| Literature DB >> 32326039 |
Emma L A Howson1,2, Richard J Orton2,3, Valerie Mioulet1, Tiziana Lembo2, Donald P King1, Veronica L Fowler1.
Abstract
Real-time PCR (rPCR) is a widely accepted diagnostic tool for the detection and quantification of nucleic acid targets. In order for these assays to achieve high sensitivity and specificity, primer and probe-template complementarity is essential; however, mismatches are often unavoidable and can result in false-negative results and errors in quantifying target sequences. Primer and probe sequences therefore require continual evaluation to ensure they remain fit for purpose. This paper describes the development of a linear model and associated computational tool (GoPrime) designed to predict the performance of rPCR primers and probes across multiple sequence data. Empirical data were generated using DNA oligonucleotides (n = 90) that systematically introduced variation in the primer and probe target regions of a diagnostic assay routinely used to detect foot-and-mouth disease virus (FMDV); an animal virus that exhibits a high degree of sequence variability. These assays revealed consistent impacts of patterns of substitutions in primer and probe-sites on rPCR cycle threshold (CT) and limit of detection (LOD). These data were used to populate GoPrime, which was subsequently used to predict rPCR results for DNA templates (n = 7) representing the natural sequence variability within FMDV. GoPrime was also applicable to other areas of the FMDV genome, with predictions for the likely targets of a FMDV-typing assay consistent with published experimental data. Although further work is required to improve these tools, including assessing the impact of primer-template mismatches in the reverse transcription step and the broader impact of mismatches for other assays, these data support the use of mathematical models for rapidly predicting the performance of rPCR primers and probes in silico.Entities:
Keywords: PCR; diagnostics; foot-and-mouth disease; in silico modeling framework
Year: 2020 PMID: 32326039 PMCID: PMC7238122 DOI: 10.3390/pathogens9040303
Source DB: PubMed Journal: Pathogens ISSN: 2076-0817
Linear DNA oligonucleotide templates for real-time PCR targets (5′-3′).
| Forward Primer Target | Probe Target | Reverse Primer Target | |
|---|---|---|---|
| R | ACTGGGTTTTACAAACCTGTGA | TCCTTTGCACGCCGTGGGAC | TCCGTGGCAGGACTCGC |
| 1 |
|
|
|
| 2 |
|
|
|
| 3 |
|
|
|
| 4 |
|
|
|
| 5 |
|
|
|
| 6 |
|
|
|
| 7 |
|
|
|
| 8 |
|
|
|
| 9 |
|
|
|
| 10 |
|
|
|
| 11 |
|
|
|
| 12 |
|
|
|
| 13 |
|
|
|
| 14 |
|
|
|
| 15 |
|
|
|
| 16 |
|
|
|
| 17 |
|
|
|
| 18 |
|
|
|
| 19 |
|
|
|
| 20 |
|
|
|
| 21 |
|
|
|
| 22 |
|
|
|
| 23 |
|
|
|
| 24 |
|
|
|
| 25 |
|
|
|
| 26 |
|
|
|
| 27 |
|
|
|
| 28 |
|
|
|
| 29 |
|
|
|
| 30 |
|
|
|
| 31 |
|
|
|
| 32 |
|
|
|
| 33 |
|
|
|
| 34 |
|
|
|
| 35 |
|
|
|
| 36 |
|
|
|
| 37 |
|
|
|
| 38 |
|
|
|
| 39 |
|
|
|
| 40 |
|
|
|
| 28 |
|
|
|
| 29 |
|
|
|
| 30 |
|
|
|
| 31 |
|
|
|
| 32 |
|
|
|
| 33 |
|
|
|
| 34 |
|
|
|
| 35 |
|
|
|
| 36 |
|
|
|
| 37 |
|
|
|
| 38 |
|
|
|
| 39 |
|
|
|
| 40 |
|
|
|
| 41 |
|
|
|
| 42 |
|
|
|
| 43 |
|
|
|
| 44 |
|
|
|
| 45 |
|
|
|
| 46 |
|
|
|
| 47 |
|
|
|
| 48 |
|
|
|
| 49 |
|
|
|
| 50 |
|
|
|
| 51 |
|
|
|
| 52 |
|
|
|
| 53 |
|
|
|
| 54 |
|
|
|
| 55 |
|
|
|
| 56 |
|
|
|
| 57 |
|
|
|
| 58 |
|
|
|
| 59 |
|
|
|
| 60 |
|
|
|
| 61 |
|
|
|
| 62 |
|
|
|
| 63 |
|
|
|
| 64 |
|
|
|
| 65 |
|
|
|
| 66 |
|
|
|
| 67 |
|
|
|
| 68 |
|
|
|
| 69 |
|
|
|
| 70 |
|
|
|
| 71 |
|
|
|
| 72 |
|
|
|
| 73 |
|
|
|
| 74 |
|
|
|
| 75 |
|
|
|
| 76 |
|
|
|
| 77 |
|
|
|
| 78 |
|
|
|
| 79 |
|
|
|
| 80 |
|
|
|
| 81 |
|
|
|
| 82 |
|
|
|
| 83 |
|
|
|
| 84 |
|
|
|
| 85 |
|
|
|
| 86 |
|
|
|
| 87 |
|
|
|
| 88 |
|
|
|
| 89 |
|
|
|
| 90 |
|
|
|
| The primer/probe target sequences of the 90 DNA templates (109 base pairs in length) in 5′-3′ orientation. Non-target regions between the primer/probe targets were identical to O/UKG/35/2001 (accession number KR265074: nucleotides 7862-7970). The black sequence (top row) represents the reference template (R); grey sequences represent the varying DNA templates, black highlighted bases depict primer/probe-template mismatch sites. | |||
Variables included in the linear model analysis.
| Mismatch Type | Variable |
|---|---|
| Primers | Percentage mismatch (forward and reverse combined) |
| Type 1 mismatch at the 3′-end (nucleotide 1) | |
| Type 2 mismatch at the 3′-end (nucleotide 1) | |
| Type 1 mismatch at the 3′-end (nucleotide 2) | |
| Type 2 mismatch at the 3′-end (nucleotide 2) | |
| Type 1 mismatch at the 3′-end (nucleotides 3-4) | |
| Type 2 mismatch at the 3′-end (nucleotides 3-4) | |
| Probe | Percentage mismatch |
| Mismatches were grouped as one of two types: (type 1) purine-pyrimidine mismatch (G-T or C-A nucleotide base pairing, leading to a minor conformational change in the primer/probe-template duplex); (type 2) purine-purine or pyrimidine-pyrimidine mismatch (G-A, A-A, G-G, C-T, T-T or C-C nucleotide base pairing, leading to a major conformational change in the primer/probe-template duplex). | |
Linear DNA templates representing naturally occurring foot-and-mouth disease field isolates for testing GoPrime predictions (5′-3′).
| Forward Primer Target | Probe Target | Reverse Primer Target | |
|---|---|---|---|
| R | ACTGGGTTTTACAAACCTGTGA | TCCTTTGCACGCCGTGGGAC | TCCGTGGCAGGACTCGC |
| JX040500 |
|
|
|
| KC440884 |
|
|
|
| AY593802 |
|
|
|
| KC440883 |
|
|
|
| AY593812 |
|
|
|
| KF112882 |
|
|
|
| HM191257 |
|
|
|
| The primer/probe binding regions of the seven DNA oligonucleotides ordered to test the program (109 base pairs in length, with regions between primers consistent with the sequences for each accession number. The black sequence (top row) represents the reference template (R); grey sequences represent the varying DNA templates, with black highlighted bases depicting primer/probe-template mismatch sites. FMDV serotypes were as follows: JX040500 (O); KC440884 (Southern African Territories 2); AY593802 (A); KC440883 (O); AY593812 (O); KF112882 (O); HM191257 (O). | |||
Figure 1The effects of primer-template mismatches on real-time PCR (rPCR) cycle threshold (CT). (A) single mismatches at the 3′-end; (B) and (C) multiple mismatches at the 3′-end(s); (D) effect of primer-template percentage complementary. Results represent the average increase in cycle threshold (ΔCT) from the reference template across two rPCR kits (ExciteTM UF 2x Master and SuperScript™ III Platinum™ One-Step qRT-PCR Kit) and a dilution series of template (106–100 copies/reaction). The limit of detection (LOD) for each template is defined as the lowest dilution where all replicates were positive (displayed in grey text). Error bars represent the standard deviation. (F) forward primer; (R) reverse primer; (nt) nucleotide. Template number refers to Table 1.
Figure 2The effects of probe-template mismatches on real-time PCR (rPCR) cycle threshold. Results represent the average increase in cycle threshold (CT) from a perfectly matched template, across two rPCR kits (ExciteTM UF 2x Master and SuperScript™ III Platinum™ One-Step qRT-PCR Kit) and a dilution series of template (106–100 copies/reaction). The limit of detection (LOD) for each template is defined as the lowest dilution where all replicates were positive (displayed in grey text). Error bars represent the standard deviation. (P) probe; percentages represent probe-template complementarity. Template number refers to Table 1.
The effect of mismatches on ΔCT calculated from the linear model analysis.
| Factor | Mismatch Type | ΔCT | SE | t Value | |
|---|---|---|---|---|---|
| Primer | % mismatch (forward/reverse combined) * | 0.87 | 0.02 | 39.39 | <0.001 |
| (minimum of 82.05% match is required [combined % for the pair]) | |||||
| nt 1 mismatch (type 1) | 1.64 | 0.24 | 6.86 | <0.001 | |
| 2× nt 1 mismatch (type 1) | 4.88 | 0.81 | 6.02 | <0.001 | |
| nt 1 mismatch (type 2) | 4.10 | 0.34 | 12.03 | <0.001 | |
| 2× nt 1 mismatch (type 2) | 8.71 | 1.25 | 6.97 | <0.001 | |
| nt 2 mismatch (type 1) | 0.90 | 0.36 | 2.51 | 0.012 | |
| 2× nt 2 mismatch (type 1) | 3.32 | 0.76 | 4.40 | <0.001 | |
| nt 2 mismatch (type 2) | 3.44 | 0.39 | 8.82 | <0.001 | |
| 2× nt 2 mismatch (type 2) | 6.13 | 1.06 | 5.79 | <0.001 | |
| nt 3-4 mismatch (type 1) | 1.07 | 0.40 | 2.69 | 0.007 | |
| 2× nt 3-4 mismatch (type 1) | 2.14 ** | ||||
| nt 3-4 mismatch (type 2) | 2.99 | 0.34 | 8.79 | <0.001 | |
| 2× nt 3-4 mismatch (type 2) | 4.83 | 2.97 | 1.63 | 0.105 | |
| Maximum of two mismatches can be tolerated in the 3′-ends (within or between primers) | |||||
| Probe | % mismatch | 0.50 | 0.03 | 18.35 | <0.001 |
| (minimum of 85.00% match is required) | |||||
| (nt) nucleotide; (ΔCT) change in cycle threshold; (SE) standard error. For multiple mismatches, the linear model was able to calculate the effect of having the same type of mutation in both the primers (2×), if two mismatches were present but different the linear model calculated the additive/dampening effect: two 3′-end primer mismatches (ΔCT: −0.27 [2dp]); one primer and one probe mismatch (ΔCT: +0.43 [2dp]). Mismatches were grouped as one of two types: (type 1) purine-pyrimidine mismatch (G-T; C-A: minor conformational change in the primer/probe-template duplex); (type 2) purine-purine or pyrimidine-pyrimidine mismatch (G-A; A-A; G-G; C-T; T-T; C-C: major conformational change in the primer/probe-template duplex). One linear model looked primer-template mismatches; a second linear model was used to look at probe-template mismatches. * If (for example) a type nt 1 mismatch was present, the percentage mismatch ΔCT would be calculated and an additional nt 1 mismatch ΔCT penalty added. ΔCT, SE, and t value given to 2 decimal places. ** Insufficient oligos to calculate with accuracy, therefore GoPrime calculates this based on ΔCT of nt 3–4 mismatch (type 1) × 2. | |||||
Figure 3GoPrime flow diagram. GoPrime examines sets of primer sequences (optionally including a probe sequence), searches the target genome sequences for potential matches, then predicts the effect of any primers/probe-template mismatches present on real-time PCR cycle threshold and limit of detection.
Figure 4Evaluating GoPrime as a predictor of real-time PCR (rPCR) performance using naturally occurring sequence variations. GoPrime predictions are plotted against the (A) observed change in cycle threshold for ExciteTM UF 2x Master Mix; (B) observed change in cycle threshold for SuperScript™ III Platinum™ One-Step qRT-PCR Kit; (C) observed change in limit of detection for ExciteTM UF 2x Master Mix; (D) observed change in limit of detection for SuperScript™ III Platinum™ One-Step qRT-PCR Kit. For the observed results, points represent the average change in cycle threshold or limit of detection across all dilutions (106–100) of the starting template.
Figure 5Using GoPrime and GoPrimeTree to predict the likely targets of foot-and-mouth disease virus (FMDV)-typing PCR assays (Bachanek-Bankowska et al., 2016) (n = 66). Four primer/probe sets were tested: (A) serotype A; (B) serotype O; (C) serotype Southern African Territories (SAT) 1; (D) serotype SAT 2. For the color scheme: (dark green) perfect primer/probe-template match; (mid-green) cycle threshold affected by up to a CT of 5; (light green) cycle threshold affected by up to a CT of 10; (black) sequence predicted not to amplify.