Column-free purification and coating of SpyCatcher protein on ELISA wells generates universal solid support for capturing of SpyTag-fusion protein from the non-purified condition.

•Spy Tag-Protein covalent interaction is rapid and specific method for protein immobilization.•Column free purification of SpyCatcher protein enables develop a universal solid support for SpyTag protein purification.•This method is highly simple and applicable to other proteins.

Introduction

A variety of display technologies, such as Phage or mRNA display, are used for selection of new bindersagainst wide ranges of antigens [[1], [2], [3]]. In Phage display, a DNA library encoding millions of variants ofa specific binding scaffold is cloned in fusion to a phage coat protein such that each phage expresses aslightly different specific binder on its surface. The DNA encoding each binder is then contained withineach phage, allowing a direct linkage between the DNA sequence and binding functionality of thescaffold to the target antigen. The selection relies on an affinity enrichment process known as Biopanning [[3], [4]]. The Biopanning process includes three parts: binding of phage to the target antigen,washing out the non-binding phage particles, and then elution of the bound phage. The target antigensused for Biopanning are typically highly purified recombinant proteins that are immobilized on eitherbeads [5] or solid supports such as ELISA multi-well plates [6]. Solid-support immobilization methodsrequire less target protein and facilitate the selection multiple targets simultaneously. However, in bothmethods, the quality and yield of the recombinant protein have an essential role in the generation ofantibodies [7]. For every new Biopanning selection process ~ 1 mg of purified recombinant protein isrequired (typically 1-100µg/ml for each well of a microtiter plate). In many laboratory applications, thepurification of new target antigen proteins can present a serious bottleneck to developing new binders,since each new target can require an entirely new expression and purification method to be developed.

To circumvent purification steps, several more direct immobilization methods have been established.Lim et al have developed a method denoted as Yin-Yang panning [8]. This method was developed foraffinity selection of a specific protein in a crude lysate without purification. This procedure was doneby saturation of non-binder antibodies in non-expressed bacterial lysate, with blocking agents in ELISA wells, followed by selection of specific binders from expressed lysates in wells. This methodwas used for the development of a MERS-CoV nucleoprotein specific antibody. Although thismethod is very cost effective, it must be optimized for every target protein. Hence, there is need for development of a sandwich ELISA method for specific capture of targetproteins from crude feedstocks. Antibody-mediated capture is highly specific, but expensive and aspecific antibody must be available for every target protein. Protein ligation methods are a valuablealternative to antibodies, which facilitate the formation of covalent bonds during the coating reaction [9]. The most widely used methods are sortase, split intein coupling [10] andSpyTag/SpyCatcher. By immobilization of one partner it is possible to catch the unpurified corresponding partner. The sortase-mediated coupling reaction takes 24h at 100µM of enzymeconcentration [11]. For split intein, the coupling reaction is limited to 10 µM concentrations ofpartners [12]. The optional target protein concentration in phage display is in the nM range [13]. Hence, there is need for a more sensitive method to achieve coupling. The SpyTag/SpyCatchercoupling reaction is an interesting method that is being rapidly developed to fill the gaps of theaforementioned methods. The coupling reaction requirements have decreased from 10µMconcentrations in early work to the recently engineered versions 002 and 003 with reactionrequirements of 100nm and 10nm respectively and coupling times of a few hours [[14], [15]]. The SpyTag/SpyCatcher derivatives have been applied in a wide range of studies such as cancer-vaccinedevelopment [16], cell-specific capturing [17], and enzyme immobilization [18].

Fierle et al. have also used bacterial superglue for specific capture of antigen from crude lysate [19].This method is based on the highly specific covalent peptide-protein interactions of SpyTag (SpyT)and SpyCatcher (SpyC) from Streptococcus pyogenes [20]. In practice, the SpyTag is chemicallysynthesized and conjugated onto beads, while the corresponding SpyCatcher protein is expressed as afusion partner with several cancer antigens expressed in a recombinant eukaryotic host system. TheSpyCatcher fusion protein was specifically captured onto the bead-based solid phase and then usedspecific-antibody selection. This interaction is efficient and highly specific. However, it is relativelyexpensive due to chemical synthesis and conjugation of SpyTag.The aforementioned studies have inspired us to develop a very simple and cost-effective method forspecific capture of antigen from crude lysate. To achieve this purpose, we have designed an indirectsandwich-like ELISA by non-chromatographic purification of faster variant SpyCatcher002 [14] protein and coating it on an ELISA plate to capture a SpyT002 fusion protein (in this work GFP) from a crudelysate. We show that this coated SpyC002 protein has the potential to be used as universal platform forimmobilization SpyT002 fusion proteins.

Materials and methods

Chemicals and reagents

All chemicals were purchased from Sigma Aldrich (St. Louis, MO, USA) unless otherwise stated. All cloning enzymes were purchased from Thermo Fisher Scientific. All oligonucleotides were synthesized by Macrogen (Seoul, South Korea) and synthetic DNA constructs were synthesized by Generay Biotech (Hongkong). All DNA extraction kits such as plasmid, Gel extraction and PCR clean up were purchased from Dena Zist Asia (Mashhad, Iran). For cloning and expression of recombinant proteins TOP10 and BL21(DE3) (RIL) were used respectively. Antibodies were purchased from BioLegend.

Plasmid construction

Primer sequences used for plasmid construction in this study are available in Table 1 . First, the sequence encoding the RTX tag (BRT17) [21] was synthesized by Generay and then cloned with NcoI and EcoRI into pET32a (which contains Trx solubility enhancer tag) to generate pET32-RTX. SpyC002 (Addgene ID:102827) and GFP were amplified and cloned by EcoRI and HindIII into pET32-RTX to make pET32-RTX-SpyC002 (Also referred as SpyC) and pET32-RTX-GFP respectively. The SpyT002 encoding plasmid was constructed according following steps: First, SpyT002-MBP was amplified from the pMAL-c5X vector and cloned into pET28(a) to make pET28-SpyT002-MBP. In parallel, RTX tag was cloned into a pMAL-c5X by NcoI and EcoRI (pMALp5X-RTX) and then RTX from pMALc5X-RTX subcloned into pET28-SpyT002MBP by SacI and EcoRI (for retrieve pMAL linker) to make pET28-SpyT002-MBP-RTX. Finally, the GFP DNA sequence was amplified and cloned by EcoRI and HindIII to generate pET28-SpyT002MBP-RTX-GFP (also referred as SpyC).For a negative control, GFP was cloned into pMAL-c5X-RTX to generate pMALc5x-RTX-GFP.

Table 1

Sequence of primers in this study.

	Primer name	Sequence (5′-3′)
1	SpyC002-F-EcoRI	TTACTGCATATGGAATTCGGTAGTGGTAGTGCCATGGTAACCACCTTATCA
2	SpyC002-R-HindIII	TTATCAAAGCTTAGTATGAGCGTCACCTTTAGT
3	GFP-F-EcoRI	AACATGGAATTCGTGAGCAAGGGCGAGGAGCT
4	GFP-R-HindIII	ATCGAAGCTTGCGGCCGCTTACTCGAGTAACTCGTCCATGCC
5	SpyT002-MBP-F-NcoI	ATGGCCATGGATGTGCCTACTATCGTGATGGTGGATGCCTACAAGCGTTACAAGGGTAGTAAAATCGAAGAAGGTAAACTG
6	MBP-R-EcoRI	TCCTTTGAATTCATGTGAAATCCTTCCCTCGATCC

Protein expression

All protein expression experiments were performed in the E. coli strain BL21(RIL). Cells harboring pET32-based plasmids (pET32-RTX-GFP and pET32-RTX-SpyC002) were cultured in Luria Broth (LB) media supplemented with 100 μg/mL ampicillin and 30 μg/mL chloramphenicol, while pET28based plasmids (pET28-SpyT002-MBP-RTX-GFP) were cultured in LB media supplemented with 50 μg/mL kanamycin and 30 μg/mL chloramphenicol. The expression cells were cultured in 5 mL LB overnight at 37 °C. The cultures were diluted 1:100 (v/v) into 200 ml LB media supplemented with the appropriate antibiotics. The cells were then grown at 37 °C until OD600 reached to 0.6–0.8, at which point 0.5 mM (final concentration) isopropyl β-d-1-thiogalactopyranoside (IPTG) was added for protein expression induction at 18 °C for 20 h.

Lysis and recovery

Cells were harvested by centrifugation at 5000×g for 10 min at 4 °C. The cell pellets were resuspended in Low Salt Buffer (40 mM Tris-HCL, 200 mM NaCl at pH 8.5). Low Salt Buffer was used for further steps, which include washing and dissolving steps. In each case, the cell pellet was resuspended in 1/20 of original culture volume. The resuspended cultures were then sonicated for 10 cycles of 30 s sonication at a setting of 4–5 W, with 30 s on ice. The resulting lysate was then clarified by centrifugation at 18,000 rpm for 30 min at 4 °C. The supernatant was recovered for purification of the target proteins.

RTX-mediated protein purification and protein analysis

This step was done according to the original Fan et al. procedures [21,22]. Briefly, calcium chloride was added to the cleared lysate of pET32-RTX-GFP, pET32-RTX-SpyC002 and pET28-SpyT002MBP-RTX-GFP to a final concentration of 25 mM (diluted from a 2 M stock solution). The sample was then mixed by inverting, and then incubated at room temperature for 15 min. The sample was then centrifuged at 16,000 g for 5 min and the supernatant was discarded. The remaining pellet was resuspended in Low Salt Buffer (40 mM Tris-Hcl, 200 mM NaCl at pH 8.5) by a short sonication. The sample was then centrifuged again at 16,000 g for 5 min and supernatant was discarded. the pellet was washed according previous step for 4 times and final pellet then dissolved in Low Salt Buffer containing 25 mM EDTA. Diluted samples were centrifuged again to separate remaining aggregates and soluble protein. The final supernatant was transferred to new tube and labelled as purified protein. Products of the TRX-RTX-SpyC002 purification steps, as well as purified Trx-RTX-GFP and SpyT002-MBPRTX-GFP proteins of were analyzed by SDS-PAGE.

Protein concentration was measure using a Bradford Assay [23] with Bovine Serum Albumin (BSA) used as a standard. The standard curve was generated according nanodrop 2000 protocol by using 125, 250, 500, 1000 and 2000 μg BSA/mL water. Clarified lysate samples were diluted 1:100 and purified product samples were diluted 1:50 in water.

To test the SpyT-SpyC interaction, 200 μg of purified SpyT002-MBP-RTX-GFP and 1 mg Trx-RTXSpyC002 were mixed and incubated for 2 h at 30 °C. The samples then analyzed by SDS-PAGE.To test the SpyT-SpyC interaction, 200 µg of purified SpyT002-MBP-RTX-GFP and 1mg of purifiedMBP-RTX-GFP (negative control) were mixed with 1 mg Trx-RTX-SpyC002 and incubated for 2h at30 °C. The samples then analyzed by SDS-PAGE.

Indirect sandwich-like ELISA

The purified Trx-RTX-SpyC002 was diluted in PBS buffer to a final concentration of 100 μg/ml. It was coated on ELISA wells either at constant (100 μg/ml) or ½ serial dilution concentrations (100, 50, 25, 12.5, 6.25, 3.125, 1.56 and 0.78 μg/ml) in 100 μl samples at 4 °C overnight. The wells were then washed with TBST buffer (Tris-buffered saline, pH 7.4, with 0.1% (v/v) Tween 20) 5x times. The coated wells were blocked with 1.0% BSA in PBST buffer (PBS with 0.1% (v/v) Tween 20) for 1 h at 37 °C. The wells were then washed with TBST buffer 3x times. At this point coated SpyC is ready for capture of the SpyT fusion protein. To assess Maximum signal of anti-GFP in different concentration, purified Trx-RTX-GFP was used as positive control and serially diluted from 100 to 0.75 μg/ml and coated according to the previous steps described above. As SpyT reacts with SpyC in a 1:1 M molar ratio, the signal of reacted Spy-T-GFP to SpyC at different concentrations with a respective positive control indicates the reaction rate for each respective concentration.For negative and non-specific control 3 type of coated SpyC, empty blocked well with 1% BSA and empty blocked wells SpyT cleared lysatetreated (to assess blocking efficiency) were used.

SpyT002-MBP-RTX-GFP in either pure and cleared lysate form (from step 2.4.) was diluted in PBS-T buffer to final concentration of 500 μg/ml. Then, serially diluted samples at 500, 250, 125, 62.5, 31.25, 15.6, 7.8 and 3.9 μg/ml in 100 μl buffer volume were incubated with SpyC coated wells for 2 h at 30 °C. The wells where then washed with TBST buffer 5x times, and 100 μl of a 1:5000 dilution of Primary antibody (anti-GFP) was added and incubated for 1 h at 37 °C. The wells were then washed with TBST buffer 5 times and a 1:5000 dilution HRP-conjugated antibody (anti-Rat) was added and incubated for 1 h at 37 °C. The wells were then washed with TBST buffer 5 times. To develop a signal, 100 μl TMB substrate was added to each well and incubated for 15min in darkness. The reaction was then stopped by addition of an equivalent volume of 0.3 M H2SO4. The wells were then read at 450 nm.

Results

Protein purification

The RTX (BRT17) tag sequence (GGAGNDTLY)9 is derived from the consensus block V RTX domain from the adenylate cyclase toxin (Cya A) of B. pertussis. It reversibly aggregates and becomes insoluble in the presence of low concentrations of calcium (25 mM) and remains insoluble until the calcium is removed by EDTA or other strong chelating agent. At this calcium concentration most bacterial proteins remain soluble, making it possible to isolate RTX-fusion proteins from whole lysates by simple centrifugation. By washing the RTX fusion pellet several times, it is possible to achieve pure a protein. Addition of metal chelators such as EDTA/EGTA in equivalent concentration reverts the RTX tag to soluble form. The RTX-based purification is illustrated in Fig. 1 . Addition of a solubility enhancer (in this work Trx) enhanced the production yield. For pET32-RTX-SpyC002, ~6.5 mg of pure protein was purified from 200 ml of shake-flask culture, where the pellet was washed 5 times. It was noted that after the third round of washing the purity of the protein didn't change, indicating that 3 wash cycles are suitable for protein purification (Fig. 2 A). This procedure was repeated for Trx-RTX-GFP (Fig. 2B) and SpyT002-MBP-RTX-GFP (Fig. 2C), where 3.3 mg and 1.5 mg of purified protein was achieved respectively. For SpyT002-MBP-RTX-GFP, after every round of washing the pellet size decreased significantly, and for this reason the yield of this protein is lower than the others (see Fig. 3).

Fig. 1

RTX-Mediated purification procedure.

Fig. 2

SDS-PAGE result of purification of recombinant proteins in this study. (A) Purification of TrxRTX-SpyCatcher002: Lane 1, cleared lysate: Lane 2, supernatant: Lane 3, Tag purity after 3x washing:Lane 4, supernatant after 3x wash; Lane 5, Tag purity after 4x wash; Lane 6, Tag purity after 5x wash, LaneM, protein maker. (B) Purified Trx-RTX-GFP: Lane M: Protein marker; Lane 1, Pure protein. (C) SpyTSpyC reaction: Lane M, Protein marker; Lane 1 Purified SpyT002-MBP-RTX-GFP; Lane 2, Mixture ofSpyT002-MBP-RTX-GFP and Trx-RTX-SpyCatcher002; Lane 3, Purified Trx-RTX-SpyCatcher002. (D) negative control of SpyT/SpyC reaction: Lane M: Protein marker, Lane 1 purified Trx-RTX-SpyC, Lane 2Trx-RTX-SpyC and MBP-RTX-GFP which shows no reaction.

Fig. 3

Coating SpyC on ELISA well and capturing and detection of recombinant SpyT fusion protein.

Spy peptide-protein interaction depends on two factors; SpyT:SpyC ratio and their concentrations in the reaction. In general, a 1.5 to 3-fold excess ratio is recommended for one partner, with a 2 h reaction time and 10 μM concentration of the limiting protein at room temperature. This time can be increased to 16 h for crowded surfaces [24]. To achieve the maximum reaction in short time, the ratio and temperature were increased to a 3.5-fold molar excess and 30 °C respectively. Although higher temperature such as 37 °C accelerates the reaction, it may not suitable for some proteins due to stability concerns. The remaining factor was binding partner concentration. The Coated SpyC proteins were divided into two groups. In one group the concentration of the SpyC was constant at 100 μg/ml (1.5 μM). In another group, The SpyC was ½ serially diluted from 100 μg/ml (1.5 μM) to 0.78 μg/ml (~10 nM) and then coated onto ELISA wells to determine threshold of reaction at low concentration [25]. For coating, PBS buffer was used with simple dilution, without need of protein dialysis. Due to the sensitivity of the RTX to calcium, skimmed milk was not used as blocking agent. As the Spy peptide-protein interaction occurs in a pH range from 4 to 8 [24], SpyT fusion proteins were diluted in PBS-T buffer and ½ serially diluted from 500 to 3.9 μg/ml.

To assess the maximum possible signal at different concentrations of reacted SpyT002- GFP fusion protein to the coated SpyC, the purified Trx-RTX-GFP test protein was ½ serially diluted from 100 to 0.78 μg/ml (from A-H) and was used as positive control. The signal of the positive control was approximately 3 (OD 450 nm) in all concentrations. At a constant concentration of SpyC (100 μg/ml), the signal of SpyT at concentrations ranging from 500 to 15 μg/ml was similar to the positive control. The signal decreased significantly at 7.8 μg/ml (86 nM) and 3.9 μg/ml (43 nM) of SpyT concentration. The SpyT lysate signal was somewhat lower due to impurity, but followed pure protein pattern (Fig. 4 A red line ). In serially diluted SpyC, the signal was maximum at 200 nM concentration of SpyC (Fig. 4B). At lower concentrations the signal decreased to about 40% of positive control at 12 nM. The immobilization efficiency was assessed by calculating the coatedSpyT signal relative to the positive control signal. As soluble SpyT is required for SpyC coupling, the immobilization efficiency was calculated by saturation of the coated SpyC. According to the result of the SpyT purified and lysate samples, for 100 μg/ml concentration of coated SpyC, the minimum concentration of SpyT that is required for a complete reaction in 2 hh at 30 °C is ~173 nM of SpyT protein (in this work ~15 μg/ml) (Fig. 4C). However, it is possible to use lower concentrations, but with a lowerimmobilization efficiency (down to 50 nM). Serial dilution of SpyC results showed that the minimum concentration of SpyC required for a complete reaction is between 100 and 200 nM (~6.25–12.5 μg/ml) and in this case at least ~350–700 nM of SpyT (in this work ~31–62.5 μg/ml) is required (Fig. 4D). These results match the original Spy002 article, which reports that the reaction rate in 100 nm SpyC is ~70% [14].

Fig. 4

ELISA and Immobilization results. The experiment was repeated in two replicates. Error barsrepresent Standard Error(SE) of mean; Blue; positive control(Trx-RTX-GFP) (SE 0.02, +SD 0.06), Grey:Pure protein(Trx-RTX-SpyC002) (SE 0.24, +SD 0.63), Red: Cleared lysate(SE 0.33, + SD 0.84), Yellow:Negative and Non-specific controls(SE 0.01, +SD 0.01). (A) ELISA signal (OD 450) of ½ serially dilutedSpyT (500-4 µg/ml) analysis on 100µg/ml coated SpyC wells, (B) ELISA signal analysis in ½ Serialdilution of SpyT (500-4 µg/ml) of ½ serially diluted SpyC (100-1 µg/ml), (C) Immobilization efficiencyanalysis in 100µg/ml coated SpyC, (D) Immobilization efficiency analysis in Serial dilution of SpyC.

Discussion

The Spy tag system has been successfully used for basic research and applied science, such as cell inner/outer localization [26], enzyme thermal stabilization [27], enzyme immobilization [28], vaccine development [29,30] and protein detection [31] and purification [32]. Since the development of this method in 2012, its applications are expanding along with its potential [33]. In this work we have combined a non-chromatographic method with the spy catcher002 protein to generate a potentially cost-effective universal capture method for immobilization of SpyT-fusion recombinant proteins from unpurified feeds. The RTX-mediated protein purification takes 1–2 h, without any specific equipment. As mentioned above, we produced ~6 mg of purified fusion protein in one example, which is theoretically suitable for the generation of hundreds of ELISA wells. Conversely, the sample size is also small, which subsequently decreases the required culture volume. In addition, this system is sensitive to small amounts of recombinant protein, which is ideal for low-expressing recombinant proteins or in mammalian transient expression systems. However, low concentrations of recombinant protein (100 nM for both partners) may show different results due to reaction rate dependence of Spy variant 002 on protein concentration. Recently, variant 003 of this method has been developed [15]. Increased sensitivity of this method to even sub-nanomolar concentrations may be possible by applying Spy003. As both ELISA and Spy tag-protein are compatible with urea, it is possible to use this method with urea to dissolve inclusion bodies and continue process steps with immobilized protein. This method is also helpful for the study of SpyT fusion vaccines and for studies of immunization or in labon chip methods.

Authorship statement

Please indicate the specific contributions made by each author (list the authors’ initials followed by their surnames, e.g., Y.L. Cheung). The name of each author must appear at least once in each of the three categories below Conception and design of study, acquisition of data, analysis and/or interpretation of data, Drafting the manuscript, revising the manuscript critically for important intellectual content, Approval of the version of the manuscript to be published (the names of all authors must be listed).

Declaration of competing interest

The authors declare no conflicts of interest.