| Literature DB >> 32349250 |
Amna Al-Araimi1, Amira Al Kharusi2, Asma Bani Oraba1, Matar M Al-Maney1, Shadia Al Sinawi3, Ibrahim Al-Haddabi3, Fahad Zadjali1.
Abstract
Inflammatory bowel disease (IBD) is an immunologically mediated chronic intestinal disorder. Growth hormone (GH) administration enhances mucosal repair and decreases intestinal fibrosis in patients with IBD. In the present study, we investigated the effect of cellular sensitivity to GH via suppressor of cytokine signaling 2 (SOCS2) deletion on colitis and recovery. To induce colitis, wild type and SOCS2 knockout (SOCS2-/-) mice were treated with 3% dextran sodium sulphate (DSS), followed by a recovery period. SOCS2-/- mice showed higher disease activity during colitis with increased mRNA expression of the pro-inflammatory cytokines nitric oxide synthase 2 (NOS2) and interleukin 1 β (IL1-β). At recovery time point, SOCS2-/- showed better recovery with less fibrosis measured by levels of α-SMA and collagen deposition. Protein and mRNA expressions of transforming growth factor beta β1 (TGF-β1) receptors were significantly lower in SOCS2-/- mice compared to wild-type littermates. Using an in vivo bromodeoxyuridine (BrdU) proliferation assay, SOCS2-/- mice showed higher intestinal epithelial proliferation compared to wild-type mice. Our results demonstrated that deletion of the SOCS2 protein results in higher growth hormone sensitivity associated with higher pro-inflammatory signaling; however, it resulted in less tissue damage with less fibrotic lesions and higher epithelial proliferation, which are markers of GH-protective effects in IBD. This suggests a pleiotropic effect of SOCS2 and multiple cellular targets. Further study is required to study role of SOCS2 in regulation of TGFβ-mothers against the decapentaplegic homolog (Smad) pathway.Entities:
Keywords: colitis; fibrosis; growth hormone; inflammatory bowel disease; suppressor of cytokine signaling protein
Mesh:
Substances:
Year: 2020 PMID: 32349250 PMCID: PMC7246483 DOI: 10.3390/ijms21093073
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 5.923
Figure 1SOCS2 deletion aggravates colitis severity in mice. (A) Experimental design of dextran sodium sulphate (DSS)-induced colitis. Both wild-type (SOCS2+/+) and SOCS2-knockout (SOCS2−/−) mice were sacrificed at three time points. Prior colitis (Pre-DSS), after DSS-induced colitis and at recovery 12 days after abstaining DSS from drinking water. Percentage of body weight changes (B), macroscopic colitis severity index (C) and histological colitis score (D) in SOCS2+/+ and SOCS2−/− mice at three time points of the model. (E) Hematoxylin and eosin staining of the distal colon from mice at the three time points of the model taken at 10x magnification. Magnified sections (X40) are shown in the bottom left corner. Details of the macroscopic and histological assessments are described in the Methods section. Student’s t-test p-values: # <0.05, ** <0.01, *** <0.001; n = 10 mice per group.
Figure 2Growth hormone and inflammatory activity during colitis and recovery. (A) Gene expressions of pro-inflammatory (NOS2 and IL-1β) and anti-inflammatory cytokines (IL-4) in colonic tissue prior, during DSS-induced colitis and at recovery in wild-type (SOCS2+/+) and SOCS-knockout (SOCS2−/−) mice. Gene expressions were measured using the relative standard method and normalised to expression of the β-actin gene. Data are shown in relative unit (RU). (B) Plasma cytokine levels of TNFα and plasma IL-4 of in both mice groups. (C) Growth hormone (GH) sensitivity index measured as the ratio of plasma IGF-1/GH in both mice groups during the three time points of the model. * Student’s t-test p-value < 0.05; n = 6 per mice group for the gene expression study and for plasma analysis n = 10 per group.
Figure 3SOCS2-deletion induces less fibrosis in an inflammatory bowel model. (A) Masson’s Trichrome staining taken at 20X magnification prior, at colitis and after recovery from colitis in wild-type (SOCS2+/+) and SOCS-knockout (SOCS2−/−) mice. (B) Collagen staining intensity in the study model measured from color threshold analysis using ImageJ tool. An average of 3 sections from each mouse was taken in a group of 5 mice. (C) immunohistochemistry of α-SMA in colonic sections. (D,E) TGFβ1 colonic gene expressions and plasma levels in both mice groups at the three time points of the study: pre-colitis, colitis and recovery. (F) TGFβRII gene expressions. (G) Western blot of TGFβ-receptor III levels in both mice groups at the three time points of the disease model (n = 2 per group). All gene expressions were normalized to the expression of the β-actin gene. Student’s t-test p-values: * < 0.05, ** < 0.01.
Figure 4Colonic microscopic changes and epithelial regeneration. (A) Transmission electron microscope images of colons of both mice not treated by dextran sodium sulphate (DSS). The ultra-structure of the villi, goblet cells and gap junctions (white arrows) are shown. (B) Western blot of the gap junction protein occludin. (C) In vivo colonic epithelial proliferation measured by immunohistochemical staining of BrdU in colonic tissues of mice without treatment with DSS. Colonic tissues were fixed 4 h post intraperitoneal injection of BrdU. Sections are shown in 10× and 40× magnification. Negative control tissues are from mice not injected with BrdU. Total positive cells per crypts are shown in the bar diagram. A total of 20–23 crypts were studied per mouse sample and 5 mice per group were studied. Student’s t-test p-value ** < 0.01.
Histological scoring of the severity of the colitis.
| Feature | Score | Description |
|---|---|---|
| Inflammation severity | 0 | None |
| 1 | Mild | |
| 2 | Moderate | |
| 3 | Severe | |
| Inflammation extent | 0 | None |
| 1 | Mucosa | |
| 2 | Submucosa | |
| 3 | Transmural | |
| Crypt damage | 0 | None |
| 1 | Basal 1⁄3 damaged | |
| 2 | Basal 2⁄3 damaged | |
| 3 | Crypt lost | |
| 4 | Surface epithelial lost | |
| Ulcer | 4 | |
| Lymphocyte infiltration | 3 | |
| Neutrophil infiltration | 2 | |
| Cryptitis | 3 | |
| Crypt abscess | 3 | |
| Edema | 4 | |
| Goblet cell depletion | 3 |
List of primers and sequences used for quantitative PCR.
| Gene | Forward Primer | Reverse Primer |
|---|---|---|
|
| CATCAACCAGTATTATGGCTC | TTTCCTTTGTTACAGCTTCC |
|
| GGATGATGATGATAACCTGC | CATGGAGAATATCACTTGTTGG |
|
| CTGGATTCATCGATAAGCTG | TTTGCATGATGCTCTTTAGG |
|
| CACCGGAGAGCCCTGGATA | TGTACAGCTGCCGCACACA |
|
| TGCAATCAGGACCACTGCAATAA | GTGCAATGCAGACGAAGCAGA |
|
| AAATTCCCAGCTTCTGGCTCAAC | TGTGCTGTGAGACGGGCTTC |
|
| GATGTATGAAGGCTTTGGTC | TGTGCACTTTTATTGGTCTC |