Identification and expression analysis of miRNAs and elucidation of their role in salt tolerance in rice varieties susceptible and tolerant to salinity.

Soil salinization is a serious problem for cultivation of rice, as among cereals rice is the most salt sensitive crop, and more than 40% of the total agricultural land amounting to approximately 80 million ha the world over is salt affected. Salinity affects a plant in a varieties of ways, including ion toxicity, osmotic stress and oxidative damage. Since miRNAs occupy the top place in biochemical events determining a trait, understanding their role in salt tolerance is highly desirable, which may allow introduction of the trait in the rice cultivars of choice through biotechnological interventions. High throughput sequencing of sRNAs in the root and shoot tissues of the seedlings of the control and NaCl treated Pokkali, a salt-tolerant rice variety, identified 75 conserved miRNAs and mapped 200 sRNAs to the rice genome as novel miRNAs. Expression of nine novel miRNAs and two conserved miRNAs were confirmed by Northern blotting. Several of both conserved and novel miRNAs that expressed differentially in root and/or shoot tissues targeted transcription factors like AP2/EREBP domain protein, ARF, NAC, MYB, NF-YA, HD-Zip III, TCP and SBP reported to be involved in salt tolerance or in abiotic stress tolerance in general. Most of the novel miRNAs expressed in the salt tolerant wild rice Oryza coarctata, suggesting conservation of miRNAs in taxonomically related species. One of the novel miRNAs, osa-miR12477, also targeted L-ascorbate oxidase (LAO), indicating build-up of oxidative stress in the plant upon salt treatment, which was confirmed by DAB staining. Thus, salt tolerance might involve miRNA-mediated regulation of 1) cellular abundance of the hormone signaling components like EREBP and ARF, 2) synthesis of abiotic stress related transcription factors, and 3) antioxidative component like LAO for mitigation of oxidative damage. The study clearly indicated importance of osa-miR12477 regulated expression of LAO in salt tolerance in the plant.

Introduction

Rice, undisputedly, is one of the most important crops in the world, not only because of its importance as staple food, but also because of several other features like vast availability of germplasm, including landraces and wild progenitors varying in innumerable characters, a comparatively smaller genome size and ease of transformation and regeneration that makes it a model cereal system. It has been genetically modified successfully for nutritional quality and resistance to various diseases [1]. However, the major challenge lies in increasing its yield with respect to the ever-inflating population of the world, as the impact of several abiotic stresses negatively influences its yield [2].

Among the abiotic stresses, the magnitude of salinity problem in rice cultivation seems to be huge, as more than 80 million ha of agricultural land representing 40% of total irrigated land the world over are affected from salinization [3] and more than 50% of all arable lands are likely to suffer from soil salinization due to irrigation and climate change by 2050 [4]. Salinity is especially a threat to rice production because among cereals rice is the most salt-sensitive crop [5] and both seedling and reproductive stages of the plant are highly sensitive to salinity [6-9]. Thus, increasing salinization of cultivable land is in contrast to the demand for rice production in future, which should must increase from the current production of approximately 500 million tons to at least 800 million tons [10] to meet the demand of estimated 9.6 billion people by 2050 [11]. This requirement is in the backdrop of challenges being faced by the staple food crops from abiotic stresses, including salinity, that negatively influence their biomass production and yield [12]. Breeding programmes on development of rice cultivars tolerant to salinity along with maintaining the yield and quality to achieve the projected target of rice production has so far not been successful. Hence, the option left is to introduce the trait in the rice cultivar of choice through biotechnological intervention.

Salinity is most complex in action among the abiotic stresses, as it invokes both ionic and osmotic actions that increases its toxicity potential greatly. Plants have developed a variety of power of adaptation to abiotic stresses, including salinity stress, involving cascades of signaling networks, which ultimately lead to changes in expression of many genes determining the fate of cellular, biochemical and physiological processes important from the view of tolerance to the stress [13]. Many such genes encoding effector and regulator proteins have been identified that impart resistance to salinity to plants, including those involved in maintenance of ion homeostasis, osmotic protection through compatible solute accumulation, protection against oxidative stress, polyamine accumulation and transcriptional regulation [14]. Efficacy of a few of them in the salt tolerance process has also been demonstrated in model plants by generating transgenic lines overexpressing genes like betaine aldehyde dehydrogenase (BADH), high-affinity potassium transporter (HKT), Δ1-pyrroline-5-carboxylate synthase (P5CS), vacuolar H+-pyrophosphorylase, etc. [14,15]. However, it has been increasingly realized that salt tolerance besides being a quantitative trait requires precise regulation of expression of the concerned genes, which may be upregulation of a few while downregulation of others. In this context microRNAs (miRNAs), the switch at the level of post-transcriptional gene regulation, as well as at the level of transcription [16,17] and translation [18], could be playing important role. Hence, identification of these miRNAs could provide a better strategy for engineering salt tolerance in plants than that accomplished by regulatory elements or effectors [19]. The view also stems from the fact that their expression is regulated by environmental cues, besides having multiple targets [20,21].

MicroRNAs are pervasive members of small RNA family, which smartly regulate the gene expression at the post-transcriptional and translational levels [22]. Unlike animals, plant miRNAs have very high or near-perfect complementarity with the target mRNA. The miRNA gene is transcribed in a normal transcriptional fashion by RNA polymerase II into a primary miRNA, which is further cleaved by DCL1/HYL1 along with supporting molecules, into a precursor miRNA [23]. This precursor forms a characteristic stem loop structure bearing the mature miRNA and miRNA* sequence in opposite arms. In plants, this precursor miRNA gets methylated at 3’ end by HEN1 and is brought to the cytoplasm by HST1. The miRNA-miRNA* duplex is cleaved and the resulting mature miRNA is loaded on to the RISC assembly by arganoute protein, while the miRNA* gets degraded [24]. A mature miRNA inhibits gene expression either directly by stalling the translation of proteins or indirectly by targeting the cognate mRNAs [25]. Post transcriptional regulation of genes has increasingly been realized to be the most conserved gene regulatory mechanism important for development, environmental stress responses and varieties of biological processes in eukaryotes [26,27].

The advent of next generation sequencing (NGS) has greatly enriched the database of miRNAs. For plants so far 10405 miRNAs sequences from 82 species have been deposited in miRBase 22.1 (http://www.mirbase.org). The occurrence of miRNAs in such a huge number, which is still increasing, is because of the fact that the profile of miRNAs expression differs greatly from species to species, both quantitatively and qualitatively. Besides, even within a species it is expected that the miRNA expression profile would differ from cultivar to cultivar depending on the trait with regard to which the two cultivars differ, and on the same logic it is also expected that their expression profile would differ considerably in the plant under contrasting environmental conditions [28,29]. Species-dependent response of miRNAs to salt treatment has been seen in many plants, including glycophytes and halophytes [21,29-39]. However, report on comparative study of expression profile of miRNAs in rice cultivars, or in any crop cultivars, contrast for salt tolerance, or tolerance to any abiotic stress is scant. Therefore, the current study was planned to see the expression profile of miRNAs in a salt-tolerant rice cultivar Pokkali in presence and absence of NaCl and to check the response pattern of a few important salt-responsive miRNAs in a salt-sensitive rice cultivar Badami in order to identify the miRNAs and their targets that could be involved in the salt tolerance process considering that the findings could be useful in improving salt tolerance in rice cultivar of interest through biotechnological interventions.

Results

Small RNA sequencing

More than 21 million high quality reads of sRNA were obtained from the four sRNA libraries (control root- CR, control shoot- CS, 256 mM NaCl (EC ~21 mS/cm) treated root- TR and 256 mM NaCl treated shoot- TS) sequenced (Table 1). These represented 99.72%, 99.78%, 99.86% and 99.87% of the total sequence reads from CR, CS, TR and TS, respectively. Total reads considered for finding the known miRNAs and predicting the novel miRNAs were 6887961, 13116913, 12126876 and 9765004 in CR, CS, TR and TS, respectively after removing the reads of length less than 16 nucleotides (nt) and more than 35 nt, low complexity reads, reads with T/R RNA matches and invalid sequence reads (Table 1). The non-redundant reads of length between 16-nt and 35-nt were 1143060, 1664461, 1219751 and 1035994, respectively for CR, CS, TR and TS. Most of the sRNA non-redundant sequences from all the libraries were 23-nt to 24-nt long (S1 File). Although the unique reads were more than one million in each of the libraries, and nearly 20% of the total unique reads, the total number of miRNAs discovered in CR, CS, TR and TS were only 147, 418, 261 and 357, respectively. Of these, 29, 35, 25 and 39 were conserved and 118, 383, 236 and 318 were mapped as novel miRNAs in CR, CS, TR and TS, respectively. The number of conserved miRNAs decreased, while that of the predicted (novel) miRNAs increased in root in response to the salt treatment (Table 1). However, opposite result was obtained in shoot, i.e. the number of conserved miRNAs increased, while that of the novel miRNAs decreased in response to the salt treatment (Table 1).

Table 1

Summary of the sRNA reads.

Adapter ligated libraries of sRNAs from the root and shoot. tissues of O. sativa cv. Pokkali seedlings, control and treated with 256 mM NaCl for 9 h on the 9th day of germination were sequenced on Illumina platform. The sequences were processed with various bioinformatics tools to get the putative miRNAs.

Read Distribution	Root control	Root treated	Leaf control	Leaf treated
Total no. of raw reads	21291582	22498709	24465280	22021240
Total no. of HQ filtered reads after first QC	21232204	22467178	24412174	21993648
Total no of reads after adapter trimming and length filtration (Min length = 15)	19549175	21090549	24182661	21342069
Total no of adapter trimmed, length filtered HQ reads after second QC	19548882	21090188	24182301	21341350
Reads unaligned with NONCODE	18236576	20103872	22753639	18112677
Filtered reads with (length (<16->35 nt), low complexity, T/R RNA match, Invalid) which are discarded	11348615	7976996	9636726	8347673
Total Reads Used for Known and Novel miRNA Prediction	6887961	12126876	13116913	9765004
Known miRNA	29	25	35	39
Novel miRNA	118	236	383	318
Total no. of miRNA	147	261	418	357

Family distribution and Northern blot analysis of the conserved miRNAs

Both root and shoot tissues showed great difference in composition of the conserved miRNAs under control and salt treated conditions (S2 File). The conserved miRNAs identified belonged to 35 families (S2 File, S3 File). Responses of two of the conserved miRNAs identified, namely miR159a and miR167f, to salt application were checked by Northern blot analysis. The result of the Northern blot confirmed that these two miRNAs expressed both in root and shoot tissues of not only the salt-tolerant Pokkali, but also of the non-tolerant Badami (Fig 1, S4 File). These miRNAs also showed noticeable changes in expression in response to the salt treatment. The expression of miR159a was downregulated in both root and shoot in the salt-tolerant Pokkali, but was downregulated only in root in the salt-sensitive Badami in response to the salt application; in Badami shoot, miR159a showed upregulation in response to salt treatment. In contrast to miR159a, miR167f showed considerable downregulation only in the root of Pokkali, and its expression increased in both root and shoot of Badami.

Fig 1

Northern blots showing expression of two conserved miRNAs in root (R) and shoot (S) tissues of control (C) and 256 mM NaCl treated (T) seedlings of O. sativa cv. Pokkali (salt-tolerant) and O. sativa cv. Badami (salt-sensitive) on 9th day of germination.

The right panel shows the relative expression of the individual miRNAs in the root/shoot tissues of the treated seedlings over control ones, as obtained by densitometric analysis of the band intensity considering the band intensity of U6 for normalization.

Bioinformatics of the novel miRNAs

Out of hundreds of novel miRNAs predicted by Illumina sequencing followed by bioinformatics analysis (Table 1), expression of at least nine of them could be successfully validated in Pokkali, as well as in Badami by Northern. The details of their bioinformatics qualifying parameters, like A+U percentage, minimum free energy (MFE) of the precursor and length of the precursor (PL, precursor length) are given in Table 2 and S5 File. The MFE values of the precursors varied from -34.1 kcal/mol to 67.7 kcal/mol, while the MFE index (MFEI) of the precursors varied from 0.67 to 1.72. A+U content in the precursors varied from 37.0% to 71.4%. The stem-loop structures obtained for the individual precursors by mFold software revealed the presence of the predicted individual miRNAs sequences in one of their arm (S5 File). The length of the novel miRNAs varied from 20-nt to 24-nt, and they varied greatly in abundance, expressed in reads per million (RPM). For several of them the miRNA* sequences were found to be present with miRNA/miRNA* mismatches varying from 3–5 (Table 2).

Table 2

The novel miRNAs predicted by alignment of the sRNA sequences with rice genome database and confirmed for their expression by Northern in root and shoot tissues of the seedlings of O. sativa cv. Pokkali along with the relevant values/information of the basic bioinformatics criteria qualifying them as miRNAs.

MFE- Minimum Free Energy, MFEI- MEF index.

Novel miRNAs	Sequence	Maximum abundance in tissue in reads per million (RPM)	Length (nt)	miRNA*	miRNA/miRNA* mis-matches (nt)	Pre-cursor Length (nt)	A+U (%)	MFE (Kcal/mol)	MFEI
osa-miR12474	GCCCCGCGTCGCACGGATTCGT	2212.9	22	CTGAATCCTTTGCAGACGACT	4	127	37.0	-57.33	0.71
osa-miR12475	ACCGAGGCGCGTCAATTGCTG	27.54	21	AATGACGCAGCTTATGAGGTT	4	175	46.3	-67.7	0.72
osa-miR12476	ATTAATAGGGACAGTCGGGGGC	10.52	22	NO		114	61.4	-34.9	0.81
osa-miR12478	CGGGGATGGAGCGACAGAAGCA	56.22	22	NO		100	51.2	-34.1	0.67
osa-miR12477	TTGAGTGCAGCGTTGATGAACC	24.33	22	TTCACCAGCACTGCACCCAATC	3	129	38.0	-56.7	0.90
osa-miR12479	TTAGTTCACATCAATCTTCCT	8.27	21	NO		99	55.6	-58.9	1.34
osa-miR12480	CAGCCCCGCGTCGCACGGATTCGT	15.10	24	GGCTGAATCCTTTGCAGACGACTT	6	127	37.0	-56.33	0.71
osa-miR12481	TATTATAAGACGTTTTGACT	7.98	20	NO		115	71.3	-53.6	1.62
osa-miR12482	AGCAAGATATTGGGTATTTCTTTT	0.72	24	CTAGAAATACCCAATATCTTGCTG	3	70	71.4	-34.4	1.72

Northern blot analysis of the novel miRNAs

The results of the Northern for the novel miRNAs revealed great variation in their tissue-specificity as well as salt responsiveness in expression (Fig 2, S4 File). Among the novel miRNAs found expressing in the seedlings, osa-miR12475, osa-miR12476 and osa-miR12479 expressed only in root (Fig 2). Expression of the other miRNAs, like osa-miR12474, osa-miR12477, osa-miR12478, osa-miR12480, osa-miR12481 and osa-miR12482 was found both in root and shoot. Among the miRNAs that expressed only in root, the expression of osa-miR12475 and osa-miR12479 decreased both in Pokkali and Badami in response to NaCl. The decrease in expression of osa-miR12479 in response to the salt treatment was, however, much more in Badami compared with that in Pokkali. In oppose to osa-miR12475 and osa-miR12479, the expression of osa-miR12476 increased in response to the salt treatment in both Pokkali and Badami. Among the novel miRNAs showing expression in both root and shoot, the expression of osa-miR12478 was more prominent in root than in shoot, while the expression of osa-miR12477 was more prominent in shoot than in root in both Pokkali and Badami. The expression of osa-miR12478, however, decreased in shoot in both Pokkali and Badami in response to the NaCl application, in contrast to osa-miR12477, which showed NaCl-induced upregulation in expression in both root and shoot of both the varieties. In contrast to osa-miR12477 and osa-miR12478, osa-miR12474 showed differential expression pattern, particularly in shoot where its expression was upregulated in Badami, but downregulated in Pokkali in response to the salt treatment. In root the expression of osa-miR12474 decreased both in Pokkali and Badami in response to the salt treatment, comparatively more in the latter than in the former. Unlike osa-miR12474, osa-miR12478 showed upregulation of expression in root in Pokkali and downregulation of expression in shoot in Badami in response to the salt treatment. Thus, osa-miR12474 and osa-miR12478 showed opposite expression pattern in root and shoot of the two rice varieties in response to the salt treatment. The expression of osa-miR12481 showed a pattern of decrease in shoot and increase in root both in Pokkali and Badami in response to the salt application with shoot showing a greater decrease in Pokkali than that in Badami. The miRNAs osa-miR12480 and osa-miR12482 showed similar response to the salt application in Pokkali; their expression increased both in root and shoot. Their response to salt application was different for root and shoot in Badami; the expression of osa-miR12480 increased in shoot and decreased in root, whereas that of osa-miR12482 decreased in shoot and increased in root.

Fig 2

Northern blots showing expression of the novel miRNAs.

Other details as in Fig 1.

Northern blot analysis of novel miRNAs in halophytes

The possible involvement of the novel miRNAs in salt tolerance was tested by looking at their expression in two halophytes, O. coarctata, a wild rice, and S. maritima, a plant growing along sea shore (Fig 3, S6 File). Expression of seven out of the nine novel miRNAs, including miR12475, miR12478, miR12481, miR12482, miR12477, miR12479 and miR12480, could be detected in the wild rice O. coarctata (Fig 3). The expression of miR12475 and miR12477 was upregulated in response to salt application in O. coarctata, although the upregulation of miR12475 was only a little compared to that of miR12477. The expression of miR12478, miR12479, miR12480, and miR12481 on the other hand was downregulated greatly in the plant upon salt treatment. The expression of miR12482 also showed a little down regulation in response to the salt treatment. In contrast to O. coarcata, however, only two of the novel miRNAs, miR12477 and miR12482 expressed in the halophyte S. maritima grown in absence of NaCl (control), and their expression increased slightly in response to the salt application, similar to that in O. coarctata (Fig 3).

Fig 3

Northern blot showing expression of the novel miRNAs in the shoot tissue of control (C) and 256 mM NaCl treated (T) Oryza coarctata (OC) and Suaeda maritima (SM).

NaCl treatment was for 9 h. U6 served as internal control. The right panel shows the relative expression of the miRNAs in the treated over control after normalization of the band intensity with U6.

Validation of target cleavage by 5’RACE, RT-qPCR and dual-luciferase assay

The targets of all the novel miRNAs validated for expression by Northern were predicted using the online software (S7 File). However, since only the novel miRNAs osa-miR12482 and osa-miR12477 expressed in the halophyte S. maritima, their target genes were experimentally determined by 5’RACE. Cleavage of three targets, including monocopper oxidase-like protein (MCO), L-ascorbate oxidase (LAO), and Myb could be confirmed by RLM-RACE. LAO and MCO were targeted by miR12477 and Myb by osa-miR12482 (Fig 4). The cleavage of the targets by the miRNAs was validated further by dual-luciferase assay (Fig 5). Significant decrease in F-luciferase to R-luciferase activities ratio was obtained for the target miRNA sequences (Fig 5A) suggesting that LAO and MCO were targeted by osa-miR12477 and Myb was targeted by osa-miR12482. The result was also supported from decrease in expression of F-luciferase in response to the salt treatment (Fig 5B). Expression studies of LAO by RT-qPCR showed decrease in its expression in both Pokkali and Badami upon NaCl treatment, comparatively more in the latter than in the former (Fig 6). The expression of Myb, however, showed an insignificant change in Pokkali, but significant increase in root in Badami in response to the salt treatment.

Fig 4

The cleavage points of L-ascorbate oxidase (LAO) and monocopper oxidase (MCO) targeted by the novel miRNA osa-miR12477, and of Myb targeted by the novel miRNAs osa-miR12482.

The cleavage points, indicated by arrows, were obtained by cloning and sequencing of the 5’RACE PCR products. The numbers against each arrow indicate the number of clones that were having cleavage point, i.e. the insert ligated to the 5’ adaptor out of the total number of the clones of the PCR products sequenced.

Fig 5

Dual-luciferase assay for the validation of the target cleavage.

The target sequence of the miRNAs in the three gene products, i.e. L-Ascorbate oxidase (LAO), monocopper oxidase (MCO), and Myb were introduced individually in the 3’UTR of luciferase (Addgene ID 55206). These constructs served as 3’UTR sensor. Construct was also made for overexpression of osa-miR12477 and osa-miR12482 by introducing their hairpin region flanked with 100 bp upstream and downstream sequences separately into Addgene ID 55208 vector. These were termed miRNA overexpressor. The 3’UTR sensor and miRNA overexpressor were then individually introduced into A. tumefaciens strain LBA4404. Nine leaves in taking three plants were infiltrated with equal volumes of miRNA overexpressor and 3’UTR sensor. Leaves were also infiltrated only with 3’UTR sensor, referred as (-) MO. These leaves were collected after 48 h and Renilla (R) and Firefly (F) luciferase assays were performed. The ratio of F-Luc/R-Luc activities for the individual 3’UTR sensor and miRNA overexpressor pairs were calculated and presented (a). Parallelly RNA was also extracted from the infiltrated leaves. RT-qPCR was performed for R-luciferase and F-luciferase using primers against these transcripts to see the relative expression of F-luciferase using the expression of R-luciferase as reference (b). The data are mean ± sd of assays in nine individual samples. The asterisk, ** or *** marked against the individual genes indicates that their activities/expressions in the leaves infiltrated with both 3’UTR sensor and miRNA overexpressor for the individual gene and miRNA pairs were significantly less than in the leaves infiltrated only with 3’UTR sensor at p ≤ 0.01 and p ≤ 0.001, respectively.

Fig 6

Changes in expression of LAO and Myb in shoot (S) and root (R) tissues of O. sativa cv. Pokkali and O. sativa cv. Badami upon exposure to 256 mM NaCl for 9 h on the 9th day of germination.

The expression was measured by RT-qPCR and expressed as relative value in the treated samples over the control ones considering actin as the reference gene. LAO- L-Ascorbate oxidase, Myb- Myb transcription factor.

ROS accumulation studies

DAB treatment revealed high level of accumulation of reactive oxygen species (ROS) in the leaves of both Pokkali and Badami in response to 256 mM NaCl treatment (Fig 7). However, the accumulation was much greater in the salt-sensitive Badami compared with that in the salt-tolerant Pokkali.

Fig 7

Influence of NaCl treatment on accumulation of H2O2 (ROS) in the leaves of salt-tolerant O. sativa cv. Pokkali and salt-sensitive O. sativa cv. Badami.

The leaves of the control seedlings and those treated with 256 mM NaCl for 9 h on the 9th day of germination were harvested and processed for DAB staining for the detection of ROS accumulation. Three leaves each from the control and NaCl treated seedlings of both Pokkali and Badami were considered for DAB staining.

In situ expression studies of osa-miR12477

In-situ PCR was performed in order to understand the spatial distribution of osa-miR12477 targeting LAO. The sections showed expression of the miRNA mostly in the mesophyll tissues, and the leaf section from the NaCl treated seedling showed a greater staining compared to that from the control one (Fig 8). The negative controls (minus the stem-loop RT primer) did not show any staining.

Fig 8

In situ PCR for the localization and expression studies of osa-miR12477.

Paraffin embedded leaves of the control (C) and 256 mM NaCl treated (T) Pokkali seedlings were sectioned (60 μm) on a microtome, processed to remove the paraffin, osa-miR12477 was reverse transcribed using miRNA specific primer and amplified with miRNA specific stem-loop forward primer and universal reverse primer using high fidelity Taq polymerase with dig-11-dUTP (Roche). The section was probed with anti-DIG-AP-Fab fragment and the miRNA expression was visualized using BM-purple substrate (Roche) on a light microscope. The leaf sections of both control (C) and NaCl treated (T) seedlings were processed without (A) and with (B) osa-miR12477 specific stem-loop primer.

Discussion

Regulation of gene expression by miRNAs has emerged as an important molecular process determining functioning of several metabolic pathways, including the biochemical events involved in salt tolerance in plants [20,21,40]. This is also reflected from the changes in the frequency of non-redundant reads (S1 File) and the number of unique reads representing miRNAs (Table 1) in both root and shoot in response to challenge of the Pokkali rice seedlings with 256 mM NaCl. Besides, the response of root and shoot to the NaCl exposure also differed, as is reflected from the changes in the predictable miRNAs reads per million; it increased in root but decreased in shoot, suggesting that the changes in the metabolism operational in root and shoot in response to the salt treatment might be different. The same is also reflected form the response of the total miRNAs expression in the two tissues (Table 1, S2 File). Furthermore, a much greater percentage of the unique sRNAs in 24-nt length category than in 21-nt length category (S1 File) suggested the presence of DCL3 action that matures 24-nt sRNAs in angiosperms, unlike in conifers that lacks DCL3 [41], and that these might be derived from transposons and retrotransposons constituting as much as 75% of the total genome with diverse sequences [42], unlike the 21-nt sRNA representing canonical miRNAs [43,44]. In addition, a low percentage of 20–22 nt unique sRNA sequences together with high sequence redundancy in comparison to that of 24-nt unique sequences (S1 File) is indicative of derivation of 20–22 nt sequences from a much lower number of genetic loci representing highly expressing genes, and hence these could be actively involved in regulation of gene expression, most likely as miRNAs [43]. With regard to influence of salinity on sRNA population, the increase in frequency of the unique sequences in root in response to NaCl suggested that the processes leading to accumulation of sRNA are hastened in presence of NaCl, although all of these might not be miRNAs [44].

The family diversity of miRNAs observed in the current study in terms of the number of miRNAs vis-à-vis the number of miR-families to which they belong, which is approximately 1.7 for shoot and 3.2 for root (S2 File, S3 File), is similar to that obtained in species like Citrus trifoliate, Brassica napus, cucumber, potato and water melon showing ratio ranging from 1.5 to 2.0 [45-49]. Such low diversity is expected for a plant species with known genome unlike that in plant species with unknown genome, like Avecinia marina and S. maritima showing miRNAs to miR-families ratio of 5.0 or more [21,38]. However, the number of conserved miRNAs found was only 49, and those already reported from rice were only 39 (S8 File), which is in contrast to the reports of presence of as many as 738 miRNAs from rice in miRBase 22.1, suggesting that their expression varies greatly depending upon the cultivar/varieties and growth stage. Moreover, identification of precursors of as many as 10 conserved miRNAs in the rice genome, not reported before, suggested that the miRNAs database for rice is still not saturated. This is also reflected from the fact that the precursors of at least two novel miRNAs, sma-miR5 and sma-miR6, identified in a halophyte S. maritima were found to be present in rice and matured miRNAs were salt-responsive [21].

The presence of salt seems to favour the growth of Pokkali. This is reflected from the salt-induced downregulation observed in the NGS result (S2 File) in shoot of the members of miR396, like miR396a/b, which targets Growth Regulator Factors (GRFs) promoting cell proliferation during leaf development [50]. However, the salt-induced appearance of one of the member of the family, miR396g/h, is in opposed to its salt-mediated suppression in Salicornia europea, but of course on long-term (7 d) treatment [37]. Hence, the salt-induced appearance of mir396g/h in short-term exposure in the present case (S3 File) might be to downregulate ubiquitin-specific proteases (UBPs), the target of miR396g/h [51], to promote ubiquitin mediated degradation of the undesired proteins during the initial period of salt stress. In contrast to others, the members of miR167 has been reported to be drought responsive [52], and Kinoshita et al. [53] have reported their downregulation under high osmotic stress, in agreement with the present observation in shoot (S2 File) considering the fact that salt application also creates physiological dryness like situation, at least during the initial phase of treatment. Moreover, the targets of mir167, like ARF and IAA-Ala, have also been reported to accumulate under drought or osmotic stress [53,54]. It is well established that ARF class of transcription factors regulates diverse metabolic and developmental process under abiotic stress for the benefit of the plant [39,55], and downregulation of miR167f in response to NaCl application in the root and shoot tissues of Pokkali, but not in Badami (Fig 1), might be enabling Pokkali to tolerate salinity better than Badami. Downregulation of miR159a in root and shoot of Pokkali in response to NaCl, similar to that of miR167f, is also reflective of greater tolerance of the cultivar compared to Badami in which miR159a was upregulated, at least in shoot (Fig 1). This is because miR159 targets Myb transcription factors [39,55,56] that participate in diverse biological processes, including defense and stress responses in plants [39,55,57,58]. In fact, overexpression of Myb transcription factors of several plants, like AmMYB1 and TaMyb73, have been shown to improve salt tolerance in tobacco and Arabidopsis, respectively [59,60]. In addition, the salt-induced upregulation of the miRNAs targeting transcription factors could be equally important in providing resistance to salinity to the plant [39]. This is reflected from the upregulation of miRNA164a/b/f, miR319a, miR169c and 172a (S2 File, S3 File) targeting NAC, TCP, NF-YA and AP2/EREBP domain protein, respectively. It has been seen that overexpression of NAC leads to downregulation of several drought-responsive genes, suggesting NAC to function as negative regulators of drought tolerance [61]. Similarly, NF-YA has been seen to function as negative regulators of salt tolerance, as overexpression of GmNFYA3 in soybean increases its sensitivity to salinity [62]. Low level of TCP on the other hand increases cell proliferation [63,64], and hence decrease in its level because of salt-induced upregulation of miR319a might be helpful for the plant to maintain cell division and cell growth under the short period of salt stress condition. Similar to TCP, the target of miR172a, AP2/EREBP domain protein SSAC1, is beneficial to plant at low level with regard to salt tolerance, as it functions as transcriptional repressor [65]. The overexpression of miR172a in fact improves salt tolerance in soybean [65]. The members of the family miR172 have also been found to be salt responsive in the wild rice O. coarctata and the African rice O. glaberrima [39,55], similar to this study.

Although the current database of plant miRNAs for rice is quite rich, it is going to increase further with the discovery of the miRNAs expressed only under certain environmental conditions, stage of development or in specific cultivars/varieties. This is evident from the present finding of at least nine novel miRNAs (Table 2), including five with miRNA* sequence. Although detection of miRNA* adds weight to the authenticity of the predicted miRNA candidates, mostly these may not be detected in sequencing as these are degraded soon after being exported to cytosol, and this makes their abundance in cell much lower than that of their corresponding mature miRNAs [25]. The negative MFE of the precursor miRNAs varied significantly 
with a range of -34.1 kcal/mol to -58.9 kcal/mol, which are much lower than the values of the tRNA and ribosomal RNA [66]. The 
mean MFEI value of the precursors was higher than 0.64, the MFEI of tRNAs, the maximum among the known RNAs, reflecting that these newly identified miRNAs were likely to be miRNAs precursors, and not any kind of non-coding RNAs [67]. Besides, the length of the precursors was greater than the desired length of 60-nt, the miRNAs occupied only one of the arm of the concerned secondary structure, and the mismatches between miRNA/miRNA* duplex was not more than five (Table 2, S5 File), suggesting that the precursors could in fact be diced to mature miRNAs [66]. The A+U contents of the precursors varied from 37% to 71.4% (Table 2), in agreement with the reports available [68,69]. The low abundance of a few of the miRNAs may be questionable as per the criteria of qualification by their number, which is generally 10 or more [70]. However, the abundance of non-conserved miRNAs could be at a low level as these might have only specific function at certain stage of development or environmental condition [71].

Salt-responsiveness of the novel miRNAs considered for validation varied greatly not only within the variety/cultivar but also between the varieties/cultivars, as revealed by Northern blot analysis (Fig 2) suggesting their varying role is salt tolerance. The downregulation of the novel miRNAs osa-miR12474, osa-miR12475 and osa-miR12479 in roots of both the rice varieties suggested their positive regulatory role in salt tolerance. In contrast to miR12474 and miR12475, the upregulation of miR12476 and miR12477 in roots in response to the salt treatment (Fig 2) suggested that these novel miRNAs might be having negative regulatory role in salt tolerance in the plants working by downregulating the expression of their target gene(s). The result of Northern for miR12478, miR12480, miR12481 and miR12482 (Fig 2) on the other hand revealed that regulation could be negative or positive depending upon the tissue and the varieties/cultivars. However, for all these miRNAs, Pokkali showed an increased expression in root (Fig 2), suggesting that for salt tolerance downregulation of their target was necessary in root. The downregulation of miR12481 and miR12478 in shoot on the other hand suggested that upregulation of their target in shoot might be necessary for salt tolerance in both Pokkali and Badami, although they differ in salt-sensitivity. Moreover, the Northern data also revealed that upregulation of miR12482 and miR12480 in both root and shoot could be very important for salt tolerance, as their level got upregulated in Pokkali in response to NaCl, but their response to NaCl was not uniform in root and shoot of Badami (Fig 2).

Salt responsiveness of the novel miRNAs like miR12477, miR12478, miR12479, miR12480, miR12481 and miR12482 in the wild rice salt-tolerant O. coarctata (Fig 3), particularly the drastic downregulation of miR12478, miR12479, miR12480 and miR12481 is suggestive of their possible role in salt tolerance. Expression of only miR12477 and miR12482 in S. maritima suggested that the other miRNAs are conserved mainly in the related species, and that the molecular mechanism regulating the salt tolerance process may differ among species taxonomically placed very apart.

Cloning and sequencing of the RACE PCR products (Fig 4) and luciferase assay (Fig 5) confirmed LAO and MCO as the targets of osa-miR12477, and Myb of osa-miR12482. The importance of Myb transcription factors in diverse biological processes, including defense and stress responses in plants is well known [39,55,57,58]. In fact, overexpression of Myb transcription factors of several plants, like AmMYB1 and TaMyb73, have been shown to improve salt tolerance in tobacco and Arabidopsis, respectively [59,60]. In contrast, the role of LAO, targeted by miR12477, is not well established, although its substrate, ascorbate, is a well-known antioxidant, as it reacts with H2O2 to break it down into water [72]. The reaction, nevertheless, is facilitated by ascorbate peroxidase [73,74]. Furthermore, it is also well established that oxidative stress is one of the way by which salt produces its toxic effect in plant [74]. Hence, downregulation of LAO as a result of upregulation of miR12477 in response to salt application suggests it to be a negative regulator of salt tolerance in plant. The negative relationship between LAO expression and osa-miR12477 expression is clearly evident from an increased accumulation of osa-miR12477 (Fig 8) concomitant with decrease in expression of LAO (Fig 6) in leaf of Pokkali in response to exposure of the seedlings to NaCl. However, the downregulation of LAO may not be the sole factor of salt tolerance in plant as its downregulation in response to salt treatment was significantly greater in the salt-sensitive Badami than in the salt-tolerant Pokkali (Fig 6), but ROS accumulation was more in the former than in the latter at 1.5 NaCl treatment, as revealed by DAB staining (Fig 7). A greater accumulation of ROS in Badami than in Pokkali despite a greater downregulation of LAO in the former than in the latter could be because of poor functioning of the enzymes involved in scavenging ROS, like catalase, ascorbate peroxidase and peroxidases [74]. It is well known that salt tolerance is a quantitative trait involving many genes. The result of in situ expression of osa-miR12477 showing an increase in expression of the miRNA in Pokkali in response to NaCl treatment of the seedlings (Fig 8), nevertheless, does support an important role of osa-miR12477 in oxidative stress management in the plant.

Conclusions

The study thus led to identification of several salt-responsive novel and conserved miRNAs, and expression of several of them could be successfully validated by Northern blot analysis. Among the conserved miRNAs, precursors of several of them were different from those available at miRBase 22.1 for rice, and hence these precursors could be considered as novel (S5 File). Several of the conserved miRNAs expressed only in shoot in response to salt, like miR172a and miR393a, targeting genes encoding proteins like AP2/EREBP and auxin receptor in SCF-E3 ligase indicating the involvement of ethylene and auxin in salt tolerance, and more importantly the modulation of hormonal action and signaling in the salt tolerance process. The fact that salt tolerance in plants could be auxin mediated also stems from 1) upregulation of miR171b (S2 File, S3 File), which targets the gene scarecrow-like proteins that negatively regulates GA/auxin action, 2) downregulation of miR167f in shoot in Pokkali (Fig 1) and sma-miR7 in the halophyte S. maritima [21], both targeting ARF, and 3) the reports of accumulation ARF and IAA-Ala under abiotic stress [53,54]. The second line of miRNA mediated salt tolerance in plants could be through influence on transcription factors regulating expression of genes encoding proteins involved in a wide range of biochemical and physiological processes linked to abiotic stress tolerance without the involvement of plant hormones, like NAC, NFYA, TCP, HD-Zip III and Myb, targeted by miR164a/b/f, miR169c, miR319a, miR166 and miR159a, respectively. The study further revealed that the tolerance to salinity could also be a result of mitigation of oxidative damage that abiotic stress generally inflicts in plants [74], as was reflected from 1) a high salt-induced upregulation of the novel miRNA miR12477, comparatively more in Pokkali than in Badami (Fig 2), that targets LAO (Fig 5), the enzyme that breaks down the ascorbate, an H2O2 detoxifying agent, and 2) low accumulation of ROS in the leaves of Pokkali than in the leaves of Badami upon exposure of the seedlings to NaCl, as reflected by DAB staining of the leaves (Fig 7). Thus, salt tolerance process in plant is not only complex, being determined by multiple factors, the involvement of miRNAs increases the complexities further. Nevertheless, a clear understanding of regulatory role of miRNAs in salt tolerance may provide opportunities for biotechnological interventions for improving salt tolerance in the crop cultivar of interest, as it would be possible to target the top biochemical and molecular events determining the salt tolerance.

Materials and methods

Plant growth conditions and treatment

Seeds of the salt tolerant Oryza sativa L. ssp. indica cv. Pokkali [75,76] and salt-sensitive O. sativa ssp. indica cv. Badami [77] were collected from the National Rice Research Institute (NRRI), Cuttack and Orissa University of Agriculture and Technology (OUAT), Bhubaneswar, respectively who maintain the germplasm of the stated rice cultivars. The seeds were surface sterilized, soaked overnight and spread onto a large petri-dish containing moist tissue paper to aid germination. The germinated seeds were grown for 8 days in Hoagland’s medium in a plant growth chamber maintained at 25 ± 2 °C and ~70% relative humidity with 14/10 h light/dark cycle. Salt treatment was given on the 9th day in morning as 256 mM (1.5%) NaCl [21,77]. EC of 256 mM NaCl is approximately 21 mS/cm [78]. At first a known volume of NaCl stock solution was added to the individual beakers to raise the salt concentration to approximately 85 mM, a low initial NaCl concentration to avoid sudden stress shock. Light was switched on after 30 min of salt application followed by addition of more of NaCl stock solution (volume calculated beforehand considering the volume of the space up to the net) and 1/10th Hoagland solution up to the net to bring the final NaCl concentration to 256 mM. After exposure of the seedlings for 9 h under illumination the shoot and root tissues of both control and salt-treated seedlings were harvested and immediately frozen in liquid nitrogen and stored at -80 °C for future use.

Suaeda maritima (L.) Dumort. seeds were collected from the plants growing naturally along the coastal belt of Bhadrak, Odisha. The species was identified by Dr. Pratap Chandra Panda, Taxonomy and Conservation Biology Division at the Regional Plant Resource Centre (RPRC), Bhubaneswar. The species is grown and maintained at the Institute of Life Sciences, Bhubaneswar at its Green House facility [21,79], and has also been deposited in the publicly available herbarium of RPRC (Voucher no. 10693). The seeds of the plant were germinated over autoclaved soil in plastic pots having holes at the bottom. The pots were placed in a growth chamber maintained at 25 ± 2 °C and ~70% relative humidity, and were illuminated with white fluorescent light (~200 μmol m-2 s-1) at 14/10 h light/dark diurnal cycle. Hoagland’s solution (1/10th) or Milli-Q water were used alternately to water the pots. The seeds germinated and the seedling grew up to 2–3 cm in 3–4 weeks. The seedlings were then transferred to other similar pots with 2–3 seedling in each and were grown under natural day/night cycle for ~3 months in a greenhouse maintained at 25 ± 2 °C and ~70% relative humidity. Milli-Q water and 1/10th Hoagland’s solution were used to water the pots alternately every day. On the day of NaCl application the individual pots meant for treatment received 500 mL 85 mM NaCl prepared in 1/10th strength and the control pots received only 1/10th Hoagland’s solution. The excess solution got drained away through the pores. The initial treatment with 85 mM NaCl was given to avoid salt stress shock to the plants. After 30 min the treatment pots received 100 mL of 256 mM NaCl prepared in 1/10th strength Hoagland’s solution and the control pots received only 1/10th Hoagland’s solution. The process was repeated every hour. The above ground part of the seedlings, the shoot, from the control and treated pots were harvested after 9 h and were preserved in liquid N2 for use later on.

The wild rice Oryza coarctata (Roxb.) Tateoka was collected from the lake Chilika outer channel, Puri, Odisha. The species is grown and maintained at the Institute of Life Sciences, Bhubaneswar at its plant growth facility [21]. The taxonomic details of the species was provided by Dr. Pratap Chandra Panda, Taxonomy and Conservation Biology Division at RPRC, and the species has also been deposited in its publicly available herbarium (Voucher no. 10689). Young plants were raised by rhizome transplantation in green house in pots similar to that used for S. maritima. The young plants, 15–20 days old, grown in different pots were then given NaCl treatment in a way similar to that to S. maritima, and the aerial part of the control and treated plants were harvested and stored frozen for use in analysis.

Small RNA library construction, Illumina sequencing and bioinformatics

For the identification of the salt-responsive miRNAs, sRNA sequencing of control (C) and treated (T) samples of root (R) and shoot (S) of Pokkali was performed on Illumina platform. Total RNA was extracted from the individual samples using TRIzol reagent (Thermo Fischer Scientific) following manufacturer’s instructions. Only good quality RNA with RIN value above 7.0 was used for downstream processing. Total RNA (1 μg) from each sample was subjected to electrophoresis on denaturing polyacrylamide gel to separate out the sRNA fragments, which were recovered and ligated with 3’- and 5’- adaptors. The ligated sRNA products from each sample were reverse transcribed and PCR amplified to generate the sRNA libraries. The individual libraries were normalized to 2 nM with Tris-HCl as per TruSeq Small RNA Prep kit manual (Illumina). The libraries were then processed for single-end sequencing on HiSeq2000. The sequencing results were generated as FASTQ data using Illumina pipeline CASAVA 1.8 package. NGS QC Toolkit Cutadapt and UEA Small-RNA Workbench were used to process the raw reads. Adaptor-trimmed high quality reads were queried against the NCBI and Rfam databases to screen out and discard the abundant non-coding RNAs like tRNA, snoRNA, snRNA and others. The unique reads were searched for the known sequences in the miRBase 22.1 for the identification of the conserved miRNAs. The sRNA sequences were then mapped on rice genome for the identification of possible novel miRNAs and their precursors. The basic criteria described in literature were followed for putative miRNA prediction [67,80-82].

Expression studies of miRNAs by Northern blotting

Expressions of the conserved miRNAs identified and that of the novel miRNAs predicted bioinformatically were validated by Northern blot analysis. Both shoot and root tissues of the control and 256 mM NaCl treated plants were considered for the validation of their expression. This also allowed study of their tissue-specific and NaCl-induced differential expression. Total RNA was extracted from different tissues using TRIzol. For the Northern blot analysis 10 μg of good quality RNA (260/280 ~2.0) of the individual samples was loaded in different lanes of 15% PAGE and run at 200 V. The RNA separated was transferred on a nylon membrane using Trans-Blot® SD Semi-Dry Electrophoretic Transfer Cell (Bio-Rad), UV-cross linked at 150 mJ using a UV cross-linker (HoeferTM UVC 500 Crosslinker) and was stored at 4 °C until used for hybridization. The individual membranes were pre-hybridized in hybridization buffer (Sigma) at 37 °C for 1 hour separately in hybridization bottles. DNA oligos complementary to the individual miRNAs were labeled with [γ-32P]dATP using T4 polynucleotide kinase (Thermo Fischer) and used as probes. The individual labeled probe was allowed to hybridize separately with the pre-hybridized blots by incubation for 16 h at 37 °C in hybridization bottles. The membranes from the individual hybridization bottles were washed separately with 2X SSC buffer containing 0.1% SDS (non-stringent), followed by washing with 1X SSC buffer containing 0.1% SDS (non-stringent) for 15 min each at 37 °C. The membranes were dried and exposed to X-ray film individually for appropriate time. The X-ray films were developed and fixed, and the images were analyzed on a gel-doc. Each exposed membrane was then sequentially washed with stringent and non-stringent wash buffers for 10 min each at 80 °C to strip off the probe. The stripped membranes were air dried and probed with a small stretch of U6 RNA labeled with [γ-32P]dATP, washed and exposed to X-ray film, as stated above, for detection of the signal. U6 RNA signals served as internal control. The signals of the miRNA and that of U6 signal on the same blot were imaged on gel-doc (BioRad) and analyzed taking densitometric approach. The expression of the individual miRNAs in the control and NaCl-treated samples was shown as relative value after normalization with the respective U6 expression. List of the probes used are given in the S9 File.

Prediction of targets

The targets for the experimentally validated miRNAs were searched in the rice transcriptome database using psRNAtarget software (http://plantgrn.noble.org/psRNATarget/) with default parameters. A single miRNA was bioinformatically found to have a number of targets, but the targets with expectancy ≤ 3.0 were mostly considered for annotation and validation. Complete CDS of the individual targets was retrieved from the NCBI site and searched for similarity in the Oryza sativa L. indica database using BLAST programme at the EnsemblPlants resource database (http://plants.ensembl.org/index.html). The search at the EnsemblePlants resource was to ensure that the target sequence was present in the Indica variety as well [83,84].

Validation of miRNA targets by RT-qPCR

Real-time PCR (RT-qPCR) was one of the methods that was used to validate the target gene of a miRNA. Total RNA was extracted using TRIzol reagent (Invitrogen, Life Technology) from the root and shoot tissues of the control and NaCl-treated seedlings. The RNA from the individual samples was converted to cDNA using QuantiTect Reverse Transcription Kit (Qiagen). The cDNA so obtained for the individual samples served as template for the qPCR carried out using QuantiTect SYBR Green PCR Kit (Qiagen) following the kit manual. Primers specific to the individual genes and mostly 20-mer or more in length with Tm not less than 59 °C were designed using Primer Blast software at NCBI (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). LightCycler® 480II (Roche) machine was used to carry out the qPCR. For each cDNA preparation PCR was run in triplicate, and two cDNA preparations from separate biological samples were used for the determination of expression of each gene (n = 6). The expression level of actin gene (LOC_Os03g50885) in a biological sample was used for normalization of expression of a target gene in that sample. The expression of a target gene was presented as relative value in the NaCl-treated sample compared with that in the control sample following Pfaffl [85] considering the expression of actin as reference. Paired ‘t’ test was used to find out significance of difference in expression of a gene in the NaCl-treated sample compared with that in control.

Validation of miRNA targets by dual-luciferase assay

Quantification of miRNA mediated target repression was performed using dual luciferase transient expression system. It was performed by transiently expressing the miRNA alongside expressing its target gene in Nicotiana benthamiana [86]. N. benthamiana plant was grown under controlled environmental conditions for the experiment in a greenhouse. Natural day/light illumination was provided maintaining the temperature of the greenhouse at 24 ± 2 °C and relative humidity at 65–75%. Matured leaves from two months old plants were used for the transient expression of miRNA and the target gene required for dual-luciferase assay. Sense and antisense strands were synthesized for the target oligo of the individual miRNAs with AvrII restriction site introduced as extension at the 5’ end and AgeI restriction site introduced as extension at the 3’ end. The sense and anti-sense strands (5 μL each, 0.5 nM concentration) were taken in a PCR tube along with 1.67 μL 0.3 M NaCl in a final volume of 60 μL. PCR was programmed for initial temperature of 97 °C for 5 min followed by ramp down to 20 °C at 0.1 °C/s. The annealed product was double digested with AverII and AgeI for cloning into pGreen derived plasmid at 3’UTR of luciferase (Addgene ID 55206). In a separate reaction 1 μg of pGreen plasmid (ID 55206) was double digested with AverII and AgeI and the digested product was run on 1.2% agarose gel for visualization and recovery of the correct fragment for use in cloning. The double digested vector (ID 55206) and the double digested target oligo were mixed in 1:3 ratio and incubated at 16 °C for 16 h in the presence of T4 DNA ligase for the ligation to occur. The ligated product was referred as 3’-UTR sensor. For making the miRNA overexpressor construct the precursors of the individual miRNAs, the hairpin region including ~100 bp upstream and downstream sequences, were PCR amplified. The forward primer used had XhoI site and reverse primer had EcoRI site at the 5’ end. The PCR product was double digested with XhoI and EcoRI and cloned into pGreen II based vector (Addgene ID 55208). The 3’-UTR sensor and miRNA overexpressor constructs so obtained were transformed into DH5α competent cells, which were plated on agar plates following standard method for the development of colonies. Individual colonies were picked up and subjected to colony PCR and sequencing for confirmation of the presence of inserts. The 3’-UTR sensor and miRNA overexpressor plasmids were transformed into A. tumefaciens strain LBA4404 individually, and equal volume of the two was infiltrated together in the leaves of N. benthamiana. A total of nine leaves to a maximum of three leaves per plant were infiltrated. A. tumefaciens carrying the sensor construct was also infiltrated alone in similar sets of leaves. After 48 h of infiltration the leaves were harvested and frozen in liquid N2. Renilla (R) and Firefly (F) luciferase activities were estimated in the preserved leaf tissues infiltrated with both 3’-UTR sensor and miRNA overexpressor and that infiltrated only with 3’-UTR sensor. Dual-luciferase Reporter Assay System (Promega) was used to perform the luciferase assay using Glomax 20–20 luminometre (Promega). RNA was also isolated from these leaves for the study of the luciferase transcript levels. RNA isolated from the leaves of both infiltrated with 3’-UTR sensor and miRNA overexpressor together and that infiltrated with 3’-UTR sensor alone was reverse transcribed using QuantiTect Reverse Transcription Kit (Qiagen). Primers were designed for the amplification of F-luciferase and R-luciferase and were used for the qPCR. The cDNA preparations from the RNA extracted from the leaves of both infiltrated with 3’-UTR sensor and miRNA overexpressor together and that infiltrated with 3’-UTR sensor alone were used for qPCR. R-luciferase served as the reference gene for the quantification of F-luciferase expression.

Validation of miRNA targets by 5’-RACE

Ambion RLM-RACE (RLM- RNA Ligase-Mediated; RACE- Rapid Amplification of cDNA Ends) kit (Thermo Fischer Scientific) based on 5’-RACE was used for the miRNA target identification. Total RNA was isolated from the root and shoot of the NaCl treated seedlings, and 10 μg of it was incubated individually with 5’ adapter for its ligation at the 5’ end of the cleaved RNA, which contains a phosphate group because of the DICER action, following the kit manual. The ligated product (2 μL) was incubated with M-MLV reverse transcriptase, random decamers and other reagent supplied along with the RLM-RACE kit for 1 h at 42 °C for reverse transcription to cDNA to make the RACE library. The miRNA cleaved gene product was PCR amplified taking 1 μL of the concerned RACE library and using 5’ RACE adapter-specific and gene-specific outer primers. The PCR product (1 μL) was again subjected to PCR for 30 cycles using 5’ RACE and gene-specific inner primers to amplify the concerned gene-product, which was electrophoresed to get the amplicon that was excised and eluted and cloned into pGEMT easy vector. The vector along with the cloned product was transfected into DH5∞ competent cells and the transformed bacteria were grown in 1 mL LB medium at 37 °C overnight in a shaking incubator at 200 RPM. The bacteria were pelleted out and spread on LB plate that contained ampicillin. The insert in the individual white colonies was PCR amplified by colony-PCR using SP6 T7 primers and visualized on agarose gel. The band from each colony PCR was excised and sequenced, and a record was made for the number of colonies sequenced and the number of colonies that had the insert of the predicted target gene product.

Tissue level reactive oxygen species detection by DAB staining

The detection of reactive oxygen species (ROS), i.e. hydrogen peroxide (H2O2) and superoxide radical (O2˙-) was done using DAB (3, 3’-diaminobenzidine) standard staining procedure [87]. DAB solution (0.1%, pH 3.0) was prepared in Milli-Q water containing 0.05% Tween 20 and 10 mM sodium phosphate buffer (pH 7.0), followed by addition of HCl. Approximately 5 cm of the leaves cut from the control and 256 mM NaCl treated seedlings were immersed in the DAB solution in separate 15 mL falcon tubes. The tubes were gently vacuumed to allow infiltration of the DAB solution evenly for 5 min. Further, the tubes were placed on a shaker for 4–5 h shaking at 80–100 rpm. Following incubation, the solution in the individual tubes was replaced with bleaching solution (ethanol:acetic acid:glycerol 3:1:1) and placed in boiling water bath (90–95 °C) for 15 min till the leaves were fully bleached. The bleaching solution was replaced with a fresh one and kept at RT for 30 min. The leaves were stretched on glass plate and photographed for DAB staining (dark brown colour).

Localization of miRNAs in leaf tissue by in-situ PCR

Undamaged leaves of Pokkali from the control and NaCl-treated seedlings were harvested and fixed with FAA (formalin-acetic acid-alcohol) fixative by vacuum infiltration. The fixed samples were carefully embedded in paraffin blocks and sectioned (60 μm) using Leica RM2265 Rotary microtome. The sections were carefully collected in microfuge tubes for successive treatments to remove the paraffin [88]. The samples were treated with DNase. The subsequent reverse transcription reaction for the miRNA was done as described by Varkonyi et al. [89]. PCR was then done using Phusion high-fidelity DNA polymerase (NEB) following the manufacturer’s instructions. Dioxigenin-11-UTP (Roche diagnostics, 4 μM final concentration) was used in the above standard PCR as an additional reagent in order to facilitate visualization of the miRNA using specific substrate [90]. The color detection was done using BM-purple substrate (Roche diagnostics) and microscopic visualization was done on Zeiss Axio Imager M2 Microscope (Carl Zeiss, Oberkochen, Germany) under bright field illumination conditions.

Frequency of non-redundant sequences of sRNA.

(DOCX)

Click here for additional data file.

Family distribution of the conserved miRNAs.

(DOCX)

Click here for additional data file.

Family distribution of the conserved miRNAs with sequences.

(XLSX)

Click here for additional data file.

Uncropped Northern blot images of known and novel miRNAs.

(PPTX)

Click here for additional data file.

Precursor sequences of the conserved and novel miRNA and novel miRNAs hairpins.

(XLSX)

Click here for additional data file.

Uncropped Northern blot images of novel miRNAs in S. maritima and O. coarctata.

(PPTX)

Click here for additional data file.

Targets of the novel miRNAs.

(XLSX)

Click here for additional data file.

Species distribution of the conserved miRNAs.

(XLSX)

Click here for additional data file.

Probes used in the study for the detection of miRNAs.

(XLSX)

Click here for additional data file.

14 Oct 2019

PONE-D-19-25289

Identification and expression analysis of miRNAs and elucidation of their role in salt tolerance in rice varieties susceptible and tolerant to salinity

PLOS ONE

Dear Dr. Shaw,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

We would appreciate receiving your revised manuscript by Nov 28 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Alberto Amato

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2.  PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

Additional Editor Comments (if provided):

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: No

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: No

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: 1.In abstract: “However, despite the salinization issue the production of rice is required to be increased from the current figure of ~500 million tons to ~800 million tons by 2050 to meet the demand of the ever growing population”. Being general statement, it should be deleted.

2.In Materials and Methods: Kindly cite the reference mentioning that how the authors have chosen these two cultivar which it shows have contrast salt adaptive. Pl cite the references for Pokkali and badami as sensitive to salinity.

3.Line # 541: Replace the 1.5% Nacl to EC value which is more acceptable form of salinity unit

4. It is wrong to treat the two halophytes at 1.5 % as in this concentration no stress will be induced in two halophyte. Thus comparing them with rice in the same concentration will be conceptually wrong.

5.The author should cite and discuss the most related following two papers; a) Mondal TK, Ganie SA, Debnath AB (2015) Identification of novel and conserved miRNAs from extreme halophyte, Oryza coarctata, a wild relative of rice. PLoS ONE 10(10): e0140675. doi:10.1371/ journal.pone.0140675and b) Mondal TK, Panda AK, Rawal HC, Sharma T R (2018) Discovery of microRNA-target modules of African rice (Oryza glaberrima) under salinity stress. Scientific Reports 8, Article number: 570

6.What is the need of fragmented salinity treatment described in line number 562-568?

7.Line #654. Which actin gene was used as internal control? . Kinldy write the LOC number.

8.Finally since this is the sequence based research and I could not check the sequence as it was not submitted to NCBI and open for review. This is also against the policy of PLOS one

Reviewer #2: This manuscript represent an interesting investigation that focuses on identification of new salt-responsive miRNAs in two rice varieties, susceptible and tolerant to salinity, respectively. After high throughput sequencing large number of both, new and conserved miRNAs, were identified. Tissue specific expression (in roots and shoots) of some miRNA was further validated by Northern blotting and the targets of the novel miRNAs were determined by 5’RACE, dual luciferase assay and RT-qPCR.

The manuscript is well written and easy to read. Large number of data are presented in 8 figures and 7 supporting files and the obtained results support the final conclusions. Unfortunately, almost all data presented are without the number of replication and without bars for standard error or deviation.

Specific comments.

1. Abstract and discussion sections are long. Abstract should focus on the scope of the work and obtained results rather then on “ever growing population” (row 30) or world rice production (row 29).

2. Results.

a. Why authors decided to express the concentration of applied NaCl in % and not in mM as in the major number of publications?

b. Will be much easier to follow the text if data in Fig. 1 and 3 are presented in accelerating order regarding the miRNAs numbers. In the current version is difficult to find the respective miRNA on the figures. For example miR169 is following miR396 (Fig. 1) and miR12477 is after miR12478 (Fig. 3).

c. Some of the photos on Fig.3 are with bad quality (for example miR12482) and is difficult to accept the conclusions for the relative expression level. Definitely, some of the Northern must be repeated or (if available) better photos should be presented. Again, on Fig.3 differences in the expression levels of miR12475 and miR12477 are minimal and not sufficient to claim up-regulation in O. coarctata (row 249, 250). In this case, to enforce their conclusions, authors have to specify the number of Northern experiments that were done for each miRNA.

d. Fig. 6. What mean the control sample with relative expression of 1? The normal way of presentation of RT-qPCR results is 2-ΔCT.

e. Fig 7. On the upper panel scale bar is missing to confirm that the stained leaves have the same size. In this case, instead of the one dimensional and very rough densitometrical analysis, some simple but precise method for quantification of H2O2 content in DAB stained tissue should be applied (for example Ramel et al., 2009). In the lower panel of Fig. 7 the bars for standard error or deviation are missing, together with the total number of stained leaves.

3. Material and methods are long and scholastic for the level of PLOS. For example:

Row 673: The PCR tube was placed in a PCR machine…

Row 724 : The entire PCR product (50 �L) was electrophoresed on 1.5 % agarose gel….

Row 741: dissolving 50 mg in 45 ml… (only the final concentration has to be reported).

Definitely, large part of this section must be revised and shortened.

4. References. Unfortunately, all the references are presented in inappropriate way. According to the “instructions for authors” PLOS uses the reference style outlined by the International Committee of Medical Journal Editors (ICMJE). Example format:

Hou WR, Hou YL, Wu GF, Song Y, Su XL, Sun B, et al. cDNA, genomic sequence cloning and overexpression of ribosomal protein gene L9 (rpL9) of the giant panda (Ailuropoda melanoleuca). Genet Mol Res. 2011;10: 1576-1588.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

18 Feb 2020

3. Have the authors made all data underlying the findings in their manuscript fully available?

All the data related to the manuscript are available as supplementary materials and at the NCBI site “accession no. GSE133866 https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE133866”

Reviewer#1

1.In abstract: “However, despite the salinization issue the production of rice is required to be

increased from the current figure of ~500 million tons to ~800 million tons by 2050 to meet the demand of the ever growing population”. Being general statement, it should be deleted.

The concerned sentence has been modified (Please see L 27-30)

2.In Materials and Methods: Kindly cite the reference mentioning that how the authors have chosen these two

cultivar which it shows have contrast salt adaptive. Pl cite the references for Pokkali and badami as sensitive to

salinity.

References cited, as desired (Please see L521-522)

3.Line # 541: Replace the 1.5% Nacl to EC value which is more acceptable form of salinity unit

Reviewer#2 has advised to represent the NaCl concentration in mM, which has been done. Salinity as EC is generally for TDS, which is not the case here. However, as desired by the Reviewer#1, the EC value for 256 mM NaCl (1.5% NaCl) has been given in parenthesis at the first mention of the NaCl concentration (Please see L130). Reference to this has been cited in the Materials and Methods section (Please see L528-529)

4. It is wrong to treat the two halophytes at 1.5 % as in this concentration no stress will be induced in two

halophyte. Thus comparing them with rice in the same concentration will be conceptually wrong.

It is true that halophytes can tolerate high level of salinity. However, it may be noted that the two halophytes in the present case were grown without salt, and thus addition of 1.5 % NaCl, nearly 50% of the seawater salinity, is certainly going to generate response in them in order to adjust to the saline environment. And this is what is required in salt response studies, which is generally carried out at sub-lethal dose. Besides, for comparative study, it was necessary to keep the NaCl treatment concentration similar in all the plants tested.

5.The author should cite and discuss the most related following two papers; a) Mondal TK, Ganie SA, Debnath AB(2015) Identification of novel and conserved miRNAs from extreme halophyte, Oryza coarctata, a wild relative of rice. PLoS ONE 10(10): e0140675. doi:10.1371/ journal.pone.0140675and b) Mondal TK, Panda AK, Rawal HC, Sharma T R (2018) Discovery of microRNA-target modules of African rice (Oryza glaberrima) under salinity stress. Scientific Reports 8, Article number: 570

The suggested papers have been referred and cited at suitable places (Please see the citations 39 and 55)

6.What is the need of fragmented salinity treatment described in line number 562-568?

The fragmented treatment was given to allow the plant to adjust to the changing environment and to avoid salt stress shock. This has been mentioned in the manuscript (L529-531, L553)

7.Line #654. Which actin gene was used as internal control? . Kinldy write the LOC number.

LOC (LOC_Os03g50885) number of actin has been given (L639)

8.Finally since this is the sequence based research and I could not check the sequence as it was not submitted to NCBI and open for review. This is also against the policy of PLOS one

The raw sRNA data are available at the NCBI as the accession no. GSE133866

https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE133866

This has been mentioned under the data availability section of the online submission process/format

Review#2

The manuscript is well written and easy to read. Large number of data are presented in 8 figures and 7 supporting files and the obtained results support the final conclusions. Unfortunately, almost all data presented are without the number of replication and without bars for standard error or deviation.

The data have been presented without replication only for the Northern (Fig. 1, 2 and 3) and the leaf sections for visualization of miRNA expression (Fig. 8). These should be quite acceptable. In other figures the data are presented as mean � standard deviation. Fig. 7 has been revised showing DAB staining in three leaves for each case.

1. Abstract and discussion sections are long. Abstract should focus on the scope of the work and obtained results rather then on “ever growing population” (row 30) or world rice production (row 29).

The concerned sentence has been changed (L29-30). The abstract is within the permissible word limit of 300. The discussion section has been shortened by 10 lines.

a. Why authors decided to express the concentration of applied NaCl in % and not in mM as in the major number ofpublications?

NaCl concentration changed to mM.

b. Will be much easier to follow the text if data in Fig. 1 and 3 are presented in accelerating order regarding the miRNAs numbers. In the current version is difficult to find the respective miRNA on the figures. For example miR169 is following miR396 (Fig. 1) and miR12477 is after miR12478 (Fig. 3).

The miRNAs have been arranged in ascending order, as desired

c. Some of the photos on Fig.3 are with bad quality (for example miR12482) and is difficult to accept the conclusions for the relative expression level. Definitely, some of the Northern must be repeated or (if available) better photos should be presented. Again, on Fig.3 differences in the expression levels of miR12475 and miR12477 are minimal and not sufficient to claim up-regulation in O. coarctata (row 249, 250). In this case, to enforce their conclusions, authors have to specify the number of Northern experiments that were done for each miRNA.

The Northern of miR12478 and miR12482 has been repeated. The concerned sentences on the relative expression of miR12475 and miR12477 have been modified in the text (L244-246)

d. Fig. 6. What mean the control sample with relative expression of 1? The normal way of presentation of RT-qPCR results is 2-ΔCT.

Yes, the result of RT-qPCR is presented as 2-�CT. But the 2-�CT value is converted into fold change, given by 2^-ΔΔCt, and the result is expressed as fold change in expression in Treated over Control. In such case the value of control is always taken as unity. Any 2^-ΔΔCt value more than one, i.e. control, is considered as upregulation and less than one is considered as downregulation. As such there is no need of showing the value of the control, which is unity, but I have given for the sake of clarity.

e. Fig 7. On the upper panel scale bar is missing to confirm that the stained leaves have the same size. In this case, instead of the one dimensional and very rough densitometrical analysis, some simple but precise method for quantification of H2O2 content in DAB stained tissue should be applied (for example Ramel et al., 2009). In the lower panel of Fig. 7 the bars for standard error or deviation are missing, together with the total number of stained leaves.

We have done DAB staining in a way similar to Ramel et al. 2009. We have repeated the experiment, and photographed the leaves putting a scale on one side. Results of three staining have been presented. Densitometric analysis has not been done, as it can be done for only one sample.

3. Material and methods are long and scholastic for the level of PLOS. For example:

Row 673: The PCR tube was placed in a PCR machine…

Row 724 : The entire PCR product (50 �L) was electrophoresed on 1.5 % agarose gel….

Row 741: dissolving 50 mg in 45 ml… (only the final concentration has to be reported).

Definitely, large part of this section must be revised and shortened.

Material and methods section has been revised to take care of the above comments (Please see L655-657, 697-701, 714-715). However, although the minute details in the Material and Methods section has been removed from several places, the section as such could not be shortened much (not more than 12 lines), as the Northern, dual luciferase assay and 5’RACE PCR had to be described to clarity. I hope the modification done would be acceptable

4. References. Unfortunately, all the references are presented in inappropriate way. According to the “instructions for authors” PLOS uses the reference style outlined by the International Committee of Medical Journal Editors (ICMJE). Example format:

Hou WR, Hou YL, Wu GF, Song Y, Su XL, Sun B, et al. cDNA, genomic sequence cloning and overexpression of

ribosomal protein gene L9 (rpL9) of the giant panda (Ailuropoda melanoleuca). Genet Mol Res. 2011;10: 1576-1588.

The references have been thoroughly checked and formatted as per the journal’s requirement

6. PLOS authors have the option to publish the peer review history of their article (what does this mean? ). If

published, this will include your full peer review and any attached files.

Not applicable to the authors

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

13 Mar 2020

Identification and expression analysis of miRNAs and elucidation of their role in salt tolerance in rice varieties susceptible and tolerant to salinity

PONE-D-19-25289R1

Dear Dr. Shaw,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Alberto Amato

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

One of the reviewers has never submitted his report, hence as academic editor I decided to rely only on the report of Reviewer 2, who was happy with the new version you submitted (as you can see below).

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #2: The new version of the manuscript “Identification and expression analysis of miRNAs and elucidation of their role in salt tolerance in rice varieties susceptible and tolerant to salinity” is definitely improved. Authors improved also the quality of the figures and new supplementary figures are now included, although, to my opinion, the new S4 and S6 figures (Uncropped Northern blot images of known and novel miRNAs) did not contribute for the better understanding of the manuscript. Authors replied to all my comments and made the suggested changes in the text.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #2: No