| Literature DB >> 32310947 |
Leonid M Irenge1,2, Jérôme Ambroise1, Prudence N Mitangala3, Bertrand Bearzatto1, Raphaël K S Kabangwa4, Jean-François Durant1, Jean-Luc Gala1.
Abstract
BACKGROUND: Over the past recent years, Vibrio cholerae has been associated with outbreaks in sub-Saharan Africa, notably in Democratic Republic of the Congo (DRC). This study aimed to determine the genetic relatedness of isolates responsible for cholera outbreaks in eastern DRC between 2014 and 2017, and their potential spread to bordering countries. METHODS/PRINCIPALEntities:
Mesh:
Substances:
Year: 2020 PMID: 32310947 PMCID: PMC7192507 DOI: 10.1371/journal.pntd.0007642
Source DB: PubMed Journal: PLoS Negl Trop Dis ISSN: 1935-2727
Antimicrobial susceptibility patterns and antimicrobial resistance (AMR) genes of V. cholerae isolates from eastern DRC.
| 2016 (n = 2) | |||||||||||||||||||
| Serotype | PXB | AMP | CHL | NA | CIP | SXT | |||||||||||||
| O1 Inaba | 0 | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / |
| O1 Ogawa | 2 | 100% | 0% | 0% | 100% | 50% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 0% | 0% | 0% |
| Non-O1/non-O139 | 0 | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / |
| 2014 (n = 3) | |||||||||||||||||||
| Serotype | PXB | AMP | CHL | NA | CIP | SXT | |||||||||||||
| O1 Inaba | 3 | 100% | 0% | 0% | 100% | 0% | 100% | 100% | 33% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 0% | 0% | 0% |
| O1 Ogawa | 0 | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / |
| Non-O1/non-O139 | 0 | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / |
| 2015 (n = 25) | |||||||||||||||||||
| Serotype | PXB | AMP | CHL | NA | CIP | SXT | |||||||||||||
| O1 Inaba | 20 | 100% | 0% | 0% | 100% | 0% | 100% | 100% | 5% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 0% | 0% | 0% |
| O1 Ogawa | 0 | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / |
| Non-O1/non-O139 | 5 | 100% | 40% | 0% | 100% | 0% | 100% | 0% | 0% | 0% | 0% | 0% | 0% | 0% | 0% | 0% | 80% | 80% | 20% |
| 2016 (n = 1) | |||||||||||||||||||
| Serotype | PXB | AMP | CHL | NA | CIP | SXT | |||||||||||||
| O1 Inaba | 1 | 100% | 0% | 0% | 100% | 0% | 100% | 100% | 0% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 0% | 0% | 0% |
| O1 Ogawa | 0 | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / |
| Non-O1/non-O139 | 0 | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / |
| 2014 (n = 17) | |||||||||||||||||||
| Serotype | PXB | AMP | CHL | NA | CIP | SXT | |||||||||||||
| O1 Inaba | 3 | 100% | 0% | 0% | 100% | 0% | 100% | 100% | 0% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 0% | 0% | 0% |
| O1 Ogawa | 14 | 100% | 18% | 0% | 100% | 12% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 0% | 0% | 0% |
| Non-O1/non-O139 | 0 | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / |
| 2015 (n = 10) | |||||||||||||||||||
| Serotype | PXB | AMP | CHL | NA | CIP | SXT | |||||||||||||
| O1 Inaba | 3 | 100% | 0% | 0% | 100% | 0% | 100% | 100% | 0% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 0% | 0% | 0% |
| O1 Ogawa | 7 | 100% | 0% | 0% | 100% | 14% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 0% | 0% | 0% |
| Non-O1/non-O139 | 0 | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / |
| 2016 (n = 18) | |||||||||||||||||||
| Serotype | PXB | AMP | CHL | NA | CIP | SXT | |||||||||||||
| O1 Inaba | 3 | 100% | 0% | 0% | 100% | 0% | 100% | 100% | % | 100% | 100% | 100% | 100% | 100% | 100% | 0% | 0% | 0% | |
| O1 Ogawa | 15 | 100% | 0% | 0% | 100% | 20% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 0% | 0% | 0% |
| Non-O1/non-O139 | 0 | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / |
| 2017 (n = 2) | |||||||||||||||||||
| Serotype | PXB | AMP | CHL | NA | CIP | SXT | |||||||||||||
| O1 Inaba | 2 | 100% | 0% | 0% | 100% | 0% | 100% | 100% | 0% | 100% | 100% | 100% | 100% | 100% | 100% | 100% | 0% | 0% | 0% |
| O1 Ogawa | 0 | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / |
| Non-O1/non-O139 | 0 | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / | / |
PXB: Polymyxin B; AMP: Ampicillin; CHL: Chloramphenicol; CIP: Ciprofloxacin; SXT: Sulfamethoxazole-Trimethoprim. AMR resistance is expressed as the percentage of resistant isolates of V. cholerae. AMR genes are in bold and in italic
Fig 1Phylogeny of seventh pandemic (7PET) V. cholerae O1 isolates associated with cholera outbreaks in DR Congo between 2014 and 2017.
The 7PET V. cholerae O1 biotype El Tor N19691 belonging to wave 1 was used as outgroup. The scale bar represents substitutions per variable site in the core genome. Green, blue, yellow, purple and red isolates represent 7PET wave 3 clades from Central Africa, East Africa, West Africa, Haiti and Asia regions.
Fig 2Geographical location of the sequenced V. cholerae isolates.
Major genetic differences between seven pandemic V. cholerae O1 sub-clades ST69 vs ST515 from eastern DRC.
Only genetic changes impacting proteins are listed in the table.
| Position in the genome | Gene | Nucleic acid change | Sub-lineage | Type | Amino acid change |
|---|---|---|---|---|---|
| I:53510_G/A | VC_0059 (Hypothetical protein) | c.14G>A | 515 | missense_variant | p.Gly5Asp |
| I:83048_C/T | VC_0084 (Conserved hypothetical protein) | c.595C>T | 515 | missense_variant | p.Arg199Cys |
| I:242838_C/T | VC_0238 (Transferase, heptapeptide family) | c.367G>A | 69 | missense_variant | p.Ala123Thr |
| I:262120_ATGTACA/AA | VC_0255 ( | c.24_28del TGTAC | 515 | frameshift_variant | p.Tyr8fs |
| I:893310_G/A | VC_0831 (Toxin-coregulated pilus biosynthesis outer membrane protein C) | c.361G>A | 69 | missense_variant | p.Ala121Thr |
| I:952978_G/T | VC_0894 (Thiamin biosynthesis protein) | c.133G>T | 69 | missense_variant | p.Val45Leu |
| I:1382170_G/A | VC_1301 (Serine transporter) | c.566C>T | 69 | missense_variant | p.Ser189Phe |
| I:1489511_T/C | VC_1398 (Chemotaxis protein CheY) | c.204A>G | 515 | missense_variant | p.Ile68Met |
| I:1712368_A/G | VC_t060 (tRNA-Val) | c.4T>C | 515 | missense_variant | p.Ser2Pro |
| I:1778509_variation of number of repeats of AATCCAGAT motif | VC_1650 (Collagenase) | c.1750_1758del AATCCAGAT | 69 | disruptive_inframe deletion | p.Asp583_Pro585del |
| I:1943737_C/A | VC_1798 (eha protein) | c.721G>T | 515 | stop_gained | p.Glu241 |
| I:2127275_A/G | VC_1975 (2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase/2-oxoglutarate decarboxylase) | c.457T>C | 69 | missense_variant | p.Ser153Pro |
| I:2249832_C/T | VC_2088 (Succinate dehydrogenase, iron-sulfur protein) | c.428G>A | 69 | missense_variant | p.Gly143Asp |
| I:2431057_A/G | VC_2276 (Conserved hypothetical protein) | c.229T>C | 515 | missense_variant | p.Ser77Pro |
| I:2433926_A/G | VC_2279 (Aminoacyl-histidine Dipeptidase) | c.4A>G | 69 | missense_variant | p.Thr2Ala |
| II:189289_C/A | VC_A0172 (Conserved hypothetical protein) | c.894G>T | 69 | missense_variant | p.Trp298Cys |
| II:193789_T/G | VC_A0176 (Methyl accepting chemotaxis protein) | c.956T>G | 69 | missense_variant | p.Ile319Ser |
| II:358345_CTTGTACGTTT/CTTGTACGTTTTGTACGTTT | VC_A0372 (Transposase OrfAB, subunit A) | c.42_43insAAACGTACA | 515 | conservative_inframe insertion | p.Thr14_Lys15insLysArgThr |
| II:819243_C/T | VC_A0866 (Hypothetical protein) | c.70C>T | 69 | missense_variant | p.Pro24Ser |
| II:1021534_G/A | VC_A1071 (Sodium/proline symporter) | c.1237C>T | 515 | missense_variant | p.Pro413Ser |
1. Tyr8fs: frameshift after the 8th amino acid (tyrosine) in the webT protein;
2. Stop codon after the 241st amino acid (glutamate) in the VC_1798 (eha protein).
Fig 3Phylogeny of the five V. cholerae non-O1/non-O139 from eastern DRC and their potential relationship with V. cholerae O1 and V. cholerae non-O1/non-O139 from other regions of the world.