Literature DB >> 32302058

Laboratory testing of SARS-CoV, MERS-CoV, and SARS-CoV-2 (2019-nCoV): Current status, challenges, and countermeasures.

Ying Yan1,2, Le Chang1,2, Lunan Wang1,2,3.   

Abstract

Emerging and reemerging infectious diseases are global public concerns. With the outbreak of unknown pneumonia in Wuhan, China in December 2019, a new coronavirus, SARS-CoV-2 has been attracting tremendous attention. Rapid and accurate laboratory testing of SARS-CoV-2 is essential for early discovery, early reporting, early quarantine, early treatment, and cutting off epidemic transmission. The genome structure, transmission, and pathogenesis of SARS-CoV-2 are basically similar to SARS-CoV and MERS-CoV, the other two beta-CoVs of medical importance. During the SARS-CoV and MERS-CoV epidemics, a variety of molecular and serological diagnostic assays were established and should be referred to for SARS-CoV-2. In this review, by summarizing the articles and guidelines about specimen collection, nucleic acid tests (NAT) and serological tests for SARS-CoV, MERS-CoV, and SARS-CoV-2, several suggestions are put forward to improve the laboratory testing of SARS-CoV-2. In summary, for NAT: collecting stool and blood samples at later periods of illness to improve the positive rate if lower respiratory tract specimens are unavailable; increasing template volume to raise the sensitivity of detection; putting samples in reagents containing guanidine salt to inactivate virus as well as protect RNA; setting proper positive, negative and inhibition controls to ensure high-quality results; simultaneously amplifying human RNase P gene to avoid false-negative results. For antibody test, diverse assays targeting different antigens, and collecting paired samples are needed.
© 2020 John Wiley & Sons, Ltd.

Entities:  

Keywords:  MERS-CoV; SARS-CoV; SARS-CoV-2 (2019-nCoV); nucleic acid testing; serological testing; specimen collection

Mesh:

Substances:

Year:  2020        PMID: 32302058      PMCID: PMC7235496          DOI: 10.1002/rmv.2106

Source DB:  PubMed          Journal:  Rev Med Virol        ISSN: 1052-9276            Impact factor:   6.989


single‐stranded positive‐sense RNA angiotensin converting enzyme 2 Centers for Disease Control and Prevention chemiluminescence assay coronavirus clustered regularly interspaced short palindromic repeats enzyme‐linked immunosorbent assay Food and Drug Administration helicase‐dependent amplification intensive care unit immunofluorescence assay loop‐mediated isothermal amplification limit of detection lower respiratory tract Middle East respiratory syndrome coronavirus nucleic acid sequence‐based amplification nucleic acid tests nasopharyngeal swab nucleocapsid protein oropharyngeal swab point of care testing rolling‐circle amplification RNA‐dependent RNA polymerase isothermal recombinase polymerase amplification real time reverse transcription‐polymerase chain reaction severe acute respiratory syndrome coronavirus SARS‐related‐CoV strand displacement amplification Specific High Sensitivity Enzymatic Reporter UnLOCKing transcription‐mediated amplification upstream of the E protein gene upper respiratory tract untranslated region virus‐like particles western blot World Health Organization

INTRODUCTION

In 2002 and 2003, severe acute respiratory syndrome coronavirus (SARS‐CoV) started in China and overspread in 29 countries worldwide, affecting more than 8000 people. Ten years later, Middle East respiratory syndrome coronavirus (MERS‐CoV) outbroke in Arabian Peninsula and overspread mainly in the Middle East, affecting more than 2000 people. These two outbreaks demonstrated the high transmissibility and pathogenicity of emerging coronaviruses (CoVs). Since late December 2019, pneumonia of unknown cause that started in Wuhan, Hubei, China has been attracting tremendous attention. The pathogen of this unexplained pneumonia was isolated from human airway epithelial cells and identified as a novel CoV, named SARS‐CoV‐2.2, 3 The World Health Organization (WHO) has declared the SARS‐CoV‐2 a public health emergency of international concern on 5 February 2020 and more recently, a pandemic. By 18 March 2020, WHO confirmed a total of 191 127 cases of SARS‐CoV‐2 infection and 7807 deaths worldwide. Among them, 91 845 confirmed cases were distributed in Western Pacific region and 74 760 were in European region. Rapid and accurate diagnosis of the causative viral pathogen is essential for early discovery, early reporting, early quarantine, early treatment, and cutting off epidemic transmission.

OVERVIEW OF CORONAVIRUSES

CoVs are enveloped single‐stranded positive‐sense RNA (+ssRNA) viruses that can infect respiratory, gastrointestinal, hepatic, central nervous systems of humans, other mammals and birds. CoVs belong to the subfamily Coronavirinae in the family Coronaviridae. This subfamily consists of four genera‐alpha, beta, gamma, and delta‐CoVs. Seven CoVs are known to cause respiratory diseases in humans. Among them, Alpha‐CoVs HCoVNL63, HCoV‐229E, and beta‐CoVs HCoV‐OC43, HKU1 can induce mild upper respiratory disease in immunocompetent individuals, while the other three CoVs SARS‐CoV, MERS‐CoV, and SARS‐CoV‐2 belonging to beta‐CoVs are more pathogenic.6, 8 The genome of a typical CoV contains a 5′ untranslated region (UTR), a conserved replicase domain (ORF 1ab), four genes S, E, M, and N to encode structural proteins spike, envelope, membrane, and nucleocapsid proteins, a 3′ UTR, and several unidentified nonstructural ORFs (Figure 1).6, 9
FIGURE 1

Genome structures of SARS‐CoV, MERS‐CoV, and SARS‐CoV‐2. All three CoVs contain a conserved replicase domain (ORF 1ab) (blue). The structural genes (green) S, E, M and N are common features to all CoVs, they encode the structural proteins spike, envelope, membrane, and nucleocapsid, respectively. The accessory genes (orange) are unique to different CoVs

Genome structures of SARS‐CoV, MERS‐CoV, and SARS‐CoV‐2. All three CoVs contain a conserved replicase domain (ORF 1ab) (blue). The structural genes (green) S, E, M and N are common features to all CoVs, they encode the structural proteins spike, envelope, membrane, and nucleocapsid, respectively. The accessory genes (orange) are unique to different CoVs Person‐to‐person spread of SARS‐CoV, MERS‐CoV, and SARS‐CoV‐2 mainly occurs via respiratory droplets produced when an infect person coughs or sneezes. Fever was the most prevalent symptom that occurred in 86% to 97% SARS‐CoV‐2 infected patients, followed by dry cough (59%‐76%), fatigue (34‐68%), and dyspnea (20%‐40%). The median time from first symptom to dyspnea was only 5 days. Apart from acute respiratory syndrome, some other organ dysfunctions, including gastrointestinal symptoms, hepatic dysfunction, splenic atrophy, seizures, and lymphadenopathy have been found in SARS and MERS.13, 14, 15, 16 Since SARS‐CoV‐2 shares the same receptor angiotensin converting enzyme 2 (ACE2) with SARS‐CoV,17, 18 it is reasonable to speculate that these organ dysfunctions may also be found in SARS‐CoV‐2 infected patients. Actually, a retrospective, observational study showed that in 52 critically ill adult patients who were admitted to the intensive care unit (ICU), 15 (29%) had acute kidney injury, 12 (23%) cardiac injury, and 15 (29%) liver dysfunction. The most severe sequelae after rehabilitation from SARS were femoral head necrosis and pulmonary fibrosis. High‐dose steroid pulse treatment was used to suppress inflammation, which caused subchondral osteonecrosis in about 5% of SARS patients. The risk of osteonecrosis was 0.6% for patients receiving less than 3 g and 13% for patients receiving more than 3 g prednisoloneequivalent dose. In addition, the use of high dose of hydrocortisone or methylprednisolone for an extended duration was shown to be a significant risk factor for osteonecrosis. In order to suppress inflammation without causing osteonecrosis in SARS‐CoV‐2 infected patients, Chinese National Health Commission recommended that glucocorticoid should be used in a short period (3‐5 days) as appropriate, and the dose should not exceed 1 to 2 mg/kg/d of methylprednisolone. Moreover, it should be considered that glucocorticoid treatment could delay clearance of viral RNA because of immunosuppression.

Specimens

Appropriate specimen collection and processing is the first and very important step for laboratory diagnosis. Specimen types of patients with respiratory virus infection are diverse. Viral RNA could be detected in upper respiratory tract (URT), lower respiratory tract (LRT), stool, blood, and urine of SARS‐CoV, MERS‐CoV, and SARS‐CoV‐2 infected persons. Among them, URT specimens, as well as available LRT specimens in severely affected patients must be collected for diagnosis and should be tested repeatedly if the first testing is negative in patients with epidemiological history and suspected symptoms of SARS‐CoV‐2 infection. It was reported that SARS‐CoV‐2 RNA could be detected in stool, blood, or urine even if it could not be detected in URT specimens,23, 24 so collecting stool, blood or urine samples if condition permits is helpful to improve positive rate when LRT specimens are unavailable. To demonstrate viral clearance during treatment, samples should also be collected and tested repeatedly. WHO recommended that the frequency of specimen collection should be at least every 2 to 4 days until there are two consecutive negative results in a clinically recovered patient at least 24 hours apart. Also, Chinese National Health Commission and the US Centers for Disease Control and Prevention (CDC) recommended that negative results of real time reverse transcription‐polymerase chain reaction (rRT‐PCR) testing for SARS‐CoV‐2 from at least two sequential respiratory tract specimens collected at least 24 hours apart can be considered to discontinue transmission‐based precautions.25, 26 The quality of specimens can be affected by several steps including operation of specimen collection, transport, and storage. For URT and sputum samples, sample quality depends greatly on the operation of the collectors. Firstly, synthetic fiber swabs with plastic shafts and sterile container were recommended to use when collecting, while calcium alginate swabs or swabs with wooden shafts should not be used as they may contain substances that inactivate viruses and inhibit PCR testing. Secondly, to get enough virus infected cells, swabs must be inserted deep enough. In detail, nasopharyngeal (NP) swab must be inserted through the nares parallel to the palate, and oropharyngeal (OP) swab needs to be inserted into posterior pharynx and tonsillar areas.28, 29 Several studies have reported that combined NP and OP specimens could increase the sensitivity of detecting respiratory viruses.30, 31, 32 As seen in Table 1, although using different RT‐PCR methods targeting different genes, the threshold cycle (CT) value of NP and OP swabs was much lower than NP or OP swab alone, suggesting that in accordance with other respiratory viruses, combining NP and OP swabs together could increase viral load and the sensitivity of SARS‐CoV‐2 RNA detection. Sputum is often confused with saliva. Although SARS‐CoV‐2 could be detected in saliva, sputum is preferred by several guidelines.27, 29, 34 Patients should cough deeply so that sputum rather than oral secretions is collected. Dehydration may lessen the fluid in the lungs and make it hard to produce sputum, hence drinking water before collection can increase availability. To avoid contamination, all types of samples must be transported in sterile containers. To ensure sample stability, storage condition should be strictly controlled, which is summarized with other key points of specimen collection in Table 2.
TABLE 1

Viral kinetics (CT value or log10 copies/mL) of SARS‐CoV‐2 in respiratory specimens

Days of illnessNP swabOP swabNP and OP swabs 46 sputum 46 Saliva 33 Log10 copies/mL
n = 17 110 n = 1 111 n = 17 110 n = 1 111 n = 1n = 1n = 1n = 1n = 12
031265.5
16.4
2214025.056.5
3323428.3327.526.15
43218—203621—226.5
5273532.1522.052.6
63628.2630.994.9
73423–243632—3328.5624.925
83529.6627.362.5
9404030.38ud0
10363933.429.70
113833—343436—4035.0929.962
123737—4039ud32.232.5
133637ud32.63
14403633.2735.43ud32.29
153939ud26.89ud
164040ududud
17394032.61
184040ud
194040
204040udud
213840ud
22udud
23udud
24udud
2536.69ud
26udud

Note: Reference 110 targets N and ORF1b gene, Reference 111 targets N gene. Reference 46 targets RdRp gene and E gene, while only the results of RdRp gene are summarized in this table. Reference 33 targets S gene. Raw data were not published in References 110 and 33, so the CT values and viral loads are estimated from figures. The finding of undetectable in swabs in between CT values of 26.89 and 32.61 might be caused by the poor quality of specimen collected in D16, which was not discussed in the original article. Time indicated in Reference 33 is the time after hospitalization.

Abbreviations: NP swab, nasopharyngeal swab; OP swab, oropharyngeal swab; ud, undetected.

TABLE 2

Key points of specimen collection

Specimen typePurpose of collectionCollection materialsTransport and storageGuarantee of sample stability, and inactivation without influencing NAT testAvoid false negative results of NAT caused by specimen quality
Nasopharyngeal and oropharyngeal swabsCollect for diagnosisSynthetic fiber swabs with plastic shafts, sterile container

1. If could test in 24 hours, store at 4°C. Otherwise store at −70°C

2. Serum could be store at 4°C for 3 days, and stored at ≤−20°C for long‐stem preservation

3. If long‐distance transport is required, use dry ice or other refrigeration methods

4. Avoid repeated freezing and thawing

Virus retention medium containing guanidine salt

1. Set positive, negative, and inhibition control when extraction and amplification

2. Test human RNase P gene simultaneously

SputumCollect for diagnosis if producedSterile container
Bronchoalveolar lavageCollect in severe patients for diagnosisSterile container
Endotracheal aspirate, and nasopharyngeal aspirateSterile container
BloodNAT test for improve diagnosis rate, monitor viremia, epidemiological surveillanceVacuum blood collection tubes with EDTA anticoagulant
SerumCollect 2 samples acute and convalescent for antibody test to monitor seroconversion, epidemiological surveillanceAnticoagulant‐free blood collection vacuum tubes
StoolImprove diagnosis rate when LRT specimens are unavailableSterile container
UrineImprove diagnosis rate when LRT specimens are unavailableSterile container

Note: “Collection materials” and “Transport and storage” reference the guidelines of 2019‐nCoV laboratory testing delivered by WHO and Chinese National Health Commission.29, 34

Abbreviation: LRT, lower respiratory tract.

Viral kinetics (CT value or log10 copies/mL) of SARS‐CoV‐2 in respiratory specimens Note: Reference 110 targets N and ORF1b gene, Reference 111 targets N gene. Reference 46 targets RdRp gene and E gene, while only the results of RdRp gene are summarized in this table. Reference 33 targets S gene. Raw data were not published in References 110 and 33, so the CT values and viral loads are estimated from figures. The finding of undetectable in swabs in between CT values of 26.89 and 32.61 might be caused by the poor quality of specimen collected in D16, which was not discussed in the original article. Time indicated in Reference 33 is the time after hospitalization. Abbreviations: NP swab, nasopharyngeal swab; OP swab, oropharyngeal swab; ud, undetected. Key points of specimen collection 1. If could test in 24 hours, store at 4°C. Otherwise store at −70°C 2. Serum could be store at 4°C for 3 days, and stored at ≤−20°C for long‐stem preservation 3. If long‐distance transport is required, use dry ice or other refrigeration methods 4. Avoid repeated freezing and thawing 1. Set positive, negative, and inhibition control when extraction and amplification 2. Test human RNase P gene simultaneously Note: “Collection materials” and “Transport and storage” reference the guidelines of 2019‐nCoV laboratory testing delivered by WHO and Chinese National Health Commission.29, 34 Abbreviation: LRT, lower respiratory tract. After specimen collection, different methods should be used to process specimens for different purposes. For isolation and culture of virus, centrifuging samples to remove cellular debris, and then inoculating the supernatant on human airway epithelial cells, Vero E6 cells or Huh‐7 cells. It took about 96 hours for SARS‐CoV‐2 to be successfully cultured in human airway epithelial cells, and took about 6 days to be cultured in Vero E6 or Huh‐7 cells.10, 22 The isolation and culture should be conducted at BSL‐3, and laboratory workers should wear protective equipment, including disposable gloves, solid front or wrap‐around gowns, scrub suits, or coveralls with sleeves that fully cover the forearms, head coverings, shoe covers or dedicated shoes, eye protection, and respiratory protection. Inactivation of viruses without reducing detection efficiency is required for testing RNA of high pathogenic CoVs at BSL‐2 and protecting experimenters from infection. Trizol, Trizol LS (Life Technologies), and buffer AVL (Qiagen) have been standard methodology for purifying and extracting viral RNA for years. Guanidine salt in these agents can inhibit nuclease, thereby ensuring viral RNA is not degraded. Viral RNA in samples placed in buffer AVL was stable for at least 48 hours at 32°C, and at least 35 days at either 4°C or −20°C. In addition, the powerful denaturing activity of guanidine isothiocyanate in these reagents could denature and dissolve protein, thus effectively inactivating enveloped viruses. The phenol component of Trizol could also disrupt membranes and denature proteins. These reagents were shown to inactivate alphaviruses, flaviviruses, filoviruses, bunyaviruses, and ebola virus.37, 38, 39 Kumar, et al. confirmed that AVL, Trizol and Trizol LS could completely inactivate MERS‐CoV within 10 minutes' room temperature incubation. Thus, although many methods have been verified to effectively inactivate SARS‐CoV and MERS‐CoV, we suggest handling samples in these reagents, as well as other virus retention reagents containing guanidine salt would be an effective way to inactivate and stabilize viruses, without affecting subsequent molecular testing of SARS‐CoV‐2. Since CoVs are sensitive to heat, heating inactivation of samples could effectively inactive virus if SARS‐CoV‐2 antibody needs to be tested at BSL‐2. However, it should be noticed that heat inactivation could significantly interfere with the levels of antibodies, and might cause falsenegative results. It was reported that the anti‐SARS‐CoV‐2 IgM levels of all samples decreased by an average level of 53.56%, and the IgG levels were decreased in 64.71% samples by an average level of 49.54% after heating at 56°C for 30 minutes. It has been reported that viral loads of SARS‐CoV and MERS‐CoV in respiratory specimens always peak in the second week after symptom onset, and viral loads in LRT specimens were higher than in URT specimens.43, 44, 45 As seen in Table 3, positive rate of SARS‐CoV and MERS‐CoV RNA in LRT specimens was about 100% at the first 2 weeks of illness, while it remained relatively lower in URT specimens. So that LRT specimens are preferred to test if available. Now, several studies have shown the viral kinetics of SARS‐CoV‐2 in respiratory specimens. Zhang, et al. reported that only 50% of OP swabs were positive with a CT value of 32.1 (30.9‐32.75) at first sampling after symptom, while after 5 days, only 25% of oral swabs were positive with a CT value of 26.95 (25.98‐27.75). As seen in Tables 1 and 3, differently to SARS‐CoV and MERS‐CoV, SARS‐CoV‐2 viral loads in respiratory specimens often peak in the first week of illness and decrease thereafter.
TABLE 3

Viral kinetics of SARS‐CoV, MERS‐CoV, and SARS‐CoV‐2

Sample typeTime of illnessSARS‐CoVMERS‐CoVSARS‐CoV‐2
URTWeek 132%, 5.36 43 ; 58%, 4.18 44 ; 39% 44 75.5%, 4.5 51 ; 25%, 5 45 ; 33.3%, 5 45 5.3 52 ; 31.5 CT 110 ; 36 CT 110 50%, 32.1 CT 23 ; 100%, 30.5 CT 112
Week 268%, 7.28 43 ; 60%, 5.25 44 ; 32% 44 ; 42.3%, 5.8 49 45.8%, 3.5 51 ; 88.2%, 5.5 45 ; 23.5%, 4.5 45 3.8 52 ; 37 CT 110 ; 38 CT 110 ; 25%, 31.65 CT 23 ; 94.4%, 31.95 CT 112
Week 34.99 43 ; 39%, 4.77 44 ; 25% 44 0 51 ; 27.3%, 4.5 45 ; 5.88%, 5.5 45 40 CT 110 ; 38 CT 110 ; 69.2%, 33.05 CT 112
LRTWeek 1100% 44 100%, 8 51 ; 100%, 6 45 6.1 52
Week 2100% 44 93%, 7 51 ; 100%, 6.8 45 5.8 52
Week 367% 44 66.7%, 5 51 ; 100%, 6.3 45 N/A
StoolWeek 147%, 6.52 44 16.7%, 4.5 51 25%, 31.65 CT 23 ; 75%, 28.2 CT 112 53%, 2.74‐5.08 52
Week 297% 43 ; 70%, 7.95 44 ; 87.2%, 7.0 49 14.3%, 4 51 37.5%, 26.5 CT 23 ; 42.9%, 30.3 CT 112
Week 354%, 5.33 44 0 51 N/A
BloodWeek 133% 44 ; 50%, 2.37 53 48.1%, 4 51 ; 10%, 4.8 45 0 112 40% 23
Week 225% 44 ; 50%, 2.59 53 41.5%, 2.7 49 25%, 3 51 ; 29.4%, 4.2 45 25%, 33.15 CT 112
Week 333% 44 ; 25%, 2.18 53 0 51 ; 17.6%, 4.7 45 N/A
UrineWeek 133% 44 9%, 2 51 0 112 ; 6.9% 24
Week 225% 44 28.8%, 4.4 49 0 51
Week 314% 44 0 51

Note: Data are expressed as “positive rate, viral load (log10 copies/mL or CT value),” which are converted directly from raw data or estimated from figures. Respiratory sample type:①NP aspirates, ②Other URT specimens consisted of throat and nasal swabs, throat swabs, nasopharyngeal swabs, and nasal swabs, ③throat swabs, ④sputum or tracheal aspirate, ⑤nasopharyngeal swabs, ⑥Sputum. Time indicated in References 51 and 23 is the time of diagnosis, NOT the time of illness.

Viral kinetics of SARS‐CoV, MERS‐CoV, and SARS‐CoV‐2 Note: Data are expressed as “positive rate, viral load (log10 copies/mL or CT value),” which are converted directly from raw data or estimated from figures. Respiratory sample type:①NP aspirates, ②Other URT specimens consisted of throat and nasal swabs, throat swabs, nasopharyngeal swabs, and nasal swabs, ③throat swabs, ④sputum or tracheal aspirate, ⑤nasopharyngeal swabs, ⑥Sputum. Time indicated in References 51 and 23 is the time of diagnosis, NOT the time of illness. Evidence showed that viral RNA could be detected in blood and feces,33, 46 raising the possibilities of blood transmission and oral‐fecal transmission. A study of 2134 SARS‐CoV infected specimens showed that the rate of viral shedding in feces was low in the first 5 days of illness (up to 28%), but rose gradually to peak at around 70% at 9 to 14 days with very high titers, even higher than in nasopharyngeal aspirates. Other studies also showed that the positive rate for stool specimens peaked at Weeks 2 and 3, with a higher diagnostic yield than pooled throat and nasal swabs, and nasopharyngeal aspirate specimens.47, 48, 49 MERS‐CoV was detectable in stools in the second week after illness. Different from SARS‐CoV, only 14.6% of stool samples yielded viral RNA. Recently, viral RNA of SARS‐CoV‐2 was reported in stools, and the virus was isolated. The kinetics of viral loads in stools are still not very clear. Data showed that SARS‐CoV‐2 RNA can be detected in stools of 53% (9/17) confirmed cases at the first 2 weeks of illness, with viral loads ranging from 550 to 1.21 × 105 copies/ml. Another study showed that 25% SARS‐CoV‐2 infected patients had detectable viral RNA with a CT value of 31.65 (27.53‐33.23) in anal swabs at first sampling, while 5 days later, 37.5% patients could test viral RNA positive in anal swabs with a CT value of 26.5 (24.22‐29.38). More importantly, SARS‐CoV‐2 RNA can be found in anal swabs even if it cannot be detected in oral swabs. Thus, it might be an optional way to improve the diagnosis rate of SARS‐CoV‐2 infection by testing stool samples when LRT specimens are unavailable. Blood samples can be collected for both nucleic acid testing and serological testing. Testing of virus from blood samples could be an effective way to monitor viremia. SARS‐CoV RNA was detected in 50% of plasma and 78% of serum samples during the first week of illness. High‐SARS‐CoV viral load in serum correlated with oxygen desaturation, mechanical ventilation, and death. About 33% of serum samples yielded MERS‐CoV RNA at initial diagnosis, and were associated with a worse clinical course.51, 54 Patients with detectable SARS‐CoV‐2 RNA in the blood progressed to severe symptom stage, indicating a strong correlation of serum viral RNA with the disease severity. In keeping with SARS‐CoV and MERS‐CoV,53, 56 plasma/serum SARS‐CoV‐2 quantification could also represent a potentially useful early diagnostic and prognostic tool.

Nucleic acid tests

Specific primers and standard operating procedures for nucleic acid tests (NAT) could be established as soon as the complete genome of the virus was sequenced, making NAT the optimal method for diagnosis. Current NAT tests for RNA viruses mainly include RT‐PCR, alternative isothermal amplification methods, and CRISPR‐Cas13a based Specific High Sensitivity Enzymatic Reporter UnLOCKing (SHERLOCK) system. Due to its simplicity, easy methodology and extensively validated standard operating procedure, RT‐PCR is now the preferred and most widely used method for NAT. RT‐PCR assays targeting ORF 1a, ORF 1b, S gene, N gene of SARS‐CoV can detect <10 genome equivalents.58, 59 Assays targeting M gene and 3′UTR also showed high sensitivity.60, 61 Three rRT‐PCR assays for routine detection of MERS‐CoV have been developed and recommended by WHO. The primers target upstream of the E protein gene (upE), the ORF 1b, and the ORF 1a. Among them, sensitivity for upE target was 3.4 copies per reaction or 291 copies/mL of sample, which was considered highly sensitive and recommended for screening. The ORF 1a assay was considered of equal sensitivity with the upE assay, while the ORF 1b assay was considered less sensitive than the ORF 1a assay.63, 64 An alternative approach involved in two rRT‐PCR assays targeting the MERS‐CoV N gene with a sensitivity of ≤10 copies/reaction, which can complement upE and ORF 1a assays for screening and confirmation has also been published and authorized for emergency use as an in vitro diagnostic test for MERS‐CoV by the US Food and Drug Administration (FDA). Several commercial and in‐house assays that detect SARS‐CoV‐2 RNA have been developed. Chu, et al reported two one‐step quantitative rRT‐PCR assays targeting ORF1b and N gene that could detect SARS‐CoV‐2 < 10 copies/reaction, while the N gene assay was about 10 times more sensitive than the ORF1b gene assay in detecting positive clinical specimens. It might be possible that clinical samples contain infected cells expressing subgenomic mRNA, resulting in more N gene copies. Corman, et al. developed assays targeting E gene and RNA‐dependent RNA polymerase (RdRp) gene that obtained best sensitivity with limit of detection (LOD) of 5.2 and 3.8 copies/reaction, respectively, while N gene assay was slightly less sensitive. Furthermore, when using other basic RT‐PCR reagents (Taqman Fast Virus 1‐step Master Mix), another lab obtained the sensitivity of 3.2 copies/reaction for E gene assay and 3.7 copies/reaction for RdRp gene assay. Some groups from different countries shared their protocols of in‐house developed molecular assays. In summary, Chinese CDC recommended primers and probes targeting ORF1ab and N gene. In Germany, Charité recommended E gene assay as first line screening assay with technical LOD of 5.2 copies/reaction, and RdRp gene assay as confirmatory assay with technical LOD of 3.8 copies/reaction. Scientists from Hong Kong University recommended the N gene RT‐PCR as a screening assay and the ORF1b assay as a confirmatory one. Ministry of Public Health of Thailand recommended assay targeting N gene. National Institute of Infectious Diseases of Japan recommended nested RT‐PCR assay targeting ORF1a and S gene, as well as RT‐PCR targeting N gene. The US CDC has developed assays including three pairs of primers targeting the N gene of SARS‐CoV‐2, and authorized emergency use by the US FDA. Details of these assays are summarized in Table 4. Most of the in‐house assays, as well as commercial kits are designed to detect two or three regions of SARS‐CoV‐2 genome. The different regions are amplified at the same time. Chinese National Health Commission recommended that both ORF1ab and N should be tested positive for a positive result. If only one region is positive, the result needs to be re‐tested. The US CDC recommended that all the N region targets should be detectable for a positive result, or be undetectable for a negative result. If only one target is positive, the result is inconclusive and need to be re‐tested. So, it is important that all the two or three regions tested should be positive to identify a positive case.
TABLE 4

In‐house assays for detecting SARS‐CoV‐2

CountryInstituteGene targetPrimers and probesSensitivity
ChinaChina CDCORF1abF: CCCTGTGGGTTTTACACTTAAN/A
R: ACGATTGTGCATCAGCTGA
P:FAM‐CCGTCTGCGGTATGTGGAAAGGTTATGG‐BHQ1
NF:GGGGAACTTCTCCTGCTAGAAT
R: CAGACATTTTGCTCTCAAGCTG
P: FAM‐TTGCTGCTGCTTGACAGATT‐TAMRA
GermanyCharitéEF:ACAGGTACGTTAATAGTTAATAGCGT5.2 copies/reaction screening assay
R:ATATTGCAGCAGTACGCACACA
P:FAM‐ACACTAGCCATCCTTACTGCGCTTCG‐BBQ
RdRpF:GTGARATGGTCATGTGTGGCGG3.8 copies/reaction confirmatory assay
R:CARATGTTAAASACACTATTAGCATA
P2:FAM‐CAGGTGGAACCTCATCAGGAGATGC‐BBQ
P1:FAM‐CCAGGTGGWACRTCATCMGGTGATGC‐BBQ
ChinaHKUNF: TAATCAGACAAGGAACTGATTA2−4‐2000 TCID50/reaction screening assay
R: CGAAGGTGTGACTTCCATG
P: FAM‐GCAAATTGTGCAATTTGCGG‐TAMRA
ORF1bF: TGGGGYTTTACRGGTAACCT2−4‐2000 TCID50/reaction confirmatory assay
R: AACRCGCTTAACAAAGCACTC
P:FAM‐TAGTTGTGATGCWATCATGACTAG‐TAMRA
JapanNational Institute of Infectious DiseasesORF1a1st‐F:TTCGGATGCTCGAACTGCACCNested RT‐PCR
1st‐R:CTTTACCAGCACGTGCTAGAAGG
2nd‐F:CTCGAACTGCACCTCATGG
2nd‐R:CAGAAGTTGTTATCGACATAGC
Seq‐F:ACCTCATGGTCATGTTATGG
Seq‐R:GACATAGCGAGTGTATGCC
S1st‐F:TTGGCAAAATTCAAGACTCACTTT
1st‐R:TGTGGTTCATAAAAATTCCTTTGTG
2nd‐F:CTCAAGACTCACTTTCTTCCAC
2nd‐R:ATTTGAAACAAAGACACCTTCAC
Seq‐F:AAGACTCACTTTCTTCCACAG
Seq‐R:CAAAGACACCTTCACGAGG
NF:AAATTTTGGGGACCAGGAAC

Five copies/reaction

Real‐time RT‐PCR

R:TGGCAGCTGTGTAGGTCAAC
P:FAM‐ATGTCGCGCATTGGCATGGA‐BHQ
ThailandNational Institute of HealthNF:CGTTTGGTGGACCCTCAGATN/A
R:CCCCACTGCGTTCTCCATT
P:FAM‐CAACTGGCAGTAACCA‐BQH1
United StatesUS CDCN1F:GACCCCAAAATCAGCGAAATN/A
R:TCTGGTTACTGCCAGTTGAATCTG
P:FAM‐ACCCCGCATTACGTTTGGTGGACC‐BHQ1
N2F:TTACAAACATTGGCCGCAAA
R:GCGCGACATTCCGAAGAA
P:FAM‐ACAATTTGCCCCCAGCGCTTCAG‐BHQ1
N3F:GGGAGCCTTGAATACACCAAAA
R:TGTAGCACGATTGCAGCATTG
P:FAM‐AYCACATTGGCACCCGCAATCCTG‐BHQ1

Abbreviations: N/A, Not applicable; RT‐PCR, reverse transcription‐polymerase chain reaction.

In‐house assays for detecting SARS‐CoV‐2 Five copies/reaction Real‐time RT‐PCR Abbreviations: N/A, Not applicable; RT‐PCR, reverse transcription‐polymerase chain reaction. RT‐PCR relies on sophisticated equipment that it may not be present in resource‐limited regions. These limitations gave birth to alternative isothermal amplification methods, such as transcription‐mediated amplification (TMA), nucleic acid sequence‐based amplification (NASBA), strand displacement amplification (SDA), loop‐mediated isothermal amplification (LAMP), helicase‐dependent amplification (HDA), isothermal recombinase polymerase amplification (RPA), and rolling‐circle amplification (RCA).75, 76, 77, 78, 79, 80 These alternative isothermal amplification methods are simple, rapid, specific and sensitive which only need a heating block or water bath capable of maintaining a constant temperature.81, 82 Chantratita, et al developed a real time NASBA assay that could detect as little as one copy/reaction of SARS‐CoV RNA. Compared to RT‐PCR, a RT‐LAMP assay of SARS‐CoV showed 100‐fold‐greater sensitivity, with a detection limit of 0.01 PFU. In another study, detection rate of the RT‐LAMP assay was lower than the RT‐PCR assay for samples isolated from patients within the first 3 days of disease onset, and was similar to RT‐PCR when detecting specimens sampled from patients with more than 3 days of illness. A RT‐RCA assay for SARS‐CoV could detect as few as five copies of SARS viral genome. For MERS‐CoV, a RT‐RPA method targeting the N gene could detect virus RNA with a sensitivity of 10 copies/reaction. In addition, the run time of the RT‐RPA was between 3 and 7 minutes for 107 and 10 molecules, respectively. Several RT‐LAMP methods have also been developed for MERS‐CoV detection with a high sensitivity.88, 89, 90, 91, 92, 93 Further alternative isothermal amplification methods for detecting SARS‐CoV‐2 genome need to be established, and would show potential applicability for point of care testing (POCT) in resource‐limited areas. In 2002, Jansen et al. firstly discovered clustered regularly interspaced short palindromic repeats (CRISPR) system. In 2003, it was confirmed for the first time that CRISPR‐Cas9 can be used to edit human genes. In 2017, combining RPA and CRISPR‐Cas13a, SHERLOCK system was developed for NAT. SHERLOCK detected viral particles down to 2 aM, and could discriminate between similar viral strains. Recently, a protocol for detection of SARS‐CoV‐2 using SHERLOCK system has been published. This method can detect SARS‐CoV‐2 in a range between 20 and 200 aM (10‐100 copies per microliter of input) within an hour. However, this method has not yet been validated with real patient samples, so it should not be used for clinical purposes now. Although many RT‐PCR assays for the SARS‐CoV‐2 have been developed, NAT positive cases only account for about 50% of clinically confirmed cases. To raise the positive rate of NAT, standard collection, strict storage and transportation conditions, proper extraction and amplification procedures are needed. To increase test sensitivity, increasing the template volume and total reagent volume for a single run would be very useful. To improve test specificity, amplifying a second genome region for confirmation is suggested. Most importantly, appropriate controls should be established to ensure the results are reliable. For SARS‐CoV, which are also suitable for other viruses, WHO recommended one negative control and one positive control for extraction, one water control and one positive control for a PCR run, and the patient sample spiked with a weak positive control to detect PCR inhibitory substances (inhibition control). Except for these external controls, internal controls, including plasmid DNA, virus‐like particles (VLPs), RNase P gene, and housekeeping genes of airway epithelial cells such as beta‐actin have been used for NAT of respiratory viruses including SARS‐CoV‐2. Of all these kinds of internal controls, only RNase P presents in all types of SARS‐CoV‐2 infected samples and can control the quality of all procedures, from sample collection to amplification (Table 5). Thus, we recommend RNase P as internal control when amplifying SARS‐CoV‐2 RNA.
TABLE 5

Internal control of nucleic acid test

Internal control typeNucleic acid typePreparationRisk of contaminating sample RNASample collection controlExtraction controlReverse transcription controlAmplification controlInhibition controlCompetent or non‐competent control
RNase PRNAEasyNo×
Housekeeping gene of airway epithelial cellsmRNAEasyNo×
Only applicable to respiratory specimens
Plasmid DNADNAComplexHigh×××
Virus‐like particlesRNAMore complexHigh×
Internal control of nucleic acid test

Serological tests

Serological testing may be conducted for diagnosis in rare situations where NAT is not possible, for investigation of an ongoing outbreak, or for serological surveys, including to retrospectively assess the extent of an outbreak. Although antibody seroconversion provides reliable proof of infection, serological testing lags behind the detection of viral genome by molecular testing, making it not suitable for early diagnosis. In SARS, higher neutralizing antibody response was associated with a longer illness. In most MERS patients, the levels of IgG and neutralizing antibodies were weekly and inversely correlated with LRT viral loads. In addition, an early MERS‐CoV antibody response was associated with reduced disease severity. Thus, testing antibody is helpful for surveillance, prediction of disease outcome and epidemiological investigation, but not for early diagnosis. A variety of serological assays were established for detecting SARS‐CoV and MERS‐CoV, mainly including enzyme‐linked immunosorbent assay (ELISA), chemiluminescence assay (CLIA), immunofluorescence assay (IFA), western blot (WB), protein microarray, and neutralization. Of these methods, ELISA and CLIA are suitable for first line screening because of the large throughput, short processing time, and simple operating procedure, while neutralization assay is used as the gold standard for confirmation in many laboratories. The basic issue in serological assays is the source of antigen. Once virus has been isolated from patients, cell lysate or supernatant of virus infected cells could be used for serological assays. These methods are most convenient and rapid, as they only need susceptible cell cultures and virus. However, they need to be performed in BSL‐3, and proper inactivation of the virus without reducing immunogenicity of antigens is required, thus limiting the widespread use of virus‐based serological testing. Furthermore, cross reaction is likely to happen because of the conserved sequence and structure between CoVs. By cloning immunogenic viral genes into prokaryotic or eukaryotic expression plasmids, transfecting the plasmids into bacterial or mammalian cells and purifying proteins, recombinant antigens can be developed to overcome the disadvantages of virus infected cells. Recombinant antigens are safe and do not require BSL‐3 containment. Importantly, although taking longer time and more steps for development, recombinant antigen based assays enable the selection of immunogenic and virus specific antigens to maximize both specificity and sensitivity, and more suitable for standardization. In SARS‐CoV and MERS‐CoV, N and S protein are the major immunogenic proteins and the first choice for producing recombinant antigens. Antibodies to proteins S, 3a, N, and 9b were detected in the sera from convalescent‐phase SARS patients. Among them, anti‐S and anti‐N were dominant and could persist in the sera of SARS patients until week 30, while only anti‐S3 showed significant neutralizing activity. Anti‐N appeared earlier than anti‐S, indicating that S protein‐based assays may be preferable for use with convalescent sera.102, 103 Sera tend to react against both antigens with higher sensitivity. Cross reaction also happened in assays using recombinant antigens. Moderate cross‐reactivity between SARS‐CoV and porcine CoVs was mediated through amino acids 120 to 208 of the N protein. Bioinformatics analysis demonstrated a significant B‐cell epitope overlapping the heptad repeat‐2 region of S protein of SARS‐CoV and HCoVEMC, which is known to harbor an epitope for broadly neutralizing antibody in the case of SARS‐CoV. As a result, convalescent SARS sera cross reacted with HCoVEMC. Thus, for SARS‐CoV‐2, specific recombinant antigens are required. Also, testing antibodies with different assays targeting different regions of antigens could avoid false‐positive results produced by cross reaction. WHO declared that positive antibody test results indicated a previous infection with SARS‐CoV. Seroconversion from negative to positive or a 4‐fold rise in antibody titer from acute to convalescent serum indicated recent infection. No detection of antibody after 21 days from onset of illness seemed to indicate that no infection with SARS‐CoV took place. For MERS‐CoV, the US CDC recommended ELISA as a screening test and microneutralization as a confirmatory test for MERS‐CoV antibodies. Where a patient has evidence of seroconversion in at least one screening assay and confirmation by a neutralization assay in samples ideally taken at least 14 days apart, this patient can be considered a confirmed case. A 4‐fold increase in MERS‐CoV antibody titer by neutralization tests in acute and convalescent serum samples performed in parallel is needed for confirmation. For conducting serology of SARS‐CoV‐2, or broad CoV serology on paired samples (in the acute and convalescent phase), WHO recommended that the first serum sample should be collected in week 1 of illness and the second collected 3 to 4 weeks later, collecting at least 3 weeks after onset of symptoms if only a single serum sample can be collected. In SARS, IgG seroconversion was documented in 93% patients at mean of 20 days. Positive antibody, neutralizing antibody titer of most patients was shown to peak between Weeks 5 and 8 after onset and to decline with a half‐life of 6.4 weeks. In most MERS patients, robust antibody responses developed by the third week of illness, and were delayed further in severely ill patients requiring mechanical ventilation.51, 98 An IgG and IgM ELISA test which used bat SARS‐related‐CoV (SARSr‐CoV) Rp3 nucleocapsid protein (NP) as antigen was developed previously. This SARSr‐CoV NP is 92% identical to SARS‐CoV‐2 NP, thus this assay was used for serological testing of SARS‐CoV‐2. Both IgM and IgG titres were relatively low or undetectable in first sampling (not first day of illness). On Day 5, an increase of viral antibodies can be seen in nearly all patients. IgM positive rate increased from 50% to 81%, whereas IgG positive rate increase from 81% to 100%. This is in contrast to a relatively low detection positive rate from molecular test. Based on this result, serological testing might improve the detection positive rate. However, the clinical records of patients involved in this study were not available. Although the target patients were those who received around 10 days of medical treatments upon admission, it is not sure on which days of illness the high positive rate of IgG and IgM occurred. Diverse assays and more evidence are needed to confirm the IgG and IgM kinetics of SARS‐CoV‐2.

CONCLUSION

With the progress of global integration, emerging and reemerging infectious diseases are becoming easier to transmit all over the world. The very important and first key to respond to outbreaks is early discovery. Laboratory testing plays the major role in early detection of infected persons, enabling recognition of the infection source and cutting off the transmission route. The results of laboratory testing are affected by various factors. To improve NAT capacity of SARS‐CoV‐2 RNA, we summarized the literature and guidelines and suggested that: (a) If LRT specimens are unavailable, collect stool and blood samples at later period of illness to improve the positive rate of NAT. (b) Increase template volume to raise the sensitivity of detection. (c) Put samples in reagents containing guanidine salt such as TRIZOL, TRIZOL LS, or AVL buffer to inactivate virus as well as protect RNA. (d) Set proper positive, negative and inhibition controls for extraction and amplification to ensure quality results. (e) Simultaneously amplify human RNase P gene as internal control to avoid falsenegative results. At the time of writing this review, serological evidence of SARS‐CoV‐2 is still poor. Diverse assays targeting different antigens are needed. Also, collecting paired samples would help to monitor the kinetics and positive rates of serological testing in different periods of diseases.

CONFLICT OF INTEREST

All authors have no conflict interest to disclose.
  90 in total

1.  Loop-mediated isothermal amplification of DNA.

Authors:  T Notomi; H Okayama; H Masubuchi; T Yonekawa; K Watanabe; N Amino; T Hase
Journal:  Nucleic Acids Res       Date:  2000-06-15       Impact factor: 16.971

2.  Detection of SARS coronavirus in plasma by real-time RT-PCR.

Authors:  Paul R Grant; Jeremy A Garson; Richard S Tedder; Paul K S Chan; John S Tam; Joseph J Y Sung
Journal:  N Engl J Med       Date:  2003-12-18       Impact factor: 91.245

3.  Nucleic acid detection with CRISPR-Cas13a/C2c2.

Authors:  Jonathan S Gootenberg; Omar O Abudayyeh; Jeong Wook Lee; Patrick Essletzbichler; Aaron J Dy; Julia Joung; Vanessa Verdine; Nina Donghia; Nichole M Daringer; Catherine A Freije; Cameron Myhrvold; Roby P Bhattacharyya; Jonathan Livny; Aviv Regev; Eugene V Koonin; Deborah T Hung; Pardis C Sabeti; James J Collins; Feng Zhang
Journal:  Science       Date:  2017-04-13       Impact factor: 47.728

4.  A combination of naso- and oropharyngeal swabs improves the diagnostic yield of respiratory viruses in adult emergency department patients.

Authors:  Peter Ek; Blenda Böttiger; Disa Dahlman; Karin B Hansen; Mattias Nyman; Anna C Nilsson
Journal:  Infect Dis (Lond)       Date:  2019-02-14

5.  Viral Load Kinetics of MERS Coronavirus Infection.

Authors:  Myoung-Don Oh; Wan Beom Park; Pyoeng Gyun Choe; Su-Jin Choi; Jong-Il Kim; Jeesoo Chae; Sung Sup Park; Eui-Chong Kim; Hong Sang Oh; Eun Jung Kim; Eun Young Nam; Sun Hee Na; Dong Ki Kim; Sang-Min Lee; Kyoung-Ho Song; Ji Hwan Bang; Eu Suk Kim; Hong Bin Kim; Sang Won Park; Nam Joong Kim
Journal:  N Engl J Med       Date:  2016-09-29       Impact factor: 91.245

6.  Molecular Diagnosis of a Novel Coronavirus (2019-nCoV) Causing an Outbreak of Pneumonia.

Authors:  Daniel K W Chu; Yang Pan; Samuel M S Cheng; Kenrie P Y Hui; Pavithra Krishnan; Yingzhi Liu; Daisy Y M Ng; Carrie K C Wan; Peng Yang; Quanyi Wang; Malik Peiris; Leo L M Poon
Journal:  Clin Chem       Date:  2020-04-01       Impact factor: 8.327

7.  Viral loads in clinical specimens and SARS manifestations.

Authors:  I F N Hung; V C C Cheng; A K L Wu; B S F Tang; K H Chan; C M Chu; M M L Wong; W T Hui; L L M Poon; D M W Tse; K S Chan; P C Y Woo; S K P Lau; J S M Peiris; K Y Yuen
Journal:  Emerg Infect Dis       Date:  2004-09       Impact factor: 6.883

8.  Development and Testing of a Method for Validating Chemical Inactivation of Ebola Virus.

Authors:  Kendra J Alfson; Anthony Griffiths
Journal:  Viruses       Date:  2018-03-13       Impact factor: 5.048

9.  Clinical features and virological analysis of a case of Middle East respiratory syndrome coronavirus infection.

Authors:  Christian Drosten; Michael Seilmaier; Victor M Corman; Wulf Hartmann; Gregor Scheible; Stefan Sack; Wolfgang Guggemos; Rene Kallies; Doreen Muth; Sandra Junglen; Marcel A Müller; Walter Haas; Hana Guberina; Tim Röhnisch; Monika Schmid-Wendtner; Souhaib Aldabbagh; Ulf Dittmer; Hermann Gold; Petra Graf; Frank Bonin; Andrew Rambaut; Clemens-Martin Wendtner
Journal:  Lancet Infect Dis       Date:  2013-06-17       Impact factor: 25.071

10.  Clinical progression and viral load in a community outbreak of coronavirus-associated SARS pneumonia: a prospective study.

Authors:  J S M Peiris; C M Chu; V C C Cheng; K S Chan; I F N Hung; L L M Poon; K I Law; B S F Tang; T Y W Hon; C S Chan; K H Chan; J S C Ng; B J Zheng; W L Ng; R W M Lai; Y Guan; K Y Yuen
Journal:  Lancet       Date:  2003-05-24       Impact factor: 79.321

View more
  88 in total

Review 1.  Antibody tests for COVID-19.

Authors:  Jonathan Kopel; Hemant Goyal; Abhilash Perisetti
Journal:  Proc (Bayl Univ Med Cent)       Date:  2020-10-13

2.  ARIMA models for predicting the end of COVID-19 pandemic and the risk of second rebound.

Authors:  Zohair Malki; El-Sayed Atlam; Ashraf Ewis; Guesh Dagnew; Ahmad Reda Alzighaibi; Ghada ELmarhomy; Mostafa A Elhosseini; Aboul Ella Hassanien; Ibrahim Gad
Journal:  Neural Comput Appl       Date:  2020-10-23       Impact factor: 5.606

3.  Structure-Based Design with Tag-Based Purification and In-Process Biotinylation Enable Streamlined Development of SARS-CoV-2 Spike Molecular Probes.

Authors:  Tongqing Zhou; I-Ting Teng; Adam S Olia; Gabriele Cerutti; Jason Gorman; Alexandra Nazzari; Wei Shi; Yaroslav Tsybovsky; Lingshu Wang; Shuishu Wang; Baoshan Zhang; Yi Zhang; Phinikoula S Katsamba; Yuliya Petrova; Bailey B Banach; Ahmed S Fahad; Lihong Liu; Sheila N Lopez Acevedo; Bharat Madan; Matheus Olivera de Souza; Xiaoli Pan; Pengfei Wang; Jacy R Wolfe; Michael Yin; David D Ho; Emily Phung; Anthony DiPiazza; Lauren Chang; Olubukula Abiona; Kizzmekia S Corbett; Brandon J DeKosky; Barney S Graham; John R Mascola; John Misasi; Tracy Ruckwardt; Nancy J Sullivan; Lawrence Shapiro; Peter D Kwong
Journal:  SSRN       Date:  2020-07-21

4.  In Search of the SARS-CoV-2 Protection Correlate: Head-to-Head Comparison of Two Quantitative S1 Assays in Pre-characterized Oligo-/Asymptomatic Patients.

Authors:  Raquel Rubio-Acero; Noemi Castelletti; Volker Fingerle; Laura Olbrich; Abhishek Bakuli; Roman Wölfel; Philipp Girl; Katharina Müller; Simon Jochum; Matthias Strobl; Michael Hoelscher; Andreas Wieser
Journal:  Infect Dis Ther       Date:  2021-06-16

Review 5.  Monitoring Symptoms of Infectious Diseases: Perspectives for Printed Wearable Sensors.

Authors:  Ala'aldeen Al-Halhouli; Ahmed Albagdady; Ja'far Alawadi; Mahmoud Abu Abeeleh
Journal:  Micromachines (Basel)       Date:  2021-05-27       Impact factor: 2.891

6.  Detection of anti-SARS-CoV-2 antibodies in dried blood spots utilizing manual or automated spot extraction and electrochemiluminescence immunoassay (ECLIA).

Authors:  Andre Knoop; Hans Geyer; Oliver Lerch; Ana Rubio; Yvonne Schrader; Mario Thevis
Journal:  Anal Sci Adv       Date:  2021-03-26

7.  SARS-CoV-2 detection by a clinical diagnostic RT-LAMP assay.

Authors:  Michael D Buck; Enzo Z Poirier; Ana Cardoso; Bruno Frederico; Johnathan Canton; Sam Barrell; Rupert Beale; Richard Byrne; Simon Caidan; Margaret Crawford; Laura Cubitt; Sonia Gandhi; Robert Goldstone; Paul R Grant; Kiran Gulati; Steve Hindmarsh; Michael Howell; Michael Hubank; Rachael Instrell; Ming Jiang; George Kassiotis; Wei-Ting Lu; James I MacRae; Iana Martini; Davin Miller; David Moore; Eleni Nastouli; Jerome Nicod; Luke Nightingale; Jessica Olsen; Amin Oomatia; Nicola O'Reilly; Anett Rideg; Ok-Ryul Song; Amy Strange; Charles Swanton; Samra Turajlic; Mary Wu; Caetano Reis e Sousa
Journal:  Wellcome Open Res       Date:  2021-05-21

Review 8.  Transboundary Animal Diseases, an Overview of 17 Diseases with Potential for Global Spread and Serious Consequences.

Authors:  Elizabeth A Clemmons; Kendra J Alfson; John W Dutton
Journal:  Animals (Basel)       Date:  2021-07-08       Impact factor: 2.752

9.  Evolutionary insights into the furin cleavage sites of SARS-CoV-2 variants from humans and animals.

Authors:  Abdou Nagy; Shereen Basiouni; Rokshana Parvin; Hafez M Hafez; Awad A Shehata
Journal:  Arch Virol       Date:  2021-07-13       Impact factor: 2.574

Review 10.  Analytical Performance of COVID-19 Detection Methods (RT-PCR): Scientific and Societal Concerns.

Authors:  Roberto Verna; Walter Alallon; Masami Murakami; Catherine P M Hayward; Abdel Halim Harrath; Saleh H Alwasel; Nairo M Sumita; Ozkan Alatas; Valeria Fedeli; Praveen Sharma; Andrea Fuso; Daniela Maria Capuano; Maria Capalbo; Antonio Angeloni; Mariano Bizzarri
Journal:  Life (Basel)       Date:  2021-07-06
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.