Literature DB >> 32293283

Molecular cytogenetic characterization of a novel wheat-Psathyrostachys huashanica Keng T3DS-5NsL•5NsS and T5DL-3DS•3DL dual translocation line with powdery mildew resistance.

Jiachuang Li1, Li Zhao1, Xueni Cheng2, Guihua Bai3, Mao Li1, Jun Wu1, Qunhui Yang1, Xinhong Chen1, Zujun Yang4, Jixin Zhao5.   

Abstract

BACKGROUND: Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs) carries many outstanding agronomic traits, therefore is a valuable resource for wheat genetic improvement. Wheat-P. huashanica translocation lines are important intermediate materials for wheat breeding and studying the functions of alien chromosomes. However, powdery mildew resistance in these translocation lines has not been reported previously.
RESULTS: This study developed a novel wheat-P. huashanica translocation line TR77 by selecting a F7 progeny from the cross between heptaploid hybrid H8911 (2n = 7x = 49, AABBDDNs) and durum wheat line Trs-372. Chromosome karyotype of 2n = 42 = 21II was observed in both mitotic and meiotic stages of TR77. Genomic in situ hybridization analysis identified two translocated chromosomes that paired normally at meiosis stage in TR77. Molecular marker analysis showed that part of chromosome 5D was replaced by part of alien chromosome fragment 5Ns. It meant replacement made part 5DL and part 5NsL·5NsS existed in wheat background, and then translocation happened between these chromosomes and wheat 3D chromosome. Fluorescence in situ hybridization demonstrated that TR77 carries dual translocations: T3DS-5NsL·5NsS and T5DL-3DS·3DL. Analysis using a 15 K-wheat-SNP chip confirmed that SNP genotypes on the 5D chromosome of TR77 matched well with these of P. huashanica, but poorly with common wheat line 7182. The translocation was physically located between 202.3 and 213.1 Mb in 5D. TR77 showed longer spikes, more kernels per spike, and much better powdery mildew resistance than its wheat parents: common wheat line 7182 and durum wheat line Trs-372.
CONCLUSIONS: TR77 is a novel stable wheat-P. huashanica T3DS-5NsL·5NsS and T5DL-3DS·3DL dual translocation line and showed significant improved spike traits and resistance to powdery mildew compared to its parents, thus, it can be an useful germplasm for breeding disease resistance and studying the genetic mechanism of dual translocations.

Entities:  

Keywords:  Dual translocation line; In situ hybridization; Psathyrostachys huashanica; Single nucleotide polymorphism array; Wheat powdery mildew

Mesh:

Year:  2020        PMID: 32293283      PMCID: PMC7161236          DOI: 10.1186/s12870-020-02366-8

Source DB:  PubMed          Journal:  BMC Plant Biol        ISSN: 1471-2229            Impact factor:   4.215


Background

Wheat (Triticum aestivum L, 2n = 42, AABBDD) is one of the most widely cultivated crops throughout the world. Also, wheat yield can be influenced by heat, drought, insects and diseases, while relatively narrow genetic variation in wheat makes it even more difficulty to identify sources of resistance to combat these biotic and abiotic stresses [1, 2]. Wheat wild relatives, however, carry many beneficial genes that can be used to improve wheat resistance to these stresses as well as grain yield and quality [3]. For example, a wheat–Agropyron 6P chromosome disomic addition line has more kernels per spike than its wheat parent [4]; a wheat–Aegilops substitution line called PRH5 showed high iron and zinc content [5]; a wheat–Haynaldia villosa 4DL–4VS translocation line called NAU413 exhibited high resistance to wheat spindle streak mosaic virus [6]; and wheat–rye 1BL/1RS translocation lines have been widely used in wheat breeding to improve resistance to multiple diseases and abiotic stress [3, 7]. Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs) is an endangered species of Poaceae, Triticeae found only in high mountains of China. As a wild relative of wheat, it owns many outstanding traits, such as high tolerance to abiotic stress, i.e. salinity, alkalinity, cold and drought and high resistance to normal wheat diseases, i.e. rust, take-all and powdery mildew [8-11]. Our laboratory made a wide cross between P. huashanica and common wheat line 7182 in the 1980s and obtained the F1 hybrid, H811 (2n = 28, ABDNs), using in vitro culture of young embryos. The colchicine treated H811 was crossed and backcrossed to 7182 to get heptaploid hybrid H8911 (2n = 49, AABBDDNs). Subsequently, H8911 was then backcrossed to 7182 or crossed to several other wheat cultivars, and generated a series of wheat–P. huashanica derived lines including wheat–P. huashanica 1Ns–7Ns disomic addition lines [12-17], 2Ns(2D) disomic substitution line [18], 5Ns(5D) disomic substitution line [19], and translocation lines [20, 21]. These wheat–P. huashanica derived lines have more desired agronomic traits than their wheat parents, demonstrating that P. huashanica is a useful wild relative for wheat improvement. However, all the known wheat–P. huashanica translocation lines are poorly characterized [20-23]. Although previous studies identified the transposition of wheat and P. huashanica chromosomes in some wheat–P. huashanica derived lines, stability of these alien chromosomes in wheat, their homeologous relationship to wheat chromosomes, and actual translocation sites in wheat chromosomes remain to be investigated. Therefore, determining chromosomal composition of stable wheat–P. huashanica translocation lines may facilitate applications of this type of resources in wheat breeding. Disease resistance genes from wild relatives of wheat play important roles in control of powdery mildew. Among the 25 wheat closely related genera, 14 demonstrated immunity to powdery mildew, including Secale [24], Aegilops [25], Thinopyrum [26], and Haynaldia villosa [27]. P. huashanica is also immune to powdery mildew but wheat–P. huashanica derived lines with powdery mildew resistance have not been reported to date. In this study, we developed a novel wheat–P. huashanica translocation line with resistance to powdery mildew from a F7 progeny of wheat–P. huashanica heptaploid line H8911 × durum wheat (Triticum durum L, 2n = 28, AABB) line Trs-372. The objectives of this study were to: (a) determine the pairing and inherent stability of the transposed alien chromosome segment using cytogenetic methods; (b) examine the chromosomal composition of the derived line using molecular markers and fluorescence in situ hybridization (FISH); (c) determine the physical locations of the translocation sites on the chromosomes using a wheat 15 K single nucleotide polymorphism (SNP) array; and (d) evaluate the agronomic traits of the new line to predict its potential use in wheat breeding.

Results

Mitotic cells of TR77

About 98% of metaphase mitotic root tip cells (RTCs) of TR77 had a chromosome number of 2n = 42 (Fig. 1a, Table 1) among 136 microscopically screened mitotic RTCs that were randomly selected from different plants. All the chromosomes were clearly separated from each other in metaphase. Genomic in situ hybridization (GISH) analysis using the whole genomic DNA from P. huashanica as the probe and wheat 7182 as the block on the same slide identified a pair of chromosomal segments with strong yellow-green hybridization signals (Fig. 1b). Each of the signals was emitted from nearly half of the wheat chromosome, and clearly covered the entire short arm and partial long arm of the chromosome that were connected through the centromere (Fig. 1c), indicating the wheat chromosomes were evidently transposed with P. huashanica chromosomal segments. Therefore, TR77 was a wheat–P. huashanica line with a large segment translocation.
Fig. 1

Cytological and genomic in situ hybridization (GISH) analyses of root tip cells from line TR77. a Mitotic metaphase, 2n = 42. b GISH analysis of TR77. GISH was conducted using the total DNA from P. huashanica as the probe and 7182 as the block. Two chromosomal segments with fluorescent hybridization signals (yellow-green) were detected as alien chromosomes in the mitotic metaphase. c Enlarged a pair of the translocated chromosomes. The alien chromosome segment consists of the short arm and a small portion of the long arm attached to the centromere. Chromosomes were counterstained with Propidium Iodide (red)

Table 1

Chromosome numbers and pairing status in the meiotic and meiotic phases of TR77

MaterialNo. of counted cells2nChromosome configuration
UnivalentBivalentTrivalentQuadrivalent
RodRingTotal
TR77128420.12 (0–2)1.31 (1–3)19.54 (19–21)20.85 (20–21)00
Cytological and genomic in situ hybridization (GISH) analyses of root tip cells from line TR77. a Mitotic metaphase, 2n = 42. b GISH analysis of TR77. GISH was conducted using the total DNA from P. huashanica as the probe and 7182 as the block. Two chromosomal segments with fluorescent hybridization signals (yellow-green) were detected as alien chromosomes in the mitotic metaphase. c Enlarged a pair of the translocated chromosomes. The alien chromosome segment consists of the short arm and a small portion of the long arm attached to the centromere. Chromosomes were counterstained with Propidium Iodide (red) Chromosome numbers and pairing status in the meiotic and meiotic phases of TR77

Chromosomes in meiosis cells of TR77

Pollen mother cells (PMCs) in metaphase I of TR77 had a chromosome configuration of 2 n = 21II (Table 1, Fig. 2a). In meiosis anaphase I, trivalents or quadrivalents and lagging chromosomes were not observed (Fig. 2b). GISH analysis on PMCs in the important fission periods detected one tetrad with a semicircular fluorescent signal in meiosis prophase I (Fig. 2c), and then a rod chromosome with a partial yellow-green signal appeared when the chromosomes were arranged on the equatorial plate (Fig. 2d), separated into two chromosomes, and finally moved to the two poles of the cell in meiotic anaphase I (Fig. 2e). In meiosis telophase II, each of the four sperms carried a fluorescent segment (Fig. 2f). The pair of transposed P. huashanica chromosome fragments showed normal synapsis, pairing, segregation, and inheritance in the wheat background, therefore, they came from the same homoeologous groups, which confirmed that TR77 was a cytogenetically stable wheat–P. huashanica translocation line.
Fig. 2

Cytological and genomic in situ hybridization analysis of pollen mother cells of line TR77. a Meiotic metaphase I, 2n = 21II. b Meiotic anaphase I, 2n = 21 + 21. c A tetrad with a semicircular fluorescent signal in meiosis prophase I. d Rod chromosome with partial yellow-green signal observed after the chromosomes arranged on the equatorial plate. e Two chromosomes with partial hybridization signals moved to the cell poles during meiotic anaphase I. f Each of the four progeny cells had a fluorescent signal in the meiosis telophase II period. P. huashanica chromosomes were labeled by the yellow-greenish fluorescent signals

Cytological and genomic in situ hybridization analysis of pollen mother cells of line TR77. a Meiotic metaphase I, 2n = 21II. b Meiotic anaphase I, 2n = 21 + 21. c A tetrad with a semicircular fluorescent signal in meiosis prophase I. d Rod chromosome with partial yellow-green signal observed after the chromosomes arranged on the equatorial plate. e Two chromosomes with partial hybridization signals moved to the cell poles during meiotic anaphase I. f Each of the four progeny cells had a fluorescent signal in the meiosis telophase II period. P. huashanica chromosomes were labeled by the yellow-greenish fluorescent signals

Analysis of molecular markers in TR77

We screened 384 pairs of simple sequence repeat (SSR) primers distributed among the long and short arms of the wheat chromosomes to determine the homoeologous groups for the transposed wheat chromosomes in TR77 (Table S1, Figure S1). Except for 5D that have only a few markers amplified on 5DL of TR77, the markers on other wheat genomes amplified the same wheat chromosome specific bands between the wheat parent line 7182 and TR77, therefore TR77 might loss its whole short arm and part of the long arm of 5D chromosome. Further comparison of the SSR markers on the wheat 5D chromosome (Table 2, Fig. 3) between 7182 and TR77 found that the primers from 5DS and part of 5DL amplified wheat D genome-specific bands in the parent 7182, but not in TR77, confirming that the short arm and part of the long arm of the 5D chromosome were missing in the TR77, and the translocation position might be near the marker Xcfd8 because the marker Xgdm153 close to Xcfd8 did not amplify in TR77.
Table 2

Wheat SSR and EST-STS markers used in this study to analyze the chromosomal composition of TR77

markerslocus7182Trs-372TR77PPrimer(5′-3′)Tm (°C)
Barc1305DS+F: CGGCTAGTAGTTGGAGTGTTGG R: ACCGCCTCTAGTTATTGCTCTC50
Xcfd1895DS+F: GCTAAAGCCACATAGGACGG R: GCACAAGATTTTGCAAGGCT60
Xwmc3185DL+F: CGTAAAATTACGGTGCATTGAT R: GTGGACTTTTGTGGTTTTTGAG60
Xgdm1535DL+F: TATAGGCAAATTAATTAAGACG R: ATCTTTATGTGAGTACACTGC50
Xcfd85DL++F: ACCACCGTCATGTCACTGAG R: GTGAAGACGACAAGACGCAA60
Xgwm1825DL++F: TGATGTAGTGAGCCCATAGGC R: TTGCACACAGCCAAATAAGG60
Xwmc3575DL++F: TAGTGGGTGACCGGTCAAGA R: TGGACGGATTTGGTCATTTC60
BF1461875AS 5BS 5DS++F: CAAGGTGCAACAGTTCATGG R: GGTCACAGAAATATGCGGCT60
BE4446445AS 5BS 5DS++F: AAGCTTGCTGAGCTTTCTGG R: TTGAGGGATGTAGGGCAAAG60
CD4526085AS 5BS 5DS++F: TGATGTCTTGTCGTGGTCGT R: TTTTGGATGCAGCAAGACAG60

P indicates P. huashanica; + means marker is present; − means marker is absent

Fig. 3

Genotype TR77 using simple sequence repeat (SSR) markers. The SSR markers Xbarc130, Xcfd189, Xwmc318, and Xgdm153 did not amplify 5D genome-specific bands in TR77, but the markers Xcfd8, Xgwm182 and Xwmc357 amplified the same bands in TR77 as in the wheat parent 7182. Lane M: DL2000 marker; lane 1: line 7182; lane 2: line Trs-372; lane 3: line TR77. The missing D genome-specific bands were indicated by arrows

Wheat SSR and EST-STS markers used in this study to analyze the chromosomal composition of TR77 P indicates P. huashanica; + means marker is present; − means marker is absent Genotype TR77 using simple sequence repeat (SSR) markers. The SSR markers Xbarc130, Xcfd189, Xwmc318, and Xgdm153 did not amplify 5D genome-specific bands in TR77, but the markers Xcfd8, Xgwm182 and Xwmc357 amplified the same bands in TR77 as in the wheat parent 7182. Lane M: DL2000 marker; lane 1: line 7182; lane 2: line Trs-372; lane 3: line TR77. The missing D genome-specific bands were indicated by arrows Among the 78 pairs of expressed sequence tag-sequence tagged site (EST-STS) markers from seven wheat homoeologous groups, three pairs of primers, BF146187, BE444644 and CD452608, from the wheat homoeologous group 5 (5AS, 5BS, and 5DS) (Table 2, Figure S1 and Fig. 4) amplified in P. huashanica and TR77, but not in wheat line 7182, suggesting that the three markers are Ns genome-specific and alien chromosome segment in line TR77 was from P. huashanica 5Ns chromosome.
Fig. 4

Expressed sequence tag-sequence tagged site (EST-STS) markers analysis of TR77 and its parents. Three pairs of EST-STS markers BE444644, BF146187, and CD452608 corresponding homoeologous group 5 could amplify the Ns chromosome specific bands in P. huashanica and line TR77. Lane M: DL2000 marker; lane 1: line 7182; lane 2: line Trs-372; lane 3: line TR77; lane 4: P. huashanica. The diagnostic amplification products of Ns genome were indicated by arrows

Expressed sequence tag-sequence tagged site (EST-STS) markers analysis of TR77 and its parents. Three pairs of EST-STS markers BE444644, BF146187, and CD452608 corresponding homoeologous group 5 could amplify the Ns chromosome specific bands in P. huashanica and line TR77. Lane M: DL2000 marker; lane 1: line 7182; lane 2: line Trs-372; lane 3: line TR77; lane 4: P. huashanica. The diagnostic amplification products of Ns genome were indicated by arrows

FISH analysis of TR77

FISH analysis was performed to determine the transposed wheat chromosomes using repetitive oligonucleotide sequences pSc119.2 and pTa535 as probes. FISH results of line TR77, common wheat 7182 and P. huashanica could be seen in Fig. 5a, b and c, respectively. All the chromosomes of TR77 showed the same fluorescent karyotype as wheat line 7182 [28, 29], except for the chromosomes 3D and 5D (Fig. 5d) that showed translocations. One breakage site was observed between the long arm of 5D chromosome and short arm of 3D chromosomes of wheat (Fig. 5e), which was caused by loss of most portion wheat 5D chromosome and that remaining 5DL segment was combined with most portion of chromosome 3D (3DS·3DL) to become 5DL-3DS·3DL. The other breakage site was observed between the wheat 3DS chromosome and most portion of newly acquired P. huashanica chromosome 5Ns (NsL·NsS) segment (Fig. 5e) due to reciprocal translocations and recombination between remaining 3DS segment and the 5Ns segment (NsL·NsS) of P. huashanica to form a new translocation chromosome 3DS-NsL·NsS. Thus, TR77 was a translocation line with dual translocations.
Fig. 5

Fluorescence in situ hybridization (FISH) analysis of TR77. Oligo-primers pSc119.2 (green) and pTa535 (red) were used as probes for wheat chromosomes during the mitosis metaphase in the root tip cells. a line TR77. b common wheat 7182. cP. huashanica. Wheat 3D and 5D chromosomes and chromosomes from two groups underwent double translocations to yield the 3DS-NsL.NsS and 5DL-3DS.3DL chromosomes as pointed by arrows. d Comparison of special chromosomes in common wheat 7182 and TR77. e Diagrammatic sketch of the two translocations, 3DS-NsL.NsS and 5DL-3DS.3DL, in TR77 to show breakage sites in each chromosome as pointed by arrows and chromosome rearrangement. Chromosomes were stained with 4′,6-diamidino-2-phenylindole (blue)

Fluorescence in situ hybridization (FISH) analysis of TR77. Oligo-primers pSc119.2 (green) and pTa535 (red) were used as probes for wheat chromosomes during the mitosis metaphase in the root tip cells. a line TR77. b common wheat 7182. cP. huashanica. Wheat 3D and 5D chromosomes and chromosomes from two groups underwent double translocations to yield the 3DS-NsL.NsS and 5DL-3DS.3DL chromosomes as pointed by arrows. d Comparison of special chromosomes in common wheat 7182 and TR77. e Diagrammatic sketch of the two translocations, 3DS-NsL.NsS and 5DL-3DS.3DL, in TR77 to show breakage sites in each chromosome as pointed by arrows and chromosome rearrangement. Chromosomes were stained with 4′,6-diamidino-2-phenylindole (blue)

Comparison of fingerprints of TR77 and its parents using a SNP Array

To determine the chromosomal composition of TR77, wheat 15 K SNP arrays were employed to genotype TR77and its parents (Table S2). In general, significantly higher percentages of common SNP sequences on all 21 chromosomes were observed between TR77 and 7182 than between TR77 and P. huashanica except for the 5th group chromosomes that had the lowest percentages of the same SNP loci between TR77 and 7182 (Table 3, Fig. 6a) and the chromosome 5D that had the highest percentage of the same SNP loci between TR77 and the alien parent P. huashanica, confirming the translocation occurred between wheat and P. huashanica on the chromosome homeologous 5. After comparison of the corresponding SNP positions in chromosome 5D between TR77 and its parent 7182 (Fig. 6b), we found an obvious boundary between Affymetrix SNP ID Affx-111,836,242 and Affx-111,527,395 located between 202.3 Mb and 213.1 Mb of 5D chromosome and assumed that translocation occurred in this interval.
Table 3

Comparison of wheat 15 K SNP array data between TR77 and its parents

ChromosomeNo. of markersNo. of valid markers in materialsNo. of same markers (TR77 vs 7182)Percentage of same markers (TR77 vs 7182)No. of same markers (TR77 vs Trs-372)Percentage of same markers (TR77 vs Trs-372)No. of same markers (TR77 vs P. huashanica)Percentage of same markers (TR77 vs P. huashanica)
1A60740821152%30475%236%
1B67043822852%22952%327%
1D33723417173%52%
2A90760738964%16627%213%
2B73643128967%27564%174%
2D59740435387%82%
3A59439129475%14938%277%
3B99761639865%43270%203%
3D50535731989%113%
4A76654540674%39572%112%
4B58934820158%19656%154%
4D24816514890%127%
5A69041416640%20349%328%
5B76346222248%28662%225%
5D51836018050%10429%
6A46326520979%8030%114%
6B76844630669%22651%6715%
6D40427926093%114%
7A73549032667%32065%265%
7B64040435488%22856%123%
7D66546241289%123%
A genome47623120200164%161752%1515%
B genome51633145199864%187260%1856%
D genome32742261184382%1637%
Total13,1998526584269%348941%4996%
Fig. 6

Chromosomal composition of TR77 analyzed using a wheat 15 K SNP array. a Difference in the 5D chromosomes according to the percentages of the same SNP loci. b The same genotype SNPs were arranged in the 5D chromosome between TR77 and its parents. An obvious boundary was determined between Affymetrix SNP ID Affx-111,836,242 and Affx-111,527,395, where the physical location was between 202.3 Mb and 213.1 Mb

Comparison of wheat 15 K SNP array data between TR77 and its parents Chromosomal composition of TR77 analyzed using a wheat 15 K SNP array. a Difference in the 5D chromosomes according to the percentages of the same SNP loci. b The same genotype SNPs were arranged in the 5D chromosome between TR77 and its parents. An obvious boundary was determined between Affymetrix SNP ID Affx-111,836,242 and Affx-111,527,395, where the physical location was between 202.3 Mb and 213.1 Mb

Agronomic traits and resistance to powdery mildew in TR77

The agronomic traits were evaluated for TR77 and their parents (common wheat 7182, durum wheat Trs-372, P. huashanica) (Table 4 and Fig. 7). TR77 exhibited completely different spike traits from its wheat parent. TR77 had conical and awnless spikes, taller plant, longer spikes, and more kernels per spike than its parents (P < 0.01) between TR77 and its common wheat parent 7182 and Trs-372, indicating that addition of 5Ns chromosome of P. huashanica in TR77 increased spike length and spikelets number per spike, but also plant height.
Table 4

Agronomic traits of TR77, its parents, P. huashanica, common wheat 7182, and durum wheat Trs-372

MaterialPlant height (cm)Tiller numberSpike length(cm)Spikelets per spikeKernels per spikeThousand kernel weight (g)Awn type
P. huashanica63.5 ± 2.2Ddclump8.26 ± 0.96BCbc16 ± 2BCb42 ± 6Cc3.44 ± 0.11CcShort awn
718283.8 ± 1.4Bb9 ± 2Ab9.05 ± 0.57Bb18 ± 3ABa54 ± 4Bb37.69 ± 0.74AaLong awn
Trs-37276.3 ± 2.9Cc10 ± 2Aab7.91 ± 0.33Cc14 ± 2Cb43 ± 2Cc35.52 ± 0.6BbLong awn
TR7792.6 ± 2.3Aa12 ± 3Aa13.05 ± 0.77Aa19 ± 3Aa67 ± 5Aa37.56 ± 0.69AaAwnless

Different uppercase and lowercase letters indicate significant differences at p < 0.01 and p < 0.05, respectively, between the translocation line TR77 and its parents

Fig. 7

Agronomic traits and powdery mildew resistance in the translocation line TR77, its parents, and controls. a Plants. b Spikes. c Kernels. d Symptoms in response to inoculation with a mixture of Bgt race E09 races in the seedling stage. e Symptoms in response to powdery mildew after natural infection in the adult stage. The samples in the Figure are (1) P. huashanica; (2) Huixianhong; (3) 7182; (4) Trs-372; (5) TR77; (6) Mianyang 11 and (7) Chinese Spring

Agronomic traits of TR77, its parents, P. huashanica, common wheat 7182, and durum wheat Trs-372 Different uppercase and lowercase letters indicate significant differences at p < 0.01 and p < 0.05, respectively, between the translocation line TR77 and its parents Agronomic traits and powdery mildew resistance in the translocation line TR77, its parents, and controls. a Plants. b Spikes. c Kernels. d Symptoms in response to inoculation with a mixture of Bgt race E09 races in the seedling stage. e Symptoms in response to powdery mildew after natural infection in the adult stage. The samples in the Figure are (1) P. huashanica; (2) Huixianhong; (3) 7182; (4) Trs-372; (5) TR77; (6) Mianyang 11 and (7) Chinese Spring The response of TR77 to powdery mildew infection was evaluated in both a growth chamber and a field. Control varieties, TR77, and its parents were grown under the same conditions to ensure accurate results. In the seedling age, susceptible mildew infection types (IT) were observed in Huixianhong (IT = 4), Mianyang 11 (IT = 4), line 7182 (IT = 3) and Trs-372 (IT = 3), whereas P. huashanica (IT = 0) and TR77 (IT = 0;) were almost immune to powdery mildew (Fig. 7d). In the adult stage, the leaves of TR77 clearly had less spores than those of the control materials Mianyang 11 and Chinese Spring at the same positions on each plant (Fig. 7e).

Discussion

Wheat is a self-pollinating plant, and thus it may not evolve rapidly enough to meet the needs of modern humans. Modern wheat breeders usually create desired genetic variations by making crosses between breeding lines within bread wheat or using mutagenesis, transgenic approach, etc. [30]. However, for mutagenesis, controlling the direction of mutations is very difficult due to the random nature of this process, the large and complex genome of allopolyploid wheat and quantitative nature of the most target traits, and transformation genotype specificity limit transgenic wheat breeding to a few traits in a few genotypes [31], making crossing breeding the most widely used strategy for creation of new variations in wheat breeding. However, long time interbreeding has narrowed the wheat genetic diversity, and caused loss of many useful genes for disease resistance, and plant adaptation and productivity. Wide crosses between wheat and its relatives can introduce alien genetic materials into common wheat to generate desired genetic variations and create new germplasm, which is important for the sustainable development of new wheat cultivars [32]. P. huashanica is a wheat relative species with many desirable traits that are valuable for wheat improvement. Many wheat lines carrying genetic materials from P. huashanica show outstanding agronomic traits. For example, a wheat–P. huashanica 1Ns disomic addition line exhibits increased storage of microelements in the seeds [10]. In addition, 2Ns, 3Ns, 4Ns, and 5Ns disomic addition lines and a 2Ns(2D) substitution line are resistant to stripe rust [13–16, 18]. A 6Ns disomic addition line and a small segment translocation line possess twin spikelets and more kernels per spike than its wheat parent [13, 21], and a 7Ns disomic addition line showed high resistance to leaf rust [12]. However, only a few wheat–P. huashanica translocation lines are available for breeding despite its importance. In the current study, we identified and characterized a novel wheat–P. huashanica translocation line that carries part of P. huashanica 5Ns chromosome and underwent dual reciprocal translocations in the wheat 3D and 5D chromosomes. This translocation line exhibited resistance to powdery mildew, an important wheat leave disease. Whether alien chromosome segments can stably transmitted to their wheat offspring in a wheat background determines usefulness of the derived line in breeding [33]. In this study, the chromosomal compositions and behavior in the RTCs and PMCs of TR77 indicated 42 chromosomes with 21 bivalents in meiosis prophase I of TR77, with no lagging chromosomes during anaphase I. GISH analysis suggested that TR77 carries a pair of unique chromosomes that consist of chromosomal segments from both P. huashanica and wheat with the segment of P. huashanica from fifth homoeologous group (5Ns). The translocated 5Ns chromosome segment in TR77 paired normally in metaphase I and synchronized with the spliced wheat chromosome during the duplication and division phases, therefore, is stably inherited. Genome specific DNA markers can be used to identify specific wheat chromosomes and determine homoeology of alien chromosome(s) with wheat. Du et al. [13] identified a wheat–P. huashanica 5Ns disomic addition line using EST-STS markers; Li et al. [19] identified a wheat–P. huashanica 5Ns(5D) disomic substitution line using SSR, EST-STS, sequence characterized amplified region (SCAR) markers. In this study, we used wheat genome-specific SSRs and P. huashanica genome specific EST-STSs to determine the chromosomal composition of TR77 and found that SSRs on 5DS and 5DL near the centromere amplified wheat genome-specific bands in parent 7182, but not in the translocation line TR77, whereas three EST-STSs on the fifth homoeologous group [13] amplified Ns genome-specific bands in both TR77 and P. huashanica. These results indicate that the short arm and partial long arm of wheat chromosome 5D close to the centromere were replaced by P. huashanica chromosome 5Ns. Many studies found that homoeologous chromosomes are remarkably conserved and any missing genetic content is usually complemented by corresponding homoeologous chromosomes [34-37]. In the H8911 × Trs-372 cross, because Trs-372 only carries A and B genomes, chromosome recombination mainly occurred between the D and Ns genomes, in particular, the reciprocal translocation between wheat 5D and P. huashanica 5Ns chromosomes that generated a new 5DL-5NsL·5NsS chromosome. High-density SNP arrays can track sources of chromosomes from different species by comparing marker sequence identity between progeny and their donor parents. In the present study, comparison of a wheat 15 K SNP array data between TR77 and its parent 7182 confirmed that the D genome of TR77 was from 7182, whereas the A and B genomes were from chromosome recombination between wheat line 7182 and durum Trs-372. TR77 genome had extremely low similarity with the genome of P. huashanica except for the chromosome 5D of TR77 that had high percentage of SNP loci in common with P. huashanica. Also, 5D of TR77 had lower percentage of SNP loci in common with its wheat parent 7182 compared with the other chromosomes. These results indicated the translocation most likely occurred in wheat chromosome 5D, which was supported by the results from previous studies of DNA markers and GISH. To determine the translocation site, we arranged all SNP markers on the chromosome 5D based on their physical locations in Chinese Spring reference genome and identified an obvious physical boundary between 202.3 Mb and 213.1 Mb. The P. huashanica chromosomal segment was located before 202.3 Mb including the centromere region from 185.6 Mb to 188.7 Mb [38] and the common wheat (5DL) segment was located after 213.1 Mb of the chromosome. Therefore, translocation break position in TR77 is near the centromere of wheat 5D chromosome. The FISH probes, Oligo-pSc119.2 and Oligo-pTa535, can accurately distinguish all 42 common wheat chromosomes based on the standard FISH karyotypes in mitotic cells [39, 40]. Many wheat-derived lines including substitution and translocation lines have been identified using this method [41-43]. In addition, structural changes in wheat chromosomes can be detected by FISH. For example, FISH was used to confirm a reciprocal translocation of the 5BL-7BS chromosome in a wheat variety Humai15 and a reciprocal translocation of the 4BL-6AL chromosome in a wheat variety Mingxian 169 [44]. In this study, however, FISH did not detect 5DL-5NsL.5NsS chromosome, therefore, 5NsL·5NsS might undergo another translocation within wheat chromosome, which is confirmed by FISH identification of two translocations, 3DS-5NsL·5NsS and 5DL-3DS·3DL in TR77. A previous FISH karyotype study on line 7182 did not find translocation between wheat chromosomes 3D and 5D [29]. Thus, the first translocation might have occurred between the wheat 5D and P. huashanica 5Ns chromosomes to yield chromosome 5DL-5NsL·5NsS as transition, and then a reciprocal translocation occurred between the wheat 3D and 5DL-5NsL·.5NsS chromosomes that produced 3DS-5NsL·5NsS and 5DL-3DS·3DL in TR77. During the two translocation events, TR77 lost its short arm and partial long arm of wheat 5D chromosome and acquired short arm (5NsS) and partial long arm (5NsL) of P. huashanica chromosome 5. Therefore, TR77 is a wheat–P. huashanica translocation line with dual translocations of 3DS-5NsL·5NsS and 5DL-3DS·3DL. The 5NsL·5NsS segment was combined with the wheat 3D chromosome via inter-chromosomal recombination. The fifth group of chromosomes in wheat carries the Ph1 gene that controls the cross ability among species [45]. A previous study found that the wheat 5BL chromosome contained a subtelomeric insertion from wheat chromosome 3A [46]. Also a wheat line carrying T5BS.7BS, T5BL.7BL and T5AS.3BS chromosomes was identified using FISH technology [47]. Those studies support the possible reciprocal translocations between wheat chromosomes 5D and 3D occurred in this study. Powdery mildew resistance genes from wild relatives of wheat are usually durable with broad-spectrum of resistance [48]. Pm21 was transferred from Haynaldia villosa 6VS to wheat and a highly powdery mildew resistant 6VS/6AL translocation line is still effective and widely used in production [27]. The current study showed that TR77 was near immune to powdery mildew in both seedling and adult ages, although its two wheat parents exhibited susceptible symptoms, indicating that powdery mildew resistance trait in TR77 was from P. huashanica. So, the identification of TR77 filled a gap where no wheat–P. huashanica derived lines had excellent powdery mildew resistance before. Agronomic traits are important criteria for assessing the value of a line carrying alien chromosome segments. TR77 had larger spikes and more kernels per spike than its wheat parents, thereby has potential to increase yield. Crossing TR77 with locally adapted varieties can transfer these desired agronomic traits to new wheat cultivars. Line TR77 exhibited many excellent characteristics, which meant these excellent genes most possible introduced from P. huashanica because of chromosomal exchange and recombination between wheat and P. huashanica. The replaced segment were entire short arm and partial long arm of the chromosome close to centromere which was generally considered to contain few expressible genes. Therefore, the gene(s) that control awn length may be located in chromosome 5DS and raise powdery mildew resistance and spikes development may be located in chromosome 5NsS.

Conclusion

In this study, TR77 was identified as a new wheat–P. huashanica T3DS-5NsL·5NsS and T5DL-3DS·3DL dual translocation line with larger spikes, more kernels per spike, and better powdery mildew resistance than their wheat parents. Molecular, cytogenetic and phenotypic analyses on TR77 determined its chromosomal composition, translocation position and inheritance stability as well as its superior agronomic performance. TR77 can be an important germplasm for improving powdery mildew resistance and yields in wheat breeding, and for dual translocation research.

Methods

Plant materials

The plant materials include one line of Psathyrostachys huashanica Keng (2n = 14, NsNs) from Huashan Mountains, Shaanxi province, China, one common wheat (Triticum aestivum L.) line 7182 (2n = 42, AABBDD), one durum (Triticum durum) line Trs-372 (2n = 28, AABB), and the wheat–P. huashanica translocation line TR77 obtained from the F7 progeny of the cross between line Trs-372 and a wheat–P. huashanica derived line H8911(2n = 49, AABBDDNs). The heptaploid line H8911 was created by the wide cross between P. huashanica and line 7182 via artificial embryo rescue and backcross [8]. Common wheat varieties Huixianhong, Mianyang 11, and Chinese Spring were used as controls for assessing disease resistance. The wheat wild related material P. huashanica was identified and collected by Shuyang Chen and Langran Xu who were the first researchers to do hybridization between common wheat and P. huashanica in China in 1980s [8]. The wheat materials were collected from The National Wheat Improvement Center of China and the wheat–P. huashanica derived lines were developed by our lab. All materials were deposited and planted in College of Agronomy, Northwest A&F University, China. The collection and treatment of materials for this experiment complied Wild Plants Protection Regulation of China. Extraction and purification of genomic DNA from leaf tissues used the standard Cetyltrimethylammonium Ammonium Bromide method [49].

Cytological analysis

The appropriate stages for sampling were length of roots to 1.5 cm and young panicles to 5 cm [50]. The cut roots were immediately soaked in ice-water mixture for 12–20 h before transferring to Carnoy’s fixative fluid I for 24 h, and finally stored at − 20 °C. Young panicles at appropriate stage were treated with Carnoy’s fixative fluid II for 24 h and then stored under refrigeration. The root apical meristem was digested in 2% cellulase plus 1% pectinase at 37 °C for more than 50 min before scattering in acetic acid. The chromosomes in root tip cell were observed under a microscope at 400 times magnification (OLYMPUS BH2, Japan). Anthers were stained with 1% acetocarmine and gently broke for cytological observations. The slides with good split phases were dried and marked for the following experiments. Microscopic observations were the first step in order to identify the chromosomal number and behavior in TR77. In this process, each plant was numbered to ensure root and spike from the same plants.

DNA marker analysis

A total of 384 pairs of SSR primers [51, 52] were selected from 21 wheat chromosomes to determine the translocated wheat chromosomes in TR77. In addition, to identify the homoeologous group of the introduced alien chromosomes in TR77, 87 pairs of EST-STS markers (https://wheat.pw.usda.gov/SNP/new/pcr_primers.shtml) were selected from seven wheat homoeologous groups that had homoeology with corresponding chromosomes of P. huashanica. PCR assays were conducted following Doğrar et al. [53] and an ABI PRISM 3730 DNA Analyzer (Applied Biosystems, USA) was adopted for separation of the PCR products. The data of SSR markers were scored by GeneMarker V1.97 (Soft Genetics LLC, USA).

In-situ hybridization

For the GISH analysis, Mixed the P. huashanica genomic DNA and DiG-Nick Translation Mix (Roche, Germany) in a ratio of two to one at 15 °C for 1.5 h as labeling probes following Wetzel et al. [54] and Zhao et al. [55]. The addition of Anti-DigoxigeninFluorescein mix (Roche, Germany) made the probes visualize after hybridization. The wheat chromosomes were dyed using Vectashield H1300 (Vector Laboratories, USA). In the FISH analysis, the match of Oligo-pSc119.2 (6-FAM-5′CCGTTTTGTG GACTATTACT CACCGCTTTG GGGTCCCATA GCTAT) and Oligo-pTa535–1 (Tamra-5′AAAAACTTGA CGCACGTCAC GTACAAATTG GACAAACTCT TTCGGAGTAT CAGGGTTC) were used to give insight into the chromosomal composition of TR77. After hybridizing with wheat chromosomes, the standard karyotype of the two Oligo-probes could be seen [28, 39]. FISH experiment was conducted as described by Patokar et al. [56] and Lang et al. [57]. The signals were observed and captured using OLYMPUS BX60 fluorescence microscope with a color camera (Penguin, Japan) at 400 times magnification.

Characterization of wheat-P. huashanica translocation using wheat 15 K SNP arrays

High-quality genomic DNA of TR77 and its parents was used to hybrid with Illumina wheat 15 K SNP arrays for loci difference scanning in China Golden Marker Biotechnology Company (Beijing, China). The array contained 13,199 SNP loci, which were dispersed in all 21 wheat chromosomes. The total valid number of SNP loci divided by the loci number that had the same genotype in a chromosome between materials was calculated as the percentage of the same markers in each chromosome. Data analysis used SigmaPlot V12.5 (SYSTAT software, USA) and chromosomal map was drew using MapChart V2.32 (Wageningen University & Research, The Netherlands).

Characterization of agronomic traits and powdery mildew resistance

P. huashanica, TR77 and its wheat parents were evaluated in the field for seven agronomic traits, i.e. spike length, plant height, spikelet number, tiller number, kernel number, thousand-kernel weight and self-fertility. The mean values over five plants were collected in two successive years as repeats to ensure data accuracy. The powdery mildew resistance was evaluated at the seedling stage in a growth chamber. The powdery mildew Bgt race E09 was used for inoculation with wheat variety Huixianhong as a susceptible control. The pathogen spores were dusted onto wheat leaves at two-leaf stage and incubated at 22 °C and 70% humidity for 15 d. the adult plant powdery mildew resistance was evaluated in a field in Sichuan province, China using Mianyang 11 as the susceptible control. The field usually had a high incidence of powdery mildew and thus tested plants were infected naturally. The reactions to powdery mildew were assessed following Sheng [58] and An [59]. In brief, wheat responses to infection were scored using infection type (IT) in a 0–4 IT scale at the seedling stage, in which IT = 0, 0;, 1, 2, 3 and 4 denoting immune, nearly immune, highly resistant, moderately resistant, moderately susceptible and susceptible respectively. In the adult stage, the plant responses to infection were recorded as the percentage of the powdery mildew spores covered the total area of the leaves at the same position on each plant [60]. Additional file 1. Figure S1 TR77-Molecular markers uncropped images. Additional file 2. Table S1 TR77-SSR Analysis. Additional file 3. Table S2 TR77-15K SNP array.
  34 in total

1.  Use of fluorescence genomic in situ hybridization (GISH) to detect the presence of alien chromatin in wheat lines differing in nuclear DNA content.

Authors:  J B Wetzel; A L Rayburn
Journal:  Cytometry       Date:  2000-09-01

2.  Isolation and characterization of a wheat--Psathyrostachys huashanica 'Keng' 3Ns disomic addition line with resistance to stripe rust.

Authors:  Wanli Du; Jing Wang; Yuhui Pang; Liangming Wang; Jun Wu; Jixin Zhao; Qunhui Yang; Xinhong Chen
Journal:  Genome       Date:  2014-01-02       Impact factor: 2.166

Review 3.  Breeding technologies to increase crop production in a changing world.

Authors:  Mark Tester; Peter Langridge
Journal:  Science       Date:  2010-02-12       Impact factor: 47.728

4.  A high-density microsatellite consensus map for bread wheat (Triticum aestivum L.).

Authors:  Daryl J Somers; Peter Isaac; Keith Edwards
Journal:  Theor Appl Genet       Date:  2004-07-29       Impact factor: 5.699

5.  [The effect of Haynaldia villosa v chromosome on the mitochondrial proteome of wheat-H. villosa chromosome substitution line and translocation line].

Authors:  Chun Zheng Li; Hai Quan Huang; Feng Ying Yin; Zhen Ying Wang; Yong Kang Peng; Chao Jie Xie; Zhi Yong Liu; Qi Xin Sun; Zuo Min Yang
Journal:  Fen Zi Xi Bao Sheng Wu Xue Bao       Date:  2008-04

6.  Fine structure mapping of a gene-rich region of wheat carrying Ph1, a suppressor of crossing over between homoeologous chromosomes.

Authors:  Gaganpreet K Sidhu; Sachin Rustgi; Mustafa N Shafqat; Diter von Wettstein; Kulvinder S Gill
Journal:  Proc Natl Acad Sci U S A       Date:  2008-04-08       Impact factor: 11.205

7.  Molecular characterization of a new wheat-Thinopyrum intermedium translocation line with resistance to powdery mildew and stripe rust.

Authors:  Haixian Zhan; Xiaojun Zhang; Guangrong Li; Zhihui Pan; Jin Hu; Xin Li; Linyi Qiao; Juqing Jia; Huijuan Guo; Zhijian Chang; Zujun Yang
Journal:  Int J Mol Sci       Date:  2015-01-20       Impact factor: 5.923

8.  Development of a wheat-Aegilops searsii substitution line with positively affecting Chinese steamed bread quality.

Authors:  Xuye Du; Xin Ma; Jingzhi Min; Xiaocun Zhang; Zhenzhen Jia
Journal:  Breed Sci       Date:  2018-04-12       Impact factor: 2.086

9.  QTL Mapping and Validation of Adult Plant Resistance to Stripe Rust in Chinese Wheat Landrace Humai 15.

Authors:  Feng-Ping Yuan; Qing-Dong Zeng; Jian-Hui Wu; Qi-Lin Wang; Zu-Jun Yang; Bang-Ping Liang; Zhen-Sheng Kang; Xin-Hong Chen; De-Jun Han
Journal:  Front Plant Sci       Date:  2018-07-05       Impact factor: 5.753

10.  Development and molecular cytogenetic identification of a new wheat-rye 4R chromosome disomic addition line with resistances to powdery mildew, stripe rust and sharp eyespot.

Authors:  Diaoguo An; Pengtao Ma; Qi Zheng; Shulan Fu; Lihui Li; Fangpu Han; Guohao Han; Jing Wang; Yunfeng Xu; Yuli Jin; Qiaoling Luo; Xiaotian Zhang
Journal:  Theor Appl Genet       Date:  2018-10-29       Impact factor: 5.699

View more
  4 in total

1.  Cytogenetic identification and molecular marker development of a novel wheat-Thinopyrum ponticum translocation line with powdery mildew resistance.

Authors:  Guotang Yang; Chunyan Tong; Hongwei Li; Bin Li; Zhensheng Li; Qi Zheng
Journal:  Theor Appl Genet       Date:  2022-04-22       Impact factor: 5.699

Review 2.  Wheat genomic study for genetic improvement of traits in China.

Authors:  Jun Xiao; Bao Liu; Yingyin Yao; Zifeng Guo; Haiyan Jia; Lingrang Kong; Aimin Zhang; Wujun Ma; Zhongfu Ni; Shengbao Xu; Fei Lu; Yuannian Jiao; Wuyun Yang; Xuelei Lin; Silong Sun; Zefu Lu; Lifeng Gao; Guangyao Zhao; Shuanghe Cao; Qian Chen; Kunpu Zhang; Mengcheng Wang; Meng Wang; Zhaorong Hu; Weilong Guo; Guoqiang Li; Xin Ma; Junming Li; Fangpu Han; Xiangdong Fu; Zhengqiang Ma; Daowen Wang; Xueyong Zhang; Hong-Qing Ling; Guangmin Xia; Yiping Tong; Zhiyong Liu; Zhonghu He; Jizeng Jia; Kang Chong
Journal:  Sci China Life Sci       Date:  2022-08-24       Impact factor: 10.372

3.  Development and application of specific FISH probes for karyotyping Psathyrostachys huashanica chromosomes.

Authors:  Hao Zhang; Fei Wang; Chunyan Zeng; Wei Zhu; Lili Xu; Yi Wang; Jian Zeng; Xing Fan; Lina Sha; Dandan Wu; Yiran Cheng; Haiqin Zhang; Guoyue Chen; Yonghong Zhou; Houyang Kang
Journal:  BMC Genomics       Date:  2022-04-18       Impact factor: 4.547

4.  Identification of a Wheat-Psathyrostachys huashanica 7Ns Ditelosomic Addition Line Conferring Early Maturation by Cytological Analysis and Newly Developed Molecular and FISH Markers.

Authors:  Binwen Tan; Lei Zhao; Lingyu Li; Hao Zhang; Wei Zhu; Lili Xu; Yi Wang; Jian Zeng; Xing Fan; Lina Sha; Dandan Wu; Yiran Cheng; Haiqin Zhang; Guoyue Chen; Yonghong Zhou; Houyang Kang
Journal:  Front Plant Sci       Date:  2021-12-09       Impact factor: 5.753

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.