sincerely apologize for these mistakes. Typos and grammatical errors in these sections were corrected. Furthermore, as recommended by the Editor and the reviewers, we submitted our revised manuscript to the American Journal Experts for professional editing (edited for language usage, spelling, and grammar).Comment 5: Please pay attention to Author contribution in page 13. Who is J.L?Response 5: We apologize for the mistake in the author contribution section, J.L was deleted from this section.Reviewer #3:Introduction and methods:Comment 1. The phrase ‘piRNA pathway’ is not clearly defined, whether it refers to biogenesis of piRNA or functions hereafter. Also, piRNA and hormones should be elaborated with appropriate references.Response 1: Thank you for this advice. The following sentence, which clearly defines the piRNA pathway, was added to the introduction.“The piRNA pathway, which contains PIWI proteins, piRNAs and proteins that have a role in piRNA biogenesis, can maintain genome integrity by transposon silencing. Furthermore, the references of the manuscript were revised. Some of the references were removed, and a few new references were added.Comment 2. What is the difference between ‘controlled OS’ and ‘OS’? it is not clear what was followed in the experimental setup as the terms are used interchangeably in the manuscript. ?Response 2: We deeply apologize for the confusion. In fact, controlled OS and OS were used with the same meaning. To avoid confusion, only the term“OS” was used throughout the article.Comment 3. Immunofluorescence labelling in methods is not clear. “After the sections were heated in 10 mM……. phosphate-buffered saline with tween-20 (PBS-Tween-20)” – consider simplifying and rephrasing this sentence.Response 3:We agree with the comment and have revised Immunofluorescence labelling section and appropriate sentences. We hope the current form is clearer.Results:Comment 1: It is not clear why the authors compare the results of both the experiments 1 and 2 together only in the immunoexpression studies.Response 1: In qPCR and immunofluorescence analysis, the data obtained from the study groups were compared with the controls. For a brief and understandable presentation, the results of experiment 1 and experiment 2 were given on the same bar graph for each protein or gene.Comment 2: Table 3 results would be better if represented as a bar graph to highlight the differential expression levels.Response 2: Thank you for this advice. As suggested by the reviewer, we presented qPCR results in the form of a bar/column chart (Fig 1)Comment 3: The sentence “Based on this studies and the obtained data from the ……………………………………and these increasing rates were similar in groups 1, 2 and 3” needs clarification. The authors have not explained the relationship between the different hormone injections and their respective effect on receptors. Rather they have just made statements about hormone injections and receptors with cited references. As mentioned by the authors, the relationship between E2, FSH, LH and the receptor regulation of these hormones is complex and requires valid experimental evidence. The authors should include experimental data on the expression levels of these receptors under the current experimental conditions to make a relevant connection.Comment 4: What is the quality of the oocyte and embryo developed under the tested experimental conditions. This result along with the data on FSH, LH, E2 hormone/receptor levels will help to connect the dots.Response 3 and 4: We appreciate the reviewer’s comments on the above concern. Phrases that our findings did not concretely support were removed from the manuscript. The removed sentences were in the second paragraph of the discussion section and were marked with grey and “_ “. We fully agree with the reviewer's opinion about FSH, LH, E2 hormone/receptor. However, the financial support of this project was limited to conducting relevant experiments only for the purpose of this research. In order to make more detailed investigations, we are currently working on the preparation of a grant proposal that focuses on the piRNA pathway and high-throughput sequencing of piRNAs after the treatment of different doses of exogenous gonadotropin and repeated rounds of OS. While planning this project, your valuable suggestions will be taken into consideration.Comment 5: Why are expression levels of Tdrd 9, Tdrd1, and Mael decreased in 2R but not in 3R and 4R. There seems to be a positive correlation between the rounds of OS and the rescue in expression levels compared to the control. What is the reason for this?Response 5: Indeed, there was a significant decrease in the expression levels of these 3 genes in the 3R group. A decrease in the 4 R group was observed, but it did not reach a significant value. The highest reduction rates were observed in the 2R group. Observing parallel decrease rates in E2 levels in the same groups may indicate that the expression of these 3 genes is suppressed with high E2 levels, as we mentioned in the manuscript.Comment 6: Fig1 legend is not clear. What is control (a) and control (j), (k)?Comment 7: Also in Fig 1, the authors have not commented about the distinct differences in the ovarian tissue sections of control (a), (d) and (e).Response 6 and 7: We apologize for the mistakes in Fig1 legends. We revised the figures and figure legends. In addition, high quality figures with 300-600 dpi resolution were produced and incorporated in the manuscript. Furthermore, as a result of image analysis, the immunofluorescence data that reached statistical significance was mentioned in the results and discussion sections.Minor correctionsComment 1 ‘I.U.’ should be consistently presented in upper case throughout the manuscript.Response 1: I.U.was presented in upper case throughout the manuscriptComment 2. Gene and protein names should be consistently represented (italized upper case for genes, lower case for proteins).Response 2: Thanks for your attention and suggestion. As suggested, gene symbols were italicized, all letters were typed in upper case, and protein names were typed in lower case but not italicized.Comment 3: Spell check manuscript thoroughly, eg. SatinedResponse 3: We apologize for this situation.We spell-checked the manuscript and cleaned up the stained areas.Reviewer #4:Comment 1: The authors concluded that exogenous administration of gonadotrophin led to down-regulation of several Piwi protein genes with suggestion that it was associated with plasma E2 level. This conclusion was most probably based on the fact that the three most down-regulated Piwi protein genes were from the groups with highest level of plasma E2 (Table 3). However, other and more Piwi protein genes were significantly down-regulated in Group 4 in Experiment 1 (Table 3) which had no significant difference in plasma E2 level compared to the control (Table 2). Hence, from the result it seems that only expression level for three of the Piwi protein studied were affected by plasma E2 level. The conclusion should be more specific to prevent misleading the readers.Response 1: We intensely appreciate the reviewer’s attention and comment. We fully agree, and we apologize for our sentences that caused misunderstanding on this issue. We revised these sentences in the abstract and conclusion sections as to mean that there could be a relationship only between E2 levels and Tdrd9, Tdrd1 and Mael expression levels.Comment 2.To make the figure more reader-friendly I would like to suggest the following:Combine panels i, j and k of Figure 1 to 6 into a single figure showing the localization of the proteins. Move panels a to h of Figure 1 to 6 to supplementary since the fluorescence intensity data is already presented in the form of bar chart in Figure 7Response 2: Thank you for these constructive comments. As suggested, we revised the figures, and high quality figures with 300-600 dpi resolution were produced and incorporated in the manuscript.Comment 3: According to MIQE guidelines (Bustin et al 2009) abbreviation for quantitative PCR should be qPCR to avoid confusion with reverse transcription PCR (RT-PCR).Response 3: Thanks for your advice. We changed qRT-PCR to qPCR in the whole manuscript.Comment 4. There are some grammatical errors in the manuscript.Response 4: Typos and grammatical errors were corrected. Furthermore, as recommended by the Editor and the reviewers, we submitted our revised manuscript to the American Journal Experts for professional editing (edited for language usage, spelling, and grammar).Reviewer #5:Specific comments:Comment 1-There are many grammatical errors and typos throughout the manuscript.Response 1: Typos and grammatical errors were corrected. Furthermore, as recommended by the Editor and the reviewers, we submitted our revised manuscript to the American Journal Experts for professional editing (edited for language usage, spelling, and grammar).Comment 2-Introduction is much focused on general information on the topics in the manuscript and it needs specific input and more correlation why authors have chosen respective treatments to focus their studies on.Response 2: We appreciate the reviewer's comments on our manuscript. We agree with the comment, and as suggested, we added new sentences and paragraphs in the introduction (paragraphs 4, 5, 6 and 7 in the 'Revised Manuscript with Track Changes' file) to better explain the functions of investigated genes and the aim of this study. Furthermore, superovulation by exogenous gonadotropin is a widely used method to produce in vivo‐derived embryos for embryo transfer in women, and in recent years, it has become an important part of IVF. In IVF treatment or reproductive studies, different OS protocols can be used, for instance, sometimes IVFpatients or experimental animals used in reproductive studies undergo OS using higher doses of exogenous gonadotrophins to obtain multiple oocytes in a single cycle. Moreover, depending on the success of IVF, some women may undergo repeated ovarian stimulation with exogenous gonadotropins. Therefore, we wanted to examine whether there is an effect of different doses of exogenous gonadotropin and repeated OS on the expression of piRNA pathway genes and formed study groups for this purpose.Comment 3-What’s the reason for time variations chosen for OS stimulations?Response 3: In some cases, IVF procedure can be repeated due to failure of implantation or pregnancy. That is why we wanted to mimic the clinic conditions and show the interactions between superovulation and piRNA pathway proteins.Comment 4-The fluorescence images of expression are hard to locate, may need counter stain and arrows/ symbols.Response 4: Thank you for these constructive comments. As suggested, we revised the figures, and high quality figures with 300-600 dpi resolution were produced and incorporated in the manuscript.Submitted filename: Response to Reviewers.docxClick here for additional data file.24 Mar 2020PONE-D-19-34298R1Effect of ovarian stimulation on the expression of piRNA pathway proteinsPLOS ONEDear Dr. Sari,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.The manuscript is way improved, however still few errors are seen and few more points need to be explained in detail. Authors should edit the manuscript for Grammar and Plos style and also address all the comments of reviewers carefully.We would appreciate receiving your revised manuscript by May 08 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Academic EditorPLOS ONEAdditional Editor Comments (if provided):The manuscript is way improved, however still few errors are seen and few more points need to be explained in detail. Authors should edit the manuscript for Grammar and Plos style and also address all the comments of reviewers carefully.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: (No Response)Reviewer #3: (No Response)Reviewer #4: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: PartlyReviewer #3: PartlyReviewer #4: Yes**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #3: YesReviewer #4: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #3: YesReviewer #4: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #3: YesReviewer #4: Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: The manuscript has been changed partially as per the reviewer’s comments however, the manuscript needs come structural change and major corrections to make it more easy for the readers.1. Figure -1 - Why the Error bars are missing ?2. mili, miwi, mael, tdrd1, tdrd9 gene name/ protein names should be written in corresponding Capital or italics3. Figure legends has to be detailed with subdivisions a,b, ... described and legends has to be seperate and Results and Discussion should not merely describe the numerical data. More of scientific impact of the study has to be written4. Less coherent information is important than more incoherent information, Hence kindly make the manuscript as simple as possible.5. S7 has to be incorporated as main figure with complete explanation of the pathway as figure legends6. Authors need to see other plos one papers more carefully for better formatting of the manuscript.7. Tables has to be separate not in the text.8. Still needs grammar improvement - For eg In abstract line 23 - "greatest decreases " decreaseReviewer #3: The authors have addressed all my comments, though not adequately.The response to comment 5 was not satisfactory. The authors have mentioned that expression levels of Tdrd 9, Tdrd1, and Mael were less in 3R and 4R (not as significant) compared to control but 2R showed maximum suppression in expression. This data correlates with E2 levels. But the authors have not given an explanation for the observation of why gene expression is low in 2R than in 3R OR 4R. I am curious to understand if increase in repetitive rounds of OS is better than 2R. It is interesting to find decrease in E2 levels in 3R and 4R compared to 2R, what is the most logical explanation for this?L 258: new abbreviation 'FR' should be mentioned first in L 256Reviewer #4: (No Response)**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #3: NoReviewer #4: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.4 Apr 2020Dear Editor,We thank you and the reviewers for the thorough reading and constructive comments of our manuscript. We are pleased to submit the improved research article, for your consideration in the PLOS ONE. Our response to the editor and reviewer comments is as follows.Editor CommentsComment: The manuscript is way improved, however still few errors are seen and few more points need to be explained in detail. Authors should edit the manuscript for Grammar and Plos style and also address all the comments of reviewers carefully.Response: Thank you for the comment. We carefully reviewed the manuscript again according to PLOS ONE author instructions to meet PLOS ONE’s style requirement. We have resubmitted our revised manuscript to a professional editing firm (Protranslate) for professional grammar editing. The changes are marked in red (blue in pdf file). A certificate provided from Protranslate is attached at the end of this file. A copy of our manuscript showing our changes was uploaded as a "'Revised Manuscript with Track Changes'" file, and a clean copy of the edited manuscript was uploaded as the new “manuscript" file.Review Comments to the Author:Reviewer #1:Comment 1:Figure -1 - Why the Error bars are missing?Response 1: We apologize for this mistake. We have added the error bars in the Fig 2 (updated caption).Comment 2: mili, miwi, mael, tdrd1, tdrd9 gene name/ protein names should be written in corresponding Capital or italicsResponse 2: Thank you for this advice. We updated the gene and protein symbols according to “MGI-Guidelines for Nomenclature of Genes, Genetic Markers, Alleles, & Mutations in Mouse & Rat” (Gene symbols generally are italicized, with only the first letter in uppercase and the remaining letters in lowercase. Protein designations are the same as the gene symbol, but are not italicized and all are upper case).Comment 3: Figure legends has to be detailed with subdivisions a,b, ... described and legends has to be seperate and Results and Discussion should not merely describe the numerical data. More of scientntroduction, results and discussion section.Response 3: We agree with the comment. As suggested, we revised the figure legends and citation of figures in the introduction, results, and discussion sections (Marked with pink).Comment 4: Less coherent information is important than more incoherent information, Hence kindly make the manuscript as simple as possible.Response 4: Thank you for the suggestion. We apologize for our confusing statement. Because some of the statements were confusing and/or redundant, we have removed (marked with green) or revised some of them (marked with yellow).Comment 5: S7 has to be incorporated as main figure with complete explanation of the pathway as figure legends.Response 5: We appreciate your suggestion. As per the reviewer’s advice, we have incorporated Fig S7 as the main figure (Fig 1) with a complete explanation of the pathway as figure legends and revised partially. We hope the current form will be clearer.Comment 6: Authors need to see other plos one papers more carefully for better formatting of the manuscript.Response 6: Thank you for the comment. We have adapted the manuscript according to PLOS ONE's requirements.Comment 7: Tables has to be separate not in the text.Response 7: Thank you for the comment, but according to the submission guidelines, each table has to be placed in the manuscript file directly after the paragraph in which it is first cited. Tables must not be submitted in the separate files.Comment 8: Still needs grammar improvement - For eg In abstract line 23 - "greatest decreases " decreaseResponse 8: We deeply apologize for grammatical errors. Grammatical error in line 23 has been corrected. Furthermore, we have resubmitted our revised manuscript to a professional editing firm (Protranslate) for professional grammar editing. The changes are marked in red (blue in pdf file).. A certificate provided from Protranslate is attached at the end of this file.Reviewer #3:Comment 1: The response to comment 5 was not satisfactory.Response 1: We are sorry for that comment. In order to create a more suitable figure, we have incorporated Fig S7 as the main figure (Fig 1) with a complete explanation of the pathway as figure legends and revised partially. We hope the current form will be clearer.Comment 2: The authors have mentioned that expression levels of Tdrd 9, Tdrd1, and Mael were less in 3R and 4R (not as significant) compared to control but 2R showed maximum suppression in expression. This data correlates with E2 levels. But the authors have not given an explanation for the observation of why gene expression is low in 2R than in 3R OR 4R. I am curious to understand if increase in repetitive rounds of OS is better than 2R. It is interesting to find decrease in E2 levels in 3R and 4R compared to 2R, what is the most logical explanation for this?Response 2: We appreciate the reviewer's comments on the subject above. We agree broadly with your consideration. Indeed, there was a significant decrease in the expression levels of these 3 genes in the 3R group. But as mentioned, the reduction rate in 2R was the highest. This highest reduction rate observed in the expression of Tdrd 9, Tdrd1 and Mael in the 2R group correlated with E2 levels suggests that there may be a complex regulation mechanism between the genes we examined and the other genes involved in piRNA biogenesis or other factors that have the potential to affect the E2 level in the repeated OS process. At first glance, increasing the number of OS cycles appears to have a positive effect on at least these 3 genes. However, to reveal the main effects of OS on this pathway in detail, we think that in different procedures further studies are needed to examine piRNA sequencing, FSH, LH, E2 hormone and receptor levels, and expression and the function of the proteins involved in the piRNA pathway. Furthermore, as we mentioned in the discussion section of our manuscript, all these findings suggest that the effect of plasma E2 levels on the expression of these proteins may vary from protein to protein in the piRNA pathway or there may be a complex regulatory pattern between these proteins.Comment 3: L 258: new abbreviation 'FR' should be mentioned first in L 256Response 3: We apologize for the mistake in line no. 256. We have mentioned abbreviation 'FR' (Fold regulation).Submitted filename: Response to reviewers.docClick here for additional data file.15 Apr 2020PONE-D-19-34298R2Effect of ovarian stimulation on the expression of piRNA pathway proteinsPLOS ONEDear Dr. Sari,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.We would appreciate receiving your revised manuscript by May 30 2020 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsPlease include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Rajakumar Anbazhagan, Ph. D.Academic EditorPLOS ONEAdditional Editor Comments (if provided):Manuscript is acceptable pending minor corrections.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.Reviewer #1: All comments have been addressedReviewer #3: All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: PartlyReviewer #3: Yes**********3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #3: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.Reviewer #1: YesReviewer #3: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #3: (No Response)**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)Reviewer #1: 1-Line number 117- decreasing symbols has to be removed. Punctuation has to be checked.2-MITOPLD, MILI, TDRD..etc protein names has to be consistent through out the manuscript when it comes to deciding uppercase or lower case.3-Figure -1 needs figure legends4-In Figure-1 typo “ Secondery”Reviewer #3: Few suggestions: check the use of articles and punctuation in figure 1 legend. Also cite references for explaining fig1.**********7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #3: No[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.16 Apr 2020Response to reviewer and editor comments(PONE-D-19-34298R2)Dear Editor,First of all, we would like to thank the editor and all of the reviewers for their careful review of the manuscript and professional comments and suggestions for improving our initial manuscript. We are pleased to submit the improved research article, for your consideration in the PLOS ONE. Our response to the reviewer's comments is as follows.Reviewer #1:Comment 1-Line number 117- decreasing symbols has to be removed. Punctuation has to be checked.Response 1-Thank you for this advice. As your advice, line number 117- decreasing symbols has been removed from the manuscript. Punctuation has been checked and some corrections made in the manuscript (marked with red).Comment 2-MITOPLD, MILI, TDRD..etc protein names has to be consistent through out the manuscript when it comes to deciding uppercase or lower case.Response 2- We deeply apologize for our inattention that caused inconsistency about this issue. We carefully reviewed the manuscript again according to MGI-guidelines for the nomenclature of genes and proteins. We made some corrections in the manuscript, and figure 2 according to the MGI-guidelines.Comment 3-Figure -1 needs figure legends.Response 3- Thanks for your suggestion. As suggested, Fig.1 legends have added to the manuscript.Comment 4-In Figure-1 typo “ Secondery”We apologize for this misspelling. We have corrected this word in the Fig.1Reviewer #3: :Comment 1-Few suggestions: check the use of articles and punctuation in figure 1 legend. Also cite references for explaining fig1.Response 1- Thanks for your suggestion. The punctuation in Fig.1 legends and the manuscript were rechecked and corrections were made (marked with red). Furthermore, references have been added for the description of fig 1.Submitted filename: Response to reviewers.docClick here for additional data file.20 Apr 2020Effect of ovarian stimulation on the expression of piRNA pathway proteinsPONE-D-19-34298R3Dear Dr. Sari,We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.With kind regards,Rajakumar Anbazhagan, Ph. D.Academic EditorPLOS ONEAdditional Editor Comments (optional):Reviewers' comments:23 Apr 2020PONE-D-19-34298R3Effect of ovarian stimulation on the expression of piRNA pathway proteinsDear Dr. Sari:I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.For any other questions or concerns, please email plosone@plos.org.Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Rajakumar AnbazhaganAcademic EditorPLOS ONE
Authors: Julio Castañeda; Pavol Genzor; Godfried W van der Heijden; Ali Sarkeshik; John R Yates; Nicholas T Ingolia; Alex Bortvin Journal: EMBO J Date: 2014-07-25 Impact factor: 11.598