The distribution of 45S rDNA sites in bird chromosomes suggests multiple evolutionary histories.

The distribution of 45S rDNA cluster in avian karyotypes varies in different aspects, such as position, number of bearer chromosomes, and bearers being macro- or microchromosomes. The present study investigated the patterns of variation in the 45S rDNA-bearer chromosomes of birds in order to understand the evolutionary dynamics of the cluster configuration and its contribution to the evolution of bird karyotypes. A total of 73 bird species were analyzed, including both published data and species for which rDNA-FISH was conducted for the first time. In most birds, the 45S rDNA clusters were located in a single pair of microchromosomes. Hence, the location of 45S rDNA in macrochromosomes, observed only in Neognathae species, seems to be a derived state, probably the result of chromosomal fusion between microchromosomes and distinct macrochromosomes. Additionally, the 45S rDNA was observed in multiple microchromosomes in different branches of the bird phylogeny, suggesting recurrence of dispersion processeses, such as duplications and translocations. Overall, this study indicated that the redistribution of the 45S rDNA sites in bird chromosomes followed different evolutionary trajectories with respect to each lineage of the class Aves.

Introduction

The rDNA genes are extremely important for cell function, given that they encode the rRNA involved in ribosome biogenesis (Hadjiolov, 1985; Shaw and Brown, 2012). In this process, two rDNA clusters are involved: the 45S rDNA composed by 18S, 5.8S, and 28S genes, and internal (ITS1 and ITS2) and external (5’ETS and 3’ETS) transcribed spacers; and the 5S rDNA, composed by a 5S gene separated by an intergenic spacer region (IGS) (Daniels and Delany, 2003; Dyomin ). In the eukaryotic genome, multiple copies of these clusters are organized in tandem in the DNA, forming the 5S and 45S rDNA sites in the chromosome (Daniels and Delany, 2003; Dyomin ).

Identification of chromosomes that bear 45S rDNA can be performed by the silver nitrate impregnation technique (Ag-NOR) (Howell and Black, 1980). However, this procedure only identifies the chromosomes with 45S rDNA sites in transitional activity, exhibiting intercellular, and interindividual variation (Zurita ). In this way, fluorescence in situ hybridization (FISH) experiments are more appropriate for this type of study, since they allow the precise identification of the bearing chromosomes when using probes for the genes that make up the rDNA cluster even when they are not active (O’Connor, 2008).

In recent years, FISH has been increasingly used to detect rDNA-bearer chromosomes in a range of vertebrate and invertebrate species (e.g., Roy ; Cazaux ; Mazzoleni ; Sochorová ). These studies have shown that 45S and 5S rDNA sites are most frequently found in a single chromosome pair per diploid genome, although considerable variation has been observed, with up to 74 chromosome copies for the 5S rDNA cluster sites and 54 for the 45S (Sochorová ). In addition, no significant correlation has been found between the number of 5S and 45S loci, which suggests that their distribution and amplification within the karyotype follow independent evolutionary trajectories (Sochorová ).

The location of rDNA sites has been related to hotspots of chromosomal breakage (Cazaux ). This fragility is probably originated by the repetitive nature of clusters or their intense gene expression activity (Huang ). In the chromosome, these breakages may result in different types of rearrangements, such as translocation, fusions, duplications, and inversions, leading to rapid changes in the chromosomal distribution of the rDNA sites in closely related species (Datson and Murray, 2006; Degrandi ).

Birds are a highly diversified biological group with more than 10,000 species. On the other hand, less than 12% of the species have a known karyotype (Kretschmer ). The diploid number ranges from 2 n= 40, as found in Burhinus oedicnemus, to 2n = 136-142 in Corythaixoides concolor (Christidis, 1990; Nie ). However, the karyotype of birds is relatively conserved, and most species have 2n = 80. Generally, their karyotypes are characterized by the presence of macrochromosomes, which are 2.5–6 μm in length, and microchromosomes, which are less than 2.5 μm long (Rodionov, 1996; Kretschmer ). This basic karyotype structure can be seen in the species of both the Paleognathae and Neognathae clades (Kretschmer ).

Studies that have mapped the chromosomal location of 45S rDNA sites have shown considerable divergence among birds (Nishida-Umehara ; Nishida , 2013; Nie ; Tagliarini ; de Oliveira ; Kretschmer ; Degrandi ; de Oliveira ). In Paleognathae birds, the 45S rDNA is normally found in a single microchromosome pair (Nishida-Umehara ). However, in the Neognathae birds, a significant variation has been observed, including species with 45S rDNA clusters in multiple microchromosomes, in a single macrochromosome pair, or in both (Nishida ; de Oliveira ; Tagliarini, 2013; Degrandi ; de Oliveira ). However, the origin of this variation and its possible evolutionary implications are still poorly understood.

Thus, the aim of this study was to investigate this variation in 45S rDNA-bearing chromosomes of birds in order to understand the evolutionary dynamics of the cluster configuration and its contribution to the evolution of the bird karyotype.

Materials and Methods

Specimens

In this work, we analyzed the basic karyotype structure and distribution of the 45S rDNA sites in bird karyotypes. The following data were considered in each species: diploid number, number of 45S rDNA-bearing chromosomes, their type (macro- or microchromosome), and position of the clusters on the chromosome arm. First, the data were obtained from the literature, considering only the species in which the 45S rDNA clusters were identified by FISH-rDNA. Ag-NORs data were disregarded due to the intercellular and individual variations or possible false positive results, already reported in the literature.

Additionally, 29 species were selected from the sample bank of the Laboratory of Animal Genetic Diversity at Universidade Federal do Pampa for the first rDNA-FISH screening of each taxon: order Passeriformes/family Thraupidae: Tachyphonus coronatus, Coryphospingus cucullatus; Icteridae: Agelaioides badius, Molothrus bonariensis, Tyrannidae: Pitangus sulphuratus, Myiarchus ferox; Tityridae: Schiffornis virescens; Furnariidae: Dendrocolaptes platyrostris, Anumbius annumbi, Synallaxis albescens, Furnarius rufus, Cranioleuca obsoleta, Syndactila rufosuperciliata; Coraciiformes/ Alcedinidae: Chloroceryle americana; Piciformes/Ramphastidae: Ramphastos tucanus; Accipitriformes/Accipitridae: Pseudastur albicollis, Buteogallus urubitinga; Pelecaniformes/Ardeidae: Syrigma sibilatrix; Charadriiformes/Stercorariidae: Stercorarius antarcticus; Caprimulgiformes /Trochilidae: Amazilia versicolor, Nyctibiidae: Nyctibius griseus, Caprimulgidae: Hydropsalis torquata; Cuculiformes/Cuculidae: Coccyzus melacoryphus, Piaya cayana, Guira guira; Columbiformes/Columbidae: Columbina talpacoti; Tinamiformes/ Tinamidae: Nothura maculosa and Rhynchotus rufescens (Table 1).

Table 1

Distribution of 45S rDNA clusters in bird karyotypes.

Infraclass/ order	Family	Species	2n	Nº	Type of chromosome	Position	Reference
Neognathae
Passeriformes Oscines	Turdidae	Turdus rufiventris	78	6	Micro	NA	Kretschmer et al., 2014
		Turdus albicollis	78	4	Micro	NA	Kretschmer et al., 2014
	Thraupidae	Saltator similis	80	2	Micro	NA	dos Santos et al., 2015
		Saltator aurantiirostris	80	2	Micro	NA	dos Santos et al., 2015
		Tachyphonus coronatus*	80	2	Micro	NA	Present study
		Coryphospingus cucullatus	80	2	Micro	NA	Present study
	Icteridae	Agelaioides badius	80	4	Micro	NA	Present study
		Molothrus bonariensis	80	2	Micro	NA	Present study
	Fringillidae	Serinus canaria	80	4	Micro	NA	dos Santos et al., 2017
	Parulidae	Basileuterus culicivorus	80	2	Micro	NA	Present study
	Estrildidae	Taeniopygia guttata	80	2	Micro	NA	dos Santos et al., 2017
		Elaenia spectabilis	80	4	Micro	NA	Kretschmer et al., 2015
Passeriformes Suboscines	Tyrannidae	Pitangus sulphuratus	78	2	Micro	NA	Present study
		Myiarchus ferox	76	2	Micro	NA	Present study
	Tityridae	Schiffornis virescens	82	2	Micro	NA	Present study
	Furnariidae	Dendrocolaptes platyrostris*	82	2	Macro, 1th	P	Present study
		Anumbius annumbi	82	2	Micro	NA	Present study
		Synallaxis albescens	82	2	Micro	NA	Present study
		Furnarius rufus*	82	2	Micro	NA	Present study
		Cranioleuca obsoleta	82	2	Micro	NA	Present study
		Syndactila rufosuperciliata	82	2	Micro	NA	Present study
Psittaciformes		Psittacus erithacus	62-64	8	Micro	NA	Seibold-Torres et al., 2015
Falconiformes	Falconidae	Falco tinnunculus	52	4	Micro	NA	Nishida et al., 2008
		Falco peregrinus	50	12 or 14	Micro	NA	Nishida et al., 2008
		Falco columbarius	40	9	Micro	NA	Nishida et al., 2008
Coraciiformes	Alcedinidae	Chloroceryle americana	94	2	Micro	NA	Present study
Piciformes	Picidae	Colaptes campestres	84	2	Macro, 13th	I	de Oliveira et al., 2017
		Colaptes melanochloros	84	2	Macro, 13th	I	de Oliveira et al., 2017
		Melanerpes candidus	64	2	Micro	NA	de Oliveira et al., 2017
	Ramphastidae	Ramphastos tucanus*	112	2	Micro	NA	Present study
Trogoniformes	Trogonidae	Trogon s. surrucura	82	6	Micro	NA	Degrandi et al., 2017
Accipitriformes Eagles	Pandionidae	Pandion haliaetus	74	2	Macro, 2th	P, q	Nishida et al., 2014
	Accipitridae	Pseudastur albicollis	66	2	Macro, 8th	P, q	Present study
		Buteogallus urubitinga*	68	2	Macro, 8th	P, q	Present study
		Buteo nitidus	68	2	Macro, 8th	P, q	de Oliveira et al., 2013)
		Rupornis magnirostris	68	2	Macro, 8th	P, q	de Oliveira et al., 2013
		Buteogallus meridionalis	68	2	Macro, 8th	P, q	de Oliveira et al., 2013
		Harpia harpyja	58	4	Macro, 6th and Micro, 25th	S	Tagliarini, 2013
		Morphnus guianensis	82	2	Macro, 1th	S	Tagliarini, 2013
		Nisaetus n. orientalis	66	2	Micro, 29th	NA	Nishida et al., 2013
Accipitriformes Vultures	Cathartidae	Sarcoramphus papa	80	2	Micro	NA	Tagliarini et al., 2009
		Cathartes burrovianus	80	2	Micro	NA	Tagliarini et al., 2009
		Cathartes aura	80	2	Micro	NA	Tagliarini et al., 2009
		Gymnogyps californianus	80	2	Micro	NA	Raudsepp et al., 2002
Pelecaniformes	Ardeidae	Syrigma sibilatrix*	62	2	Micro	NA	Present study
Charadriiformes	Stercorariidae	Stercorarius antarcticus	84	2	Micro	NA	Present study
	Burhinidae	Burhinus oedicnemus	42	2	Macro, 13th	I	Nie et al., 2009
Caprimulgiformes Hummingbirds	Trochilidae	Amazilia versicolor	82	2	Micro	NA	Present study
Caprimulgiformes Nigthjars	Nyctibiidae	Nyctibius griseus	86	2	Micro	NA	Present study
	Caprimulgidae	Hydropsalis torquata	74	2	Micro	NA	Present study
Cuculiformes	Cuculidae	Coccyzus melacoryphus	-	2	Micro	NA	Present study
		Piaya cayana	88	2	Macro 7th	P, p	Present study
		Guira guira	76	2	Macro, 6th	P, q	Present study
Columbiformes	Columbidae	Columbina talpacoti	76	2	Micro	NA	Present study, Kretschemer et al., 2018b
		Zenaida auriculata	76	2	Micro	NA	Kretschemer et al., 2018b
		Geotrygon montana	86	2	Micro	NA	Kretschemer et al., 2018b
		Geotrygon violacea	86	2	Micro	NA	Kretschemer et al., 2018b
		Leptotila verreauxi	78	2	Micro	NA	Kretschemer et al., 2018b
		Patagioenas cayennensis	76	2	Micro	NA	Kretschemer et al., 2018b
		Columba livia	80	2	Micro	NA	Kretschemer et al., 2018b
		Columbina passerina	76	2	Micro	NA	Kretschemer et al., 2018b
		Columbina picui	76	6	Micro	NA	Kretschemer et al., 2018b
Galliformes	Phasianidae	Coturnix japonica	78	6	Micro	NA	McPherson et al., 2014
		Meleagris gallopavo	80	2	Micro, 18th	NA	McPherson et al., 2014
		Gallus gallus	78	2	Micro, 16th	NA	Dyomin et al., 2016
Paleognathae
Tinamiformes	Tinamidae	Nothura maculosa	78	4	Micro	NA	Present study
		Eudromia elegans	80	4	Micro	NA	Nishida-Umehara et al., 2007
		Rhynchotus rufescens	78	2	Micro	NA	Present study
Casuariiformes	Dromaiidae	Dromaius novaehollandiae	80	2	Micro	NA	Nishida-Umehara et al., 2007
	Casuariidae	Casuarius casuarius	92	2	Micro	NA	Nishida-Umehara et al., 2007
Struthioniformes	Struthionidae	Struthio camelus	80	2	Micro	NA	Nishida-Umehara et al., 2007
Rheiformes	Rheidae	Rhea pennata	80	2	Micro	NA	Nishida-Umehara et al., 2007
		Rhea americana	80	2	Micro	NA	Nishida-Umehara et al., 2007

Chromosome preparation

Mitotic chromosomes were obtained following standard protocols, including direct preparation from bone marrow, fibroblast culture, and lymphocyte culture (Moorhead ; Sasaki ; Garnero and Gunski, 2000).

FISH for 18S rDNA

FISH using probes specific for the 18S rDNA gene identified the 45S rDNA-bearing chromosomes. Primers were developed from sequences obtained from the fish Hoplias malabaricus (Cioffi ). This generated a fragment of approximately 1,400 base pairs, which was labeled by polymerase chain reaction (PCR), using the primers 18SF (5’CCGAGGACCTCACTAAACCA 3’) and 18SR (5’CCGCTTTGGTGACTCTTGAT-3’), with fluorescein dUTP in the PCR mix.

The PCRs were run in a final volume of 25 μL containing 2 ng of genomic DNA from H. malabaricus, 0.2 μM of each primer (18SF and 18SR), 0.2 mM of dNTP, 10X buffer (1x), 50 mM of MgCl2 (2 μM), 1 mM of Fluorescein-12-dUTP solution, 1 U/μL of Taq polymerase, and sterile H2O to complete to final volume. The thermal cycling parameters were 94 ºC for 60 s, 30 cycles of 94 ºC for 60 s, 60 ºC for 60 s, 72 ºC for 90 s, followed by an elongation step of 5 min at 72 ºC (Cioffi ).

For the FISH procedures, slides with metaphases were treated with RNase A (10 μg/mL) for 20 min and then denatured in 70% formamide at 70°C for 80 s. Subsequently, 300 ng of the 18S probe were added to each slide, which was then sealed with a cover slip and incubated overnight at 37 °C (Daniels and Delany, 2003). The slides were then washed in 50% formamide at 42 °C for 1 min (x2), 2xSSC at 40 °C for 2.5 min (x2), and once in 4xSSC Tween (1X) at room temperature. The chromosomes were counterstained with DAPI. Hybridization results were analyzed using a Zeiss Axioplan2 fluorescence microscope.

Chromosomal analyses

The diploid number of each specimen was determined from the analysis of approximately 30 mitotic cells stained with Giemsa observed under an optical microscope. Variation in the number of rDNA clusters was evaluated based on the number of chromosomes that presented a fluorescent signal. The rDNA cluster-bearing chromosomes were classified as either macrochromosomes or microchromosomes, according to their length (Rodionov, 1996). The position of the 45S rDNA cluster was classified as: (i) pericentromeric (adjacent to the centromere), (ii) subtelomeric (adjacent to the telomere), and (iii) interstitial (between the centromere and the telomere) (Cazaux ). Ideograms were created using these characteristics to represent the rDNA-bearing chromosomes in each species.

Phylogenetic comparison

The species were compared using the phylogenetic relationships proposed by Jarvis and Prum . In this step, the chromosomal locations of the 45S rDNA clusters were plotted in a modified phylogenetic tree of Jarvis . In this tree, we used the Mesquite software to exclude groups of birds for which rDNA location data were not available. We considered the presence of 45S rDNA in a single pair of microchromosomes as an ancestral condition for birds, according to the hypothesis of Nishida-Umehara . Based on this hypothesis, we analyzed the evolutionary relationships and the probable chromosomal rearrangements that would explain the variations observed in chromosomes carrying 45S rDNA.

Results

The number of chromosomes (2n), number of 45S rDNA sites, and the characteristics of these bearing chromosomes from 29 selected species for rDNA-FISH screening in this work are shown in Table 1 (see species identified as ‘present study’ in Table 1). The rDNA-FISH results of some selected species are shown in Figure 1.

Figure 1

Examples of the metaphases analyzed in the present study using the 18S rDNA probe (green) to identify the chromosomes (blue) carrying 45S rDNA sites (arrows). The acronym shown in the upper right corner of each metaphase indicates the species: Syrigma sibilatrix (SSI), Ramphastos tucanus (RTU), Tachyphonus coronatus (TCO), Buteogallus urubitinga (BUR), Furnarius rufus (FRU), and Dendrocolaptes platyrostris (DPL).

Overall, the analysis of the chromosomal distribution of the 45S rDNA included 73 bird species, representing 17 orders of the class Aves (Table 1). Eight of these species were Paleognaths, representing four orders, the Casuariiformes, Rheiformes, Struthioniformes, and Tinamiformes. The other 65 species were Neognaths, belonging to 13 orders, the Accipitriformes, Caprimulgiformes, Charadriiformes, Columbiformes, Coraciiformes, Cuculiformes, Falconiformes, Galliformes, Passeriformes, Pelecaniformes, Piciformes, Psittaciformes, and Trogoniformes.

Variation in the diploid number in birds

Considering only the bird species for which the location of 45S rDNA sites is available (73), diploid numbers ranged from 2n = 40 to 2n = 112 (Table 1). Despite this ample variation, most (38) of the species had diploid numbers between 78 and 82, and 21 were 2n = 80 (Figure 2A). While the Paleognathae species were relatively conserved, with most species having around 80 chromosomes, higher variability in 2n was observed in Neognathae (Table 1).

Figure 2

Chromosomal location of the 45S rDNA sites in all 73 bird species analyzed in the present study. (A) variation in the diploid number; (B) variation in the number of 45S rDNA bearer chromosomes; (C) the proportion of the species with 45S rDNA located in macrochromosomes or microchromosome; (D) location of the 45S rDNA cluster in the chromosome arm.

Number of 45S rDNA sites

The analysis of the number of 45S rDNA-bearing chromosomes highlighted that most (58) species had a cluster in a single chromosome pair (Figure 2B). In the Paleognathae, Nothura maculosa and Eudromia elegans were exceptions, with two rDNA-bearing chromosome pairs. In the Neognathae, the 45S rDNA clusters were found in a single chromosome pair and in up to six or seven pairs (Table 1).

Types of rDNA-bearing chromosomes

In the bimodal analysis of macrochromosomes vs. microchromosomes, the 45S rDNA sites of most (59) species were observed on microchromosomes (Figure 2C). In the Paleognathae, the rDNA was located exclusively on microchromosomes. The Neognathae presented different configurations, by contrast, with some species having the cluster in the microchromosomes, others in the macrochromosomes, and some in both types of chromosome, as observed in the Accipitriformes, Harpia harpija (Table 1).

The location of the rDNA in macrochromosomes was observed in 14 Neognathae species (Table 1), representing a number of different orders: Pandion haliaetus, Pseudastur albicollis, Buteogallus urubitinga, Buteo nitidus, Rupornis magnirostris, B. meridionalis, H. harpyja and Morphnus guianensis (Accipitriformes), Burhinus oedicnemus (Charadriiformes), Piaya cayana and Guira guira (Cuculiformes), Dendrocolaptes platyrostris (Passeriformes), Colaptes campestres, and Colaptes melanochloros (Piciformes). In some cases, it was possible to identify homologies between the macrochromosomes and those of Gallus gallus (Table 2).

Table 2

Associations of 45S rDNA sites with macrochromosomes and their respective homologies with Gallus gallus (GGA) chromosomes.

Order	Species	45S rDNA chromosome location	Homologous GGA segment *	Reference
Accipitriformes	Pandion haliaetus	2th	GGA1	Nishida et al., 2014
	Harpia harpyja	6th and 25th	GGA1	Tagliarini, 2013
	Morphnus guianensis	1th	GGA3	Tagliarini, 2013
	Pseudastur albicollis	8th	GGA7	de Oliveira et al., 2010
	Buteo nitidus	8th	GGA7	de Oliveira et al., 2013
	Rupornis magnirostris	8th	GGA7	de Oliveira et al., 2013
	Buteogallus meridionalis	8th	GGA7	de Oliveira et al., 2013
Charadriiformes	Burhinus oedicnemus	13th	2 Micro	Nie et al., 2009
Cuculiformes	Piaya cayana	7th	GGA2	Unpublished data
	Guira guira	6th	GGA2	Unpublished data

Homologies established by chromosome painting; Micro: Microchromosome.

Position of the 45S rDNA site in the chromosomes

As microchromosomes have a limited resolution, the species with rDNA sites in these tiny elements were excluded from the analysis of the rDNA topology in the chromosomes in order to avoid biases in data interpretation. Therefore, the position of the rDNA cluster was analyzed only in the 14 species in which the 45S rDNA is located in macrochromosomes.

The 45S rDNA was observed in a pericentromeric position in most (64%) cases, that is, in P. haliaetus, P. albicollis, B. urubitinga, B. nitidus, R. magnirostris, B. meridionalis (Accipitriformes), G. guira, P. cayana (Cuculiformes), and D. platirostris (Passeriformes). The interstitial position was the second most frequent, being observed in 22% of the species, B. oedicnemus (Charadriiformes), C. campestres, and C. melanochloros (Piciformes). Finally, a subtelomeric position was recorded in two (14%) species, M. guianensis and H. harpyja (Accipitriformes) (Figure 2D, Table 1).

Phylogenetic comparisons

For the phylogenetic comparisons, the presence of the 45S rDNA cluster in a single pair of microchromosomes was considered to be the ancestral condition, based on the hypothesis of Nishida-Umehara . This analysis revealed that the variation in the number of 45S rDNA-bearer chromosomes was independent of the phylogenetic relationships among the species (Figure 3). The presence of rDNA in macrochromosomes was observed in species belonging to different orders from infra class Neognathae (Figure 3).

Figure 3

Phylogenetic relationships among the birds modified from Jarvis . The data of chromosomal location of the 45S rDNA from species analyzed in the present study were plotted in the tree. (A) Species with rDNA located only in a microchromosome pair; (B) species with rDNA in multiples microchromosomes; (C) species in which the rDNA is located in macrochromosomes. The complete data are shown in Table 1.

Discussion

Here we present for the first time a broad analysis of the distribution of 45S rDNA in avian karyotype. Although an impressive variation was observed in the chromosomes carrying the 45S rDNA cluster, we recorded that in most species it is located in a single pair of microchromosomes. Interestingly, most of these species have a karyotype with 2n = 80 chromosomes (Figure 2A).

A study with rodents indicated that there is no relationship between the 2n and the number of 45S rDNA cluster bearing chromosomes (Cazaux ). Nevertheless, birds with 2n = 80 chromosomes that carry only a single pair of 45S rDNA microchromosomes seem to reflect the karyotype conservation status of these species in relation to the ancestral karyotype of birds (PAK), as proposed by Griffin . This karyotype uniformity of birds has also been observed in species from Paleognathae and Neognathae using the GGA whole chromosome paint (Kretschmer ).

The presence of a single pair of microchromosomes with 45S rDNA conserved among the species of Paleognaths (Dromaius novaehollandiae, Casuarius casuarius, Struthio camelus, Rhea pennata, and Rhea americana) suggests that this would be an ancestral condition of rDNA (Nishida-Umehara ). Using the phylogenetic relationships proposed by Jarvis and Prum , we compared these data and identified that several species of the Neognaths infraclass preserve the 45S rDNA in a pair of microchromosome (Figure 3), a fact that reinforces the hypothesis of PAK ancestral condition (Griffin ).

The 45S rDNA-bearer chromosome is related to the presence or absence of the process of karyotypic diversification. For example, Accipitriformes, where species of the Cathartidae family have karyotypes with 80 chromosomes, the 45S rDNA was located in only a single pair of microchromosomes (Raudsepp ; Tagliarini ). In contrast, the Accipitridae family shows a diploid number quite derived (2n = 58-82), and chromosome painting evidenced an extensive karyotypic reorganization, originated by breaks and fusions of macrochromosomes (GGA) and microchromosomes. In this group, it was observed that 45S rDNA is associated with different macrochromosomes (Table 2) (de Oliveira , Tagliarini, 2013; Nishida ).

45S rDNA in multiple microchromosomes

Multiple microchromosomes carrying 45S rDNA can be found in some species of the orders Tinamiformes, Columbiformes, Trogoniformes, and Falconiformes, and notably, even phylogenetically related species may differ in the number of rDNA bearing chromosomes. For instance, Paleognath birds from the order Tinamiformes show variation in the number of clusters. In R. rufescens a single microchromosome pair containing the 45S rDNA was observed, whereas in N. maculosa and E. elegans, the 45S rDNA is located in two pairs of microchromosomes (Figure 3). Similarly, such numerical variation is also seen in species of the same genus, as in the genus Falco (Falconiformes), where F. tinnunculus has 45S rDNA in four microchromosome pairs, F. columbarius in five pairs, and F. peregrinus shows this cluster in six or seven pairs (Nishida ) (Figure 3). Considering the phylogenetic relationships between these orders, the most plausible explanation for the origin of these variation are recurrent processes of 45S rDNA cluster duplications or translocations, resulting in the numerical variation observed in these species.

45S rDNA distribution in macrochromosomes

The 45S rDNA location in macrochromosomes can be considered a derived characteristic in birds (Kretschmer ). The available data on chromosomal homologies with G. gallus (GGA) (Table 2), demonstrated that the rDNA sites are clearly associated with distinct macrochromosomes. This scenario might have been originated by multiple independent events of chromosomal fusion, which are supported by several different types of evidence.

In Accipitriformes, for example, multiple associations were recorded, including GGA1, GGA3, and GGA7. In B. nitidus, R. magnirostris, and B. meridionallis, an association with the homologous GGA7 segment was found, although the short arm of the chromosome pair containing the rDNA of these species was not hybridized by any of the GGA probes used (de Oliveira ). This unhybridized region probably corresponds to the homologous of the ancestral microchromosome containing the rDNA, reinforcing the fusion hypothesis. Similarly, in P. haliaetus, the rDNA located on the q-arm of chromosome 2 was associated with the homologous GGA1 segment (Nishida ). In this species, the short arm did not hybridize by any GGA probe. However, P. haliaetus showed rDNA in the long arm, suggesting that a pericentric inversion should have occurred after fusion with the 45S rDNA microchromosome, shifting the cluster position to the long arm.

45S rDNA related to intrachromosomal rearrangements

Intrachromosomal rearrangements have been reported in bird karyotypes, and our data revealed that two cases involved the 45S rDNA-bearer chromosome (Degrandi ). For example, in Cuculiformes, Piaya caiana and Guira guira showed the association of 45S rDNA with a segment homologue to chromosome GGA2 (Table 2). In P. caiana, the cluster was in the pericentromeric region of the short arm of the submetacentric chromosome pair 7, whereas in G. guira the cluster was in the long arm pericentromeric region of the metacentric chromosome 6 (Figure 3). In Accipitriformes Harpia harpyja and Pandion haliaetus, the association was with a segment homologue to chromosome GGA1 (Table 2). However, in H. harpyja, the rDNA cluster was seen in the subtelomeric region of macrochromosome 6, and in P. haliaetus, the cluster occupied the pericentromeric region of the long arm on chromosome 2 (Figure 3) (Tagliarini, 2013; Nishida ). The translocation or a pericentric inversion may explain this position variation of the internal 45S rDNA cluster in the bearer chromosome, which corroborates the hypothesis that the 45S rDNA cluster is related to chromosomal breakpoints, according to Cazaux .

Conclusion

In birds, the 45S rDNA site is located predominantly in a single pair of microchromosomes, although a number of deviations from this basic pattern exist, with some species having rDNA located in more than one microchromosome pair or in macrochromosomes, or in both types of chromosome. The present study also demonstrated that the redistribution of rDNA sites within the chromosome complement has resulted from chromosomal rearrangements, which have resulted from the distinct evolutionary histories of each group of the class Aves.