Fluoresceinated Aminohexanol Tethered Inositol Hexakisphosphate: Studies on Arabidopsis thaliana and Drosophila melanogaster and Docking with 2P1M Receptor.

Inositol hexakisphosphate (InsP6; phytic acid) is considered as the second messenger and plays a very important role in plants, animals, and human beings. It is the principal storage form of phosphorus in many plant tissues, especially in dry fruits, bran, and seeds. The resulting anion is a colorless species that plays a critical role in nutrition and is believed to cure many diseases. A fluoresceinated aminohexanol tethered inositol hexakisphosphate (III) had been synthesized earlier involving many complicated steps. We describe here a simple two-step synthesis of (III) and its characterization using different techniques such as matrix-assisted laser desorption ionization mass spectrometry, tandem mass spectrometry, and Fourier transform infrared, ultraviolet-visible, ultraviolet-fluorescence, 1H nuclear magnetic resonance (NMR), and two-dimensional NMR spectroscopies. The effect of (III) has been investigated in the model systems, Arabidopsis thaliana and Drosophila melanogaster. Using Schrodinger software, computational studies on the binding of (III) with the protein 2P1M (Auxin-receptor TIR1-adaptor ASK1 complex) has revealed strong binding propensity with this compound. These studies on the fluoresceinated tethered phytic acid could have far reaching implications on its efficacy for human health and treatment of diseases (cancer/tumor and glioblastoma) and for understanding phosphorous recycling in the environment, especially for plant systems.

Introduction

Inositol hexakisphosphate (InsP6; phytic acid) is found in significant amounts in dry fruits, beans, seeds, rice, wheat, and many other edible foods.[1a−1c] It is also referred to as the “second messenger” in cellular systems, though 1,4,5-inositol triphosphate is considered as the “real messenger.” Its potential to cure many diseases based on its powerful antioxidant property has been highlighted.[2] Its efficacy against cancers via inhibition of metastasis, enhancing Nκ cells, increasing tumor suppressor p53 gene activity, and apoptosis has been noted.[3] Now a days, there is increasing discussion about inositol pyrophosphate, InsP7, and its biological application as a modulator of protein functions.[4,5]

InsP6 is popular in alternative therapy and is recommended to be taken on an empty stomach. Branded versions (“Cell Forte” and “Vita Cost”) are commercially available online.[6] The ability of InsP6 to chelate ions, especially iron, has been associated with the treatment of iron-dependent neural degeneration. It has been reported that the viability of cells of glioblastoma, a deadly brain tumor,[7] decreases following treatment with increasing doses of InsP6, and it has also been demonstrated that InsP6 is taken up by tumor cells and causes inhibition of their growth.[8]

These observations substantiate the popular perception in the general public that consuming dry fruits such as almonds,[9] and so forth rich in InsP6 is beneficial against major diseases. The only question on their mind is how much dry fruits should one consume on a daily basis? Excess of anything is bad, and it is clear that consuming excess of InsP6-containing dry fruits could, via chelation, sequester important cations/minerals, which could be detrimental to human health. Inositol cyclic-phosphate has been implicated in diabetes type II.[10] InsP6 is involved in plague through activation of acetyl transferase activity of AvrA-YopJ protein, which deregulates MAPK and NFκB, affecting the innate immune activity.[11]

Studies have been carried out on Arabidopsis thaliana in relation to myo-inositol phosphate synthase 1 gene (MIPS1) in plants.[12] The important role of PP-InsP6 in plant physiology in terms of plant hormones and inorganic phosphate signaling along with its emerging role in bioenergetics homeostatsis have been highlighted.[13,14] Overexpression of phytic acid improves the plant growth under osmotic condition via stimulation of enzymatic and non-enzymatic antioxidant systems and its regulatory role in phosphate homeostasis; phytic acid may be also involved in fine tuning osmotic stress response in plants.[15]

In a recent study, biotinylated inositol hexakisphosphate[16] was used to study DNA double-strand break repair and the involvement of nonhomologous end joining factor. A recent book on the subject links it to agriculture and environment.[17] It is well known that monogastric animals cannot digest phytate (salt of myo-inositol hexakisphosphate), and supplementing phosphate-rich seed diet for pigs and poultry leads to environmental pollution and also caused calamities such as the Chesapeake Bay tragedy in U.S.A and in Gippsland, Australia, the areas often associated with large cattle populations. Supplementing animal diets with microbial phytase is the most successful for controlling such pollution.[18]

Inositol pentakisphosphate 2-kinase 1 (IPK1) is an enzyme which plays a significant role in generating inositol hexakisphosphate.[19] Previously, myo-inositol hexakisphosphate (InsP6)[20] was shown to bind to DNA-PK and stimulate end joining in vitro.[21] InsP6 also stimulates the joining of complementary DNA ends in a cell-free system. Moreover, the binding data suggested that InsP6 bound to DNA-PKcs (not to Ku).[22] Furthermore, the bindings of DNA ends and InsP6 to Ku are independent of each other. Thus, InsP6 could be useful as a marker for in vitro and in vivo plant and animal cell systems.[23]

Synthesis, biochemistry, and therapeutic potential of “inositol phosphate” and its derivatives have been compiled.[24−26] Phytic acid is the hexaphosphoric ester of 1,2,3,4,5,6-hexahydroxy cyclohexane. Because of ring inversion of the cyclohexane ring, it can exist in two different conformations, one having the phosphate group at position-2 axially oriented and the other five-phosphate groups oriented equatorially.[27]

This conformer could coexist with the other conformer [having the five hydroxyl/phosphoric ester groups being oriented axially (ax.) and just one group being equatorially (eq) oriented]. These authors stated that “there is no interconversion between the 1 ax/5 eq and 5 ax/1 eq conformers, except at intermediate pH of 9.0–9.5″.[28]

In the current paper, an attempt has been made to answer the following questions:

Can the title compound (III) be synthesized without any protection/deprotection steps?

How can compound (III) be characterized? Would mass spectrometry (MS) and nuclear magnetic resonance (NMR) [1H NMR, 13C NMR, and two-dimensional (2D)-NMR] be more useful for this purpose?

Can the special reactivity of the axially oriented phosphoric acid at position 2 of the cyclohexane ring in InsP6 be exploited? Can it be selectively esterified with the hydroxyl group of aminohexanol tethered to flourescein? Can it happen for the complete exclusion of all other five equatorially oriented phosphoric acids in InsP6?

Will (III) be internalized by A. thaliana?

Will (III) be taken up by Drosophila melanogaster and would it be involved in the growth and development cycle of the fruit fly through the stages, viz. eggs, larvae, and pupae to the adult fruit fly?

Would (III) “dock” well with the proteins PDB 2P1M and 1PMQ, both of which are relevant to InsP6? Will the Schrodinger docking software tools be useful for this study?

Two decades ago, Prestwich’s group[29−31] carried out a very complicated multistep synthesis and purification[32] of fluoresceinated aminohexanol tethered InsP6 (III). A more recent synthesis of a similar flouresceinated InsP6 with a much smaller side-chain and with a more stable ether linkage, though somewhat shorter, requires the attention of a specially trained and experienced organic chemist. Based on the special high reactivity of the exposed axially oriented phosphate group at position 2 in InsP6, we hypothesized that a very simple synthesis of (III) could be undertaken, which could be handled even by an ordinary laboratory attendant. Such a simple two-step synthesis is described in this paper.

Our compound (III) described in this paper is homogenous as shown by preparative thin-layer chromatography (P-TLC); mass spectral data m/z = 1156.9. The NMR coupling constant (as shown in Table ) for coupling in our case is 9.7 Hz. Further, our experiments have been done in D2O at (pH = 7) and not at alkaline pH. Thus, compound (III) represents the preferred axial conformer without any interconversion to the other conformer.

Table 1

Composition of the Medium for Growth Studies on D. melanogaster

s. no.	components	250 mL	1 L
1	corn flour	20 g	80 g
2	d-glucose	5 g	20 g
3	sugar	10 g	40 g
4	agar	2 g	8 g
5	yeast powder	3.75 g	15 g
6	propionic acid	1 mL	4 mL
7	TEGOa (dissolved in ethanol)	0.3125 g	1.25 (diss in 3 mL ethanol)
8	orthophosphoric acid	150 μL	600 μL

TEGO = trade name for methyl-para-hydroxy benzoate, an antimicrobial preservative in foods.

Results and Discussion

Characterization of (III)

Fluoresceinated amino hexanol tethered inositol hexakisphosphate (III) had been synthesized previously by a complex multistep synthesis. In this paper, we report a simple two-step synthesis of (III) (Scheme ), whose three-dimensional (3D) structure is shown in Figure .

Scheme 1

Synthesis of Compound (III)

Figure 1

(a) 3D structure of (III). (b) P-TLC plate showing band for (III). (c) Fluorescence in a test tube containing a solution of (III) in methanol [seen under an ultraviolet (UV) lamp, 366 nm]. (d) Fluorescence of (III) in a Petri dish under ordinary visible light.

Earlier Mass Spectral Studies on Phytic Acid

The mass spectrum of phytic acid shows the molecular ion peak at m/z 658.823. In its “tandem” MS/MS spectrum it successively loses meta phosphoric acid (98 amu) and loss of (80 amu) observed at m/z (460.90) for loss of meta phosphoric acid (loc. cit.). Electrospray ionization (ESI)-MS and MS/MS of phytic acid show the [M–2H]2– ion, and this has been used to confirm the fragmentation pattern of phytic acid. It was concluded that ESI-high-resolution mass spectrometry of inositol phosphates is unusual and highly “characteristic” and can be used for “the detection of the compound in environmental matrices” and “soils and manures.”[33] The authors also state that these studies are “complicated by the potentially labile elimination of meta phosphoric acid” HPO3. Despite the mass spectra of InsP6 being complicated, these could be used for “the exploration of organic phosphorous cycling in the environment.”

MALDI-MS and MS/MS of Compound (III)

Matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS) studies of compound (III), purified by P-TLC, was done using methanol solution and is shown in Figure .

Figure 2

MALDI-MS spectrum of (III).

In this mass spectrum, the peak of m/z 1156.9 is observed for compound III (C33H41NO30P6 + potassium, K), and the calculated value is 1156.1122 so that the mass error percent is 0.78, which shows the successful conjugation between fluorescein and phytic acid using the linker molecule aminohexanol. Underivatized phytic acid shows M+ at m/z 658.823, the base peak, and in the MS/MS spectrum of the m/z 658.823 peak, a loss of phosphate meta phosphoric acid (98 amu) is observed at 560.92. This is followed by another loss (80 amu) observed at m/z 460.90 for loss of HPO3 (loc. cit). MS/MS spectrum of the peak m/z 1082.1783 results in a calculated value of 1081.9057 for C33H37NO28P6 m/z (error percent is 0.02%), 1066.2053 gives calculated for C33H39NO28P6 m/z value 1065.9108 + 1H equal to 1066.9186 (error percent is 0.06%), and 1051.8262 gives calculated for C33H38NO28P5 m/z value 1051.9492 (error percent is 0.01%). M+ peak 1117.9363 for calculated peak C33H41NO30P6 – 2 × H2O showed the most intense peak at m/z 893.0007 (loss of P3O6 unit m/z 188.8908 amu error percent is 0.0007%). MS/MS spectra of the m/z 1066.2053 and 1051.8262 peaks are all shown in (Figure S1).

Ultraviolet–Visible Studies on (III)

UV–visible (UV–vis) spectrum of (III) showed peaks at 427.59 and 482.01 nm (Figure a). Its fluorescence spectrum shows a large shift toward higher wavelengths (Figure b).

Figure 3

(a) UV–vis spectrum of compound (III). (b) Fluorescence spectrum of (III).

Fourier Transform Infrared Studies on Compound (III)

Fourier transform infrared (FT-IR) spectrum of (III) recorded in methanol at room temperature is shown in Figure S2. The FT-IR spectral analysis showed peaks at 1072.75, 1109.56, 1421.25, 1442.36, 1697.43 2890.78, 2905.16, 2945.71, and 3340.64 cm–1.

Earlier NMR Studies on Phytic Acid

Experimental data based on earlier NMR studies of phytic acid (loc. cit) have shown that “for 1 ax/5 eq conformation, J1,2 = J2,3 = 2.0 ± 0.2 Hz, expt. (1.7 Hz, predicted); J3,4 = J1,6 = 9.6 ± 0.2 Hz expt. (9.6 Hz predicted). For the 5 ax/1 +eq conformation (Figure ), J1,2 = J2,3 = 2.2 ± 0.2 Hz, expt. (2.4 Hz predicted); J4,5 = 1.7 ± 0.2 Hz expt. (0.7 Hz predicted).

Figure 4

COSY spectrum of (III) showing correlation of aromatic protons at δ 8.566 and 8.676 with CH2–NH peaks at δ 3.338 and 3.374 ppm.

1H NMR Spectral Studies on Compound (III)

1H NMR of compound (III) was recorded in D2O (and CD3OD), and the expanded spectra of aliphatic and aromatic regions are shown in (Figures S3–S5). The 1H NMR spectrum of (III) can be divided into three distinct regions; the aliphatic CH2 region, the cyclohexane hydrogen region, and the aromatic region of the fluorescein moiety. The four aliphatic methylene groups are observed at δ 1.35 and 1.67 ppm.

The other two methylene groups are observed at δ 4.23 (b, 2H, −CH2–O– unit; Figure ) and δ 3.338–3.374 [t, 2H, CH2–NH unit; based on the correlation in the correlation spectroscopy (COSY) spectrum]. Figures and 5 show the correlation of aromatic protons at δ 8.566 and 8.676 with CH2–NH peaks at δ 3.338 and 3.374 ppm.

Figure 8

(a) A. thaliana seedlings were grown with fluorescein or fluoresceinated InsP6 containing nutrient media. (b) Chlorophyll content was measured on fluorescein- and fluoresceinated InsP6-treated seedlings. * represents the statistical significant difference (P < 0.0001) in the expression level between treated and untreated samples.

Figure 5

Expanded signals in the COSY spectrum of (III) at δ 3.338 and 3.374 correlating with signals at δ 8.566 and 8.676 ppm.

The cyclohexane ring protons are observed at δ 3.422 (s, 1H, 2-H) and 3.338 to 3.378 (5H, H-1, H-3, H-4, H-5, H-6). The nine aromatic protons of the fluorescein ring are observed at δ value 6.787 (1H, d, J = 10 Hz, H-7″), 6.874 (1H, s, H-9″), 7.220 (d, J = 10 Hz, H-6″), 7.427 (d, J = 8.4 Hz, H-5″), 7.609 (s, H-2″), 7.977 (dt, J = 6 Hz, H-6″), 8.239 (bs, H-2′), 8.566 (t, J = 5.6 Hz, H-5′), and 8.676 (t, J = 5.6 Hz, H-4′).

Total correlation spectroscopy (TOCSY) spectrum of (III) shows correlation of the δ 4.23 ppm signal of the CH–O hydrogens with the protons of the cyclohexane ring, as shown in (Figure S6).

2D-NMR COSY spectrum of (III) in the fluorescein unit; the region δ 6.4 to 8.8 is shown in Figure . On this basis, assignments have been made which are discussed below.

Figure 6

Double quantum filtered-COSY spectrum of (III).

It is seen that the signals at δ 6.787 and 7.220 are correlated and hence coupled to each other, showing that they are ortho-placed with respect to each other and thus assigned to H-7′ and H-6′, respectively. Similarly, the two signals at δ 7.427 and 7.977 are correlated and hence coupled to each other, showing that they are also ortho-placed with respect to each other and thus assigned to H-4′ and H-5′, respectively. It can also be seen that the two signals at δ 8.566 and 8.676 are correlated and hence coupled to each other, showing that they are ortho-placed with respect to each other and thus assigned to H-5′ and H-4′, respectively. The three signals at δ 6.874, 7.609, and 8.239 are observed as singlets and thus assigned to H-9″, H-2″, and H-2′, respectively. Our NMR data are compared with values from the literature in the Supporting Information (Table S1).

Thus, P-TLC shows that compound (III) is homogenous; the mass spectral data, other spectroscopic data (FT-IR, UV–vis, and UV fluorescence), and more particularly the NMR/2D NMR data confirm the structure of (III).

Our NMR spectral studies have been done in neutral pH and not alkaline pH, and as quoted earlier, no cyclohexane ring inversion is expected to be observed. The coupling constants and more particularly the value of J1,6 of 7 Hz (lit. value of J = 9.6 Hz) clearly establish the structure of (III) unequivocally.

Studies on the Model Plant A. thaliana Using (III)

Compound (III) is Internalized by Root and Leaf Cell of A. thaliana Seedlings

Recently, internalization of InsP6 by H1299 has been demonstrated.[34a,34b] InsP6 is a highly charged molecule and therefore cannot freely pass the cell membrane because neither plants nor animals have a plasma membrane transporter for InsP6. The authors demonstrated that extracellular InsP6 enters the cell by a micro-endocitosis like mechanism. Once inside the lysosome (by fusion of the endocitic vesicle), InsP6 could be dephosphorylated by a specific phosphatase MINPP1 to myo-inositol, which can then be transported inside the cell cytosol. Synthesis of membrane permeable diphosphate-containing inositol polyphosphate or inositol pyrophosphates and their cellular uptake has already been reported. To check whether compound (III) would be similarly taken up by A. thaliana, its seeds were grown with compound (III) for 7 days. As the control, seeds were also grown with fluorescein. Uptake of fluoresceinated InsP6 or fluorescein was analyzed using a Zeiss SP5 confocal microscope. The characteristics of the channel used were as follows: argon laser; excitation is at 490 nm; detector gain 320. Cellular uptake by a cell is defined by the detection of the fluorescence signal in root and leaf mesenchymal cells. Fluorescence signal was not detected from fluorescein-treated seedlings (Figure S), but seedlings treated with compound (III) show a clear accumulation of fluoresceinated InsP6 (Figure a,b).

Figure 7

Uptake of fluoresceinated InsP6 through the root system (a) and leaf cell of A. thaliana seedlings (b). Shown are the fluorescence and bright-field representative images at 400-fold magnification. The scale bar is 50 μm.

Chlorophyll Content of A. thaliana Seedlings Were Induced under Fluoresceinated InsP6 Containing Media

Extensive role of inositol triphosphate (InsP3) on chloroplast development has been reported earlier.[35] To find out, whether fluoresceinated InsP6 plays any such role, we analyzed A. thaliana seedlings grown under either fluoresceinated InsP6 or fluorescein. Interestingly we could see that seedlings grown with fluoresceinated InsP6 are more greenish and contain a significant increase in the amount of chlorophyll compared to seedlings with fluorescein alone (Figure ). Considering that seedling development requires inositol hexakisphosphate,[36] our observations suggest the stimulating role of fluoresceinated InsP6 on chlorophyll synthesis.

Expression of ICS1-transcripts in the seedling assay is shown in Figure .

Figure 9

Expression of ICS1-transcripts. Whole seedlings of each treatment were collected for total RNA extraction followed by qRT-PCR analysis (n = 3). * represents the statistical significant difference (P < 0.0001) in the expression level between treated and untreated samples.

Salicylic Acid Biosynthesis Gene ICS1 (Isochorismate Syhthase 1) Expression is Upregulated with Fluoresceinated InsP6

Inducing defense responses upon phosphate supplementation was shown earlier.[37] The rice phosphate transporter protein OsPT8 regulates disease resistance and plant growth.[38] We discovered that the transcript level of ICS1 is upregulated in seedlings grown with fluoresceinated InsP6 compared to fluorescein control (Figure ). Indeed, ICS1 was found to be involved in disease resistance in A. thaliana and other plants. Salicylic acid (SA) is a potent immune signaling molecule.[39] These results suggest that fluoresceinated InsP6 helps in inducing defense responses in A. thaliana.

Figure 14

(a) Pupae in normal media. (b) Pupae in normal media with fluoresceinated compound.

Defense Signaling Regulator EDS1 (Enhanced Disease Susceptibility 1) Transcripts Are Upregulated by Fluoresceinated InsP6

Recent understanding of plant immune signaling pathways genetically place SA and enhanced disease susceptibility 1 (EDS1) downstream of resistant protein activation.[40] Previously, our assays demonstrated upregulated ICS1 upon fluoresceinated InsP6 treatment. To determine if EDS1 played a role in the same context, we checked the EDS1 protein levels upon each treatment.[41] We identified significant accumulation of EDS1 protein in fluoresceinated InsP6-treated seedlings compared to fluorescein controls (Figure ). Taken together, these results suggest that, indeed, fluoresceinated InsP6 augments defense responses in A. thaliana.

Figure 10

Level of EDS1 protein detected through immunoblot of fluoresceinated InsP6 and fluorescein-treated seedlings. Ponceau S of Rubisco indicates comparable loading controls.

Studies on the Model System Adult D. melanogaster Using (III)

Feeding response of D. melanogaster on new fluoresceinated aminohexanol tethered inositol hexakis phosphate (III) and its effect on ingestion.

To study the effect of this new fluoresceinated aminohexanol tethered inositol hexakisphosphate on fruit flies, adult D. melanogaster were fed on this compound. Fluorescence was observed in the abdominal region of flies that ingested the compound. The flies which did not ingest the compound did not show fluorescence in any region. As most of the flies ingested the compound, it shows that the flies can easily feed on it and ingest it and might have a taste for it as shown in Figure . Flies feeding on the compound in the presence of 100 mM sucrose compared to just the fluoresceinated aminohexanol tethered inositol hexakis phosphate feeding alone concentration is shown in Figure . Since not much difference is seen in the intensity and feeding behavior between 0.25 and 0.5 mg/mL concentration, we later used 0.25 mg/mL concentration only for all assays.

Figure 11

(a) Flies fed on 0.5 mg/mL fluoresceinated InsIP6 without 100 mM sucrose. (b) Flies fed on 0.5 mg/mL InsIP6 with 100 mM sucrose. (c) Flies fed on 0.25 mg/mL InsP6. (d) Flies fed on 0.25 mg/mL InsIP6 with 100 mM sucrose. (e) Flies did not feed on InsP6.

The graphical representation of the feeding preferences of adult D. melanogaster on different concentrations of fluoresceinated aminohexanol tethered inositol hexakis phosphate tested is shown in Figure at different concentrations.

Figure 12

Percentage of flies that fed on fluoresceinated-tethered compound (III).

Significance of the flies feeding preference is more toward lower concentration of 0.25–0.5 mg/mL of the compound. A small percentage of the flies did not feed on the compound at any concentration. The T test values of 0.5 and 0.25 clearly show that there is a difference in the absence of sucrose.

Effect of (III) on the Drosophila Larval Feeding

The larvae of D. melanogaster also showed a feeding preference on the fluoresceinated aminohexanol tethered inositol hexakis phosphate (F) mixed with agar (A). The fluorescence intensity in larvae after ingestion of fluoresceinated aminohexanol tethered inositol hexakis phosphate (F) mixed with 1% agar compared to the compound mixed with agar (A) and sucrose (S) were more or less similar, indicating that larvae feeding on the fluoresceinated aminohexanol tethered inositol hexakis phosphate (F) can feed on the compound even in the absence of sucrose (Figure a–c).

Figure 13

(a) Larvae obtained from fluoresceinated aminohexanol tethered inositol hexakisphosphate (F) and agar (A). (b) Larvae obtained from agar (A) containing both sucrose (S) and fluoresceinated aminohexanol tethered inositol hexakisphosphate compound (F). (c) Graphical representation of the larvae on fluorescein + sucrose compared with fluorescein + sucrose + agar.

Larval molting was also not affected in general in the presence of fluoresceinated aminohexanol tethered inositol hexakis phosphate as seen on 1% agar media with and without sucrose.

In the ″larval feeding assay” on the basis of T test analysis, we observe that high feeding is observed in the absence of sucrose.

Effect of Compound (III) on the Development of D. melanogaster

The effect of fluoresceinated aminohexanol tethered inositol hexakisphosphate in nutrient media (nutrient media 1 and nutrient media 2) and without the florescent label (F + nutrient media 1 and F + nutrient media 2) was studied. No differences in the development of larvae or pupae are found in the presence or absence of the compound.

We also collected and counted eggs on 1% agar with and without the compound, as shown in Figure S7. We have observed that in the presence of the fluoresceinated compound, egg laying has increased.

Effect of Compound (III) on the Pupae of D. melanogaster

The fluorescence was absent in pupae from normal media when compared to pupae with normal media mixed with fluoresceinated aminohexanol tethered inositol hexakisphosphate (F). These results indicate that the compound does not degrade and stays even in the pupal stages (Figure a,b).

Thus, the above-mentioned result confirms the interaction and retention of compound (III) in pupae and the positive response of the life cycle of the flies.

Effect of Compound (III) on the Development of Flies of D. melanogaster

During our experiments, we observed that flies can easily lay eggs in the presence of fluoresceinated aminohexanol tethered inositol hexakis phosphate and larvae can easily feed on it. We also observed fluorescence in the pupae and then later in the adult flies. Compared to fluoresceinated aminohexanol tethered inositol hexakis phosphate (F) mixed with normal media, only minimal background fluorescence was observed in normal media flies.

Later, we counted the number of pupae that eclosed as adult flies, as shown in the graphical representation of the number of pupae, and the number of pupae that did not evolve as flies (Figure a–e). Our data suggest that fluoresceinated aminohexanol tethered inositol hexakis phosphate has a significant effect on the pupal development and eclosion.

Figure 15

(a) Flies in normal media. (b,c) Flies in normal media with 0.25% fluorescent compound. (d) Number of flies developed from pupae shown in duplicate on normal media condition (NM) with and without the fluoresceinated compound. (e) Graphical representation of the number of pupae that did not evolve as flies.

Thus, in vivo and significance effect were captured by the different microscopic techniques and different concentrations and at different stages such as eggs, larvae, pupae, and at the adult state. This also shows that the interaction with compound (III) provides better effect on the flies and the enhancement of their life cycle.

In the future work, we plan to confirm these claims by coupling with biochemical confirmation, for example, by MS analyses with root extracts treated with the InsP6-fluorescent conjugate or by analyzing the control and treated extracts by polyacrylamide gel electrophoresis (PAGE) coupled with TiO2 enrichment.[42] A green chemistry method for carrying out the CuO nanoparticle-catalyzed click reaction with very high yields has been described.[43] Similar experiments could also be taken up using D. melanogaster. InsP6 is a direct precursor for inositol pyrophosphates, such as InsP7. These pyrophosphates are fundamental to a large number of biological processes.[44,45] Therefore, in the future work, it would be interesting to see whether the IP6-conjugate can be used as a substrate by InsP6K-type proteins to generate fluoresceinated-IP7.

D. melanogaster is a widely used model organism for research purposes. It only has four chromosomes which makes the study easier.

Its life cycle is of around 10–12 days. Differentiating male fruit flies from female flies is easy. Because of their small size, Drosophila can easily be stored in a laboratory. The food, present in the abdominal area, can be detected by viewing under a microscope.

All above-mentioned studies indicate that after feeding of the phytic acid derivative, the fluorescence can be easily assessed in the gut. May be fluoresceinated aminohexanol tethered inositol hexakis phosphate (III) has the potential to be used as a tag for studies to mark the neurons or for looking at the effect of various compounds that are hazardous for human health.

Docking of (III) with the PM1K Receptor Using the Schrodinger Software Suite

Bioinformatics studies on (III) has been performed using the Schrodinger software suite. In these studies, the docking cavity and its corresponding energy were taken into account. The study involved the Auxin receptor TIR1 in a complex with the adaptor ASK1 (PDB code 2P1M). Three different protein crystal structures 2P1M, 1N4K, and 4ZAI were taken for molecular docking studies. First, axial and equatorial ligands were docked to the 2P1M protein. For the axial conformer, the docking energy is −5.01 kcal/mol, and for the equatorial conformer, the docking energy is −7.24 kcal/mol. The binding site residues for axial and equatorial are mostly common though their binding orientation is different. The common amino acid residues at the binding site are R111, S138, K113, R114, R164, R344, R403, R401, R436, R435, K485, R484, K74, E72, F49, K47, K25, D24, and L23. In the case of the axial conformer, some residues are distinct E109, R509, V48, V71, and S70. Because of different orientations of the axial and equatorial conformers, the equatorial mode of the ligand is shown apart from many common residues such as W320, R318, E165, E342, L378, S37, H78, G51, R560, R509, M460, and E459 and other set of residues as well. Hydrogen bond, van der Waal, and pi–pi interactions are responsible for the high binding affinity. The residues involved in hydrogen bonding are R436, R114, K113, K485, R484, and R509, whereas for the equatorial conformer, the residues are K113, R344, R403, R401, R436, R435, K485, K74, E72, K25, and E459, and pi–pi stacking is observed with F49 shown in Figure S8. From the residue-wise analysis, the docking data shows that the binding of the equatorial conformer is much better than that of the axial conformer. The binding site derived from docking studies using Schrodinger software is shown in Figure , which confirms that fluoresceinated aminohexanol tethered inositol hexakis phosphate (III) binds well to protein 2P1M.

Figure 16

Binding site obtained from docking studies using Schrodinger software suite using 2P1M protein and (III).

Conclusions

Fluoresceinated aminohexanol tethered inositol hexakisphosphate compound (III) has been prepared by a facile and convenient two-step synthesis unlike previous synthetic methods, which involved multistep synthesis and many protection/deprotection steps. This beautiful, green fluorescent compound has been characterized by modern spectroscopic techniques (FT-IR, UV–vis, and NMR studies). 2D NMR spectral studies have been used to make assignments for individual hydrogen atoms in the molecule. Its mass spectrum (M+, m/z = 1156.9) helped nail the molecule. In the UV–fluorescence spectrum (λmax 457.28–487.01 nm), a bathochromic shift of 29.93 nm was observed.

We detected internalization of fluoresceinated aminohexanol tethered inositol hexakisphosphate compound (III) into the root and leaf cellular systems and its subsequent enhancement of the chlorophyll content in whole seedlings. Therefore, compound (III) has been successfully demonstrated by us as a growth enhancer on the model plant A. thaliana. The effect of compound (III) was then tested on D. melanogaster. The insect ingested the compound, and fluorescence was carried over to the eggs, larvae, and pupae, showing that it survives these stages in the fly’s development cycle. The data generated in this paper could be useful for studying the role of InsP6 in intact cells. InsP6 is a direct precursor for inositol pyrophosphates, such as InsP7. These pyrophosphates are fundamental to a large number of biological processes. The importance of InsP6 in environmental studies, soils, and phosphorous recycling is also foreseen.

Experimental Section

Materials and Methods

Synthesis of (III)

N-Hydroxysuccinimidyl fluorescein (40 mg, 0.931 mmol) and 1-amino-6-hexanol (10 mg, 0.854 mmol) were taken in a flask with 20 mL of dichloromethane. For increasing the solubility, 10–15 drops of methanol was also added into the vessel, and the solution was stirred using a magnetic needle on a magnetic stirrer overnight at room temperature.

After overnight stirring, the solvent was evaporated using a Heidolph rota—evaporator. Phytic acid (56 mg, 0848 mmol) along with dicyclohexyl carbodiimide (DCC) (16 mg, 0.776 mmol) were then added followed by dichloromethane (50 mL) and again stirred overnight at room temperature using a magnetic needle.

Any solid (DCC urea) obtained at this stage was filtered away; the solvent was removed by evaporation, when a yellowish orange colored solid was obtained, which was dried over anhydrous phosphorous pentoxide in a vacuum desiccator overnight. The yield was 72 mg (Scheme ). Mass spectrum of (III) showed the molecular ion peak, M+ at m/z 1156.9, which represents its molecular weight.

Experimental Methods for Studies on A. thaliana Using (III)

Plant growth conditions: Seeds of A. thaliana Columbia (Col-0) were stratified in the dark at 4 °C for 3 days. The seeds were then surface sterilized with 30% bleach solution and rinsed three times with sterile water. Murashige and Skoog agar media-containing Petridishes (0.5× Murashige and Skoog , 0.5% sucrose, 1% phytoagar, pH 5.7) were prepared either with 10 μM fluorescence or with 10 μM fluoresceinated aminohexanol tethered inositol hexakisphosphate (fluoresceinated InsP6).

After plating the seeds, the plates were sealed with a parafilm and placed in a growth room for a short day (12 h dark:12 h light) photoperiod cycle with a constant temperature of 22 °C for 7 days.

Analysis of Cellular Uptake of Fluoresceinated InsP6 in A. thaliana Seedlings

Uptake of fluoresceinated InsP6 or fluorescein was analyzed using a Zeiss SP5 confocal microscope. The characteristics of the channel used were as follows: argon laser; excitation 490 nm; detector gain 320. Seven day old seedlings grown with fluoresceinated InsP6 or fluorescein were used for imaging studies.

Measurement of Chlorophyll Content

Chlorophyll extraction using dimethyl sulfoxide. One hundred milligram of seedlings was taken into a vial containing 7 mL of dimethyl sulfoxide (DMSO) (Sisco research Lab Pvt. Ltd.) and incubated for 6 h at 65 °C. After a short spin, the supernatants were transferred to another tube, and the volume was made up to 10 mL with DMSO.

Determination of chlorophyll content. From the prepared DMSO extraction, 3.0 mL of extract was transferred to a cuvette, and the optical density values were measured at 645, 663, and 652 nm using a spectrophotometer with DMSO as the blank. Chlorophyll content was then calculated according to the Arnon equation.[46]

RNA isolation and qPCR analysis. Seven day old seedlings were ground in liquid nitrogen, and total RNA was extracted with RNA iso Plus (Takara) according to the manufacturer’s instruction. Extracted RNA was treated with TURBO DNA-free Kit (Invitrogen) to inactivate the DNAase and was quantified using a nano-spectrophotometer (Thermo Fisher Scientific). Two microgram of RNA was then reverse transcribed to cDNA using iScript cDNA synthesis kit as instructed by the manufacturer (Bio-Rad). Quantitative real-time polymerase chain reaction (PCR) was then performed using the HOT FIREPol EvaGreen qPCR Supermix in a ABI system (Thermo Fisher Scientific, Waltham, MA, USA). Mean PCR efficiencies per amplicon was then calculated through LinReg PCR. SAND (At2g28190) was used to normalize the efficiency corrected relative expression values. Primers used in quantitative reverse transcriptase (qRT)-PCR are listed below.

ICS1 forward primer: 5′TACTAACCAGTCCGAAAGACG3′ ICS1 reverse primer: 5′GAGGCTTGACAACAACTCTGT3′

Protein extraction and analysis. Seven day old seedlings were ground with 6 M urea. The homogenates were mixed with a loading buffer containing 4%(w/v) sodium dodecyl sulphate (SDS), 125 mM Tris–HCl, 2% (v/v) 2-mercaptoethanol, 0.05% (w/v) bromophenol blue, and 20% (v/v) glycerol and boiled for 10 min at 100 °C, followed by loading on an 6% SDS-PAGE gel for Western blot analysis. The monoclonal anti-α-EDS1 antibody produced in mouse (customized from Bio Bharati, 1:10,000 dilutions) was used to detect the endogenous EDS1 levels. The goat anti-rabbit-IgG polyclonal antibody horseradish peroxidase-conjugated (Sigma, 1:5000 dilutions) was used as the secondary antibody.

Experimental Methods on Studies on D. melanogaster Using (III)

Materials for studies on D. melanogaster

Wild-type CsBz flies

1% agar and 1% agar + 100 mM sucrose media.

Fluoresceinated tethered compound.

Fly media composition for raising the flies

The composition of the medium for growth studies on D. melanogaster is shown in Table .

Steps involved:

Two vials each of 1% agar and two of fluoresceinated tethered compound plus 1% agar were taken. Each vial had 3 mL of media present in it. Fluoresceinated tethered compound (0.25 mg/mL) was present, which means each vial had 0.75 mg/mL fluoresceinated tethered compound.

Twenty female flies and 10 male flies were put in each vial for egg laying for 24 h.

After 24 h, the flies were removed and the following were done:

The eggs were observed under the fluorescence microscope.

The number of eggs in both 1% agar vials and vials which also contain the fluoresceinated tethered compound (III) were counted.

The eggs were then allowed to hatch into larvae and were shifted to normal media; later, they were again checked under a microscope for fluorescence. Both, first and second instar stages of larvae were checked.

The larvae were then allowed to grow into pupae. The pupae that eclosed as adult flies were also checked under a fluorescence microscope.

Steps Involved in Computational Studies Using (III)

Protein Structure Preparations

Crystals of 2P1M, 1N4K, and 4ZAI were obtained from the Protein Data Bank (www.pdb.org). The crystals were in APO forms. The protein structure was optimized and then minimized using the protein preparation wizard module of Maestro[47] in which OPLS3 force field was used.[48]

Ligand Preparation in Axial and Equatorial Arrangements

The bioactive molecules in their axial and equatorial forms were prepared using Schrödinger’s module LIGPREP (version 2017-1),[49,50] which generates tautomers, and the possible ionization states at the pH range 7 ± 2[51] also generates all stereoisomers of the compound if necessary. The optimization was done using the OPLS3 force field.[52]

Binding Site Identification

Two ligand-independent (Site Map) and ligand-dependent (molecular dockings) methods were used to identify the most likely binding site of the compounds. The optimized structures of 2P1M, 1N4K, and 4ZAI by molecular dynamics simulation were used for binding site identification.

Site Map Analysis

Site Map[53] program of Schrodinger Suite was used for calculating the binding site of compounds. The different parameters such as site score, size, exposure score, enclosure, hydrophobic/hydrophilic character, contact, and donor/acceptor character were used for the calculation of the potential binding site. Drug ability of the site is denoted by D score. These scores were derived by Halgren[54] by executing the Site Map.

Program on a number of proteins that have inhibitors bound with potencies in the submicromolar range was used, and statistical analyses were performed to produce optimized scores. The OPLS-2003 force field[55] was employed, and a standard grid was used with 15 site points per reported site and cropped at 4.0 Å from the nearest site point.

Molecular Docking

Molecular docking was used further to assess the robustness of results provided by Site Map. The docking studies were performed using both AUTODOCK4.2 (loc.cit) and GLIDE. The two tools were required to identify the putative binding site as no cocrystal (with inhibitor) is reported for these molecules.[56,57] The docking with AUTODOCK was performed using three different protocols: (1) blind docking was performed to explore the possible binding sites at the surface of the whole protein to rule out any bias; (2) focused docking was performed on the most populated cluster obtained from blind docking by entering the docking grid on the center of mass of cluster representative conformation of compounds; and (3) guided docking was performed using the coordinates of the binding site[58] to observe the expansion of compounds from the center of the pocket, taking the center of mass of compounds as a grid. Interestingly, the different dockings were carried out at the most likely site identified by Site Map, followed by the most populated cluster obtained through blind docking, followed by focused and guided docking that coincide well. In all these protocols, 200 conformers were generated separately to observe their convergence at the catalytic site.

The grid coordinates, energy evaluations, and generations of all three protocols are provided here. GLIDE and GLIDE XP docking methods (a module of MAESTRO) were also implemented to obtain the consensus result as well as to remove the chances of errors.