Systems pharmacology reveals the mechanism of activity of Physalis alkekengi L. var. franchetii against lipopolysaccharide-induced acute lung injury.

Acute lung injury (ALI) is an important cause of mortality of patients with sepsis, shock, trauma, pneumonia, multiple transfusions and pancreatitis. Physalis alkekengi L. var. franchetii (Mast.) Makino (PAF) has been extensively used in Chinese folk medicine because of a good therapeutic effect in respiratory diseases. Here, an integrated approach combining network pharmacology, proton nuclear magnetic resonance-based metabolomics, histopathological analysis and biochemical assays was used to elucidate the mechanism of PAF against ALI induced by lipopolysaccharide (LPS) in a mouse model. We found that the compounds present in PAF interact with 32 targets to effectively improve the damage in the lung undergoing ALI. We predicted the putative signalling pathway involved by using the network pharmacology and then used the orthogonal signal correction partial least-squares discriminant analysis to analyse the disturbances in the serum metabolome in mouse. We also used ELISA, RT-qPCR, Western blotting, immunohistochemistry and TUNEL assay to confirm the potential signalling pathways involved. We found that PAF reduced the release of cytokines, such as TNF-α, and the accumulation of oxidation products; decreased the levels of NF-κB, p-p38, ERK, JNK, p53, caspase-3 and COX-2; and enhanced the translocation of Nrf2 from the cytoplasm to the nucleus. Collectively, PAF significantly reduced oxidative stress injury and inflammation, at the same time correcting the energy metabolism imbalance caused by ALI, increasing the amount of antioxidant-related metabolites and reducing the apoptosis of lung cells. These observations suggest that PAF may be an effective candidate preparation alleviating ALI.

INTRODUCTION

Acute lung injury (ALI) manifests as an uncontrolled inflammatory cascade. It is associated with high mortality rate linked to acid aspiration, sepsis, transfusion injury, ischaemia reperfusion, aspiration of gastric contents, major trauma and acute pancreatitis.1, 2 Acute respiratory distress syndrome (ARDS) is the most severe clinical presentation of ALI. It is characterized by injury of the alveolar‐capillary system, increase in the pulmonary vascular permeability, diffuse alveolar damage, intra‐alveolar fibrin, organization interstitial oedema and inflammatory cell infiltration. Furthermore, ARDS has a high mortality rate, surpassing 40%‐60% in patients with the most severe forms of the disease.3, 4 Currently, the treatment of ALI/ARDS at home and abroad mainly involves the following groups of drugs: anti‐inflammatory drugs, vasomotor drugs, surfactants, statins, antioxidants, glucocorticoids, β2‐receptor agonist, stem cell therapy, etc.5, 6, 7, 8 However, the aetiology and pathogenesis of ALI/ARDS are complex, with no specific drugs and specific therapies.

Lipopolysaccharide (LPS), a component of the cell envelope of gram‐negative bacteria, is commonly used to induce pharmacological ALI models.9, 10, 11 LPS is also considered as a key molecule that triggers the innate immune response and acute inflammation. It activates the Toll‐like receptor (TLR) 4, which subsequently leads to the activation of nuclear factor‐kappa B (NF‐κB) and mitogen‐activated protein kinase (MAPK) pathway. This induces excessive expression of chemokines and pro‐inflammatory cytokines, such as the tumour necrosis factor‐α (TNF‐α), interleukin (IL)‐1β and IL‐6.11, 12 In addition, oxidative stress signalling is involved in modulating the LPS‐induced inflammatory reaction via activation of transcription factor NF‐E2‐related factor 2 (Nrf2) and reducing the accumulation of reactive oxygen species (ROS). Haem oxygenase‐1 induction by Nrf2 protects against the cytotoxicity of various oxidative stresses and inflammatory response.13

Recently, the paradigm for the studies of traditional Chinese medicines (TCMs) was shifted from ‘one drug, one target’ to ‘multi‐component therapeutics, biological networks’.14 Several approaches have been developed to study the complex effects of TCMs on the biological system. Systems pharmacology is a new approach that integrates pharmacology, multiple‐omics techniques, network biological information analysis and molecular biology technology, enabling the exploration of TCMs across multiple scales of complexity, from molecular and cellular level to tissue and organism level.15 Network pharmacology is a valuable approach for systematic pharmacology research and a tool for achieving a holistic view of, and comprehensive and systematic insight into the mechanisms of activity of multi‐ingredient medicine. It aligns with the TCM theory of highlighting holistic thinking and multilevel interactions among herbs, targets and diseases.16 Another approach, metabolomics, is more sensitive than general pharmacodynamic analysis and has a great advantage for the studies of complex diseases, which comprise dynamic responses to the changes of both endogenous and exogenous factors.17 Therefore, systems pharmacology can constitute a novel strategy to uncover the bioactive components and underlying mechanisms of TCM from a systemic and holistic perspective.

Physalis alkekengi L. var. franchetii (Mast.) Makino (PAF) (Chinese name: Jindenglong) is a well‐known edible and medicinal plant, abundantly distributed in the north‐east region of China. PAF is not only consumed as a dietary supplement, but also used for the treatment of respiratory diseases. It is widely used in the Chinese folk medicine, as has been recorded in many Chinese medical documents, for instance, ‘Shennong's Classic of Materia Medica’ (Shen Nong Ben Cao Jing) and ‘Compendium of Materia Medica’ (Ben Cao Gang Mu).18 Biologically active metabolites, such as physalins, flavones, phenylpropanoids and alkaloids, have been isolated from different parts of PAF. They have many pharmacological activities, such as antifungal, anti‐inflammatory, antioxidant, antitumour and hypoglycaemic activity, acting as febricide or expectorant, or diuretic, etc.19, 20, 21, 22 We have previously reported that PAF has excellent antibacterial and anti‐inflammatory activities, and that it can alleviate xylene‐induced ear oedema in mouse and inhibit granulomatous tissue formation induced by cotton pellet.23 In addition, we have identified the chemical components in PAF in our previous work and found that the main components are physalins and flavonoids (Figure S1).

In this study, we aimed to determine whether PAF could be used to treat ALI. Because of the complexity of ALI pathogenesis and the diversity of chemical components of PAF, elucidating the mechanism of PAF activity against ALI using a research strategy focusing on a single TCM component would have been difficult. Therefore, we set out to delineate the interactions between active ingredients, genes, proteins and small‐molecule metabolites on a systemic level, to reveal the molecular mechanism of PAF action against ALI. The potential mechanisms of ALI were investigated using systems pharmacology and confirmed by molecular and biochemical approaches.

MATERIALS AND METHODS

Data preparation

Identification of ALI targets and PAF composite compounds

The therapeutic targets for the treatment of ALI were identified by searching the following databases: (a) Therapeutic Target Database (TTD, https://db.idrblab.org/ttd/); (b) the DrugBank database (DrugBank, https://www.drugbank.ca/); (c) a database of gene‐disease associations (DisGeNET, http://www.disgenet.org/); and (d) Online Mendelian Inheritance in Man (OMIM, http://omim.org/) database.24 The symbols and UniProt ID numbers of the identified 159 target genes related to ALI were consolidated in Excel.

All the composite compounds of PAF were obtained from the Traditional Chinese Medicine Systems Pharmacology Database (TCMSP, http://tcmspw.com/tcmsp.php)25 and literature review. The screening index based on OB ≥ 0.3 or DL ≥ 0.18 was not used because that would result in filtering out the main effective components (eg physalins) of PAF. Overall, 70 candidate compounds were identified, including flavonoids, physalins, alkane and others, for further analysis.

Prediction of composite compound targets

To establish a direct link between the potential active compounds of PAF and the target, target selection for active compounds remains an urgent step. The component targets were collected from DrugBank and PubChem (https://pubchem.ncbi.nlm.nih.gov/) databases, and the potential targets of the identified compounds were predicted based on the 2D or 3D structure of the molecular scaffold. The SMILES number of each compound was used to predict the targets in the SwissTargetPrediction database (http://www.swisstargetprediction.ch/). Disease targets and compound targets were analysed to obtain candidate targets for the treatment of ALI.

Network construction

To investigate the multiple molecular mechanisms used by active PAF compounds against ALI and further clarify the relationship between the active targets and active compounds, the two following networks were constructed using Cytoscape 3.2.1 (https://cytoscape.org/index.html): (a) the compound‐target network of PAF and (b) the compound‐target‐mechanism network. Cytoscape is an open and free source software platform commonly used to visualize the molecular interaction networks and biological pathways, and integrating these networks with annotations, gene expression profiles and other data. In the networks, the nodes represent the compounds, targets or pathways, and the edges represent the compound‐target or target‐pathway interactions.

Network analysis

Using the topological parameter analysis in Cytoscape 3.2.1, gene ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment were performed by linking targets to the Database for Annotation, Visualization and Integrated Discovery (DAVID, v 6.8, https://david.ncifcrf.gov/). P‐values were derived from the DAVID and set to below .05. A small P‐value indicates greater enrichment than a large P‐value.

Metabolomics analysis and pharmacological verification

Experimental animals and treatment

Eighty male BALB/c mice (22 ± 2 g) were used for the ALI experiment. Experimental animals were purchased from the Laboratory Animal Center of Guangzhou University of Chinese Medicine (certificate no. SCXK 2018‐0034). All animals were acclimatized to the laboratory conditions for 3 days before the experiment. The animals were housed individually in polypropylene cages and maintained under standard conditions of alternating 12‐h light and dark cycles, at a constant temperature of 22 ± 2°C and relative humidity of 50 ± 5%. The experimental animals were provided with free access to standard laboratory animal food and water ad libitum. The animal experimental protocol was approved by the Animal Care Committee of Guangdong Pharmaceutical University (no. 20170142). All procedures in the study were performed according to the ‘Guide for the Care and Use of Laboratory Animals’.

The mice were randomly divided into four groups, each containing 10 mice: (a) the control group; (b) the model group (LPS group); (c) the PAF (500 mg/kg) group; and (d) the LPS + PAF (500 mg/kg) group. The PAF and LPS + PAF groups were given PAF (500 mg/kg) by gavage for 7 days, while the other two groups were given the same volume of saline. The PAF dose used in the study was based on the dose determined earlier.23 The murine model of LPS‐induced ALI was established as previously described.26 LPS (5 mg/kg) was injected intraperitoneally after the last administration of PAF 1 hour; 6 hours later, blood samples were collected from the orbital vascular plexus, and then, mice were killed. The blood and lung tissues were harvested and stored at −80°C for subsequent analysis.

Plant material

The calyces of Physalis alkekengi L. var. franchetii (Mast.) Makino were collected from Maoer Mountain in Heilongjiang Province in 2018. The original plant was identified by Professor Shuyuan Li (Guangdong Pharmaceutical University). A voucher specimen (no. 20180928) was deposited in the Herbarium of Guangdong Pharmaceutical University. PAF extracts were prepared as previously described.23

Reagents and chemicals

LPS (Escherichia coli 055:B5) and deuterium oxide (D2O, 99.9%) were obtained from Sigma‐Aldrich. The kits for determining the malondialdehyde (MDA) content, the activity of glutathione peroxidase (GSH‐Px) and superoxide dismutase (SOD), and TNF‐α, IL‐1β and IL‐6 levels were from Jiancheng Bioengineering Institute. ROS enzyme‐linked immunosorbent assay (ELISA) kits were purchased from RapidBio Lab. A terminal deoxynucleotidyl transferase‐mediated dUTP nick end‐labelling (TUNEL) assay kit was purchased from Roche Diagnostics GmbH. Diethyl pyrocarbonate was obtained from Sangon Biotech. Protein extraction kits were from CoWin Biosciences Co., Ltd., and BCA kit was from Pierce Corporation. Primary antibodies against NF‐κB (p65), Nrf2, p‐p38, p38, JNK, p‐JNK, ERK, p‐ERK, COX‐2, p53, caspase‐3 and β‐actin were obtained from Santa Cruz Biotechnology, Inc. TRIzol reagent was from Invitrogen Inc, and PrimeScript™ RT Reagent Kit and SYBR® Premix Ex Taq™ II Kit were from Takara Biotechnology Co., Ltd.

Serum sample preparation and 1H‐nuclear magnetic resonance (NMR) spectroscopy

The serum samples were transferred to 4°C, thawed and vortex‐mixed to ascertain uniform thawing. Then, 300 μL of each serum sample was mixed with 300 μL of phosphate buffer solution (0.2 mol/L Na2HPO4 and 0.2 mol/L NaH2PO4, pH 7.4). The above solution was prepared with D2O and contained 0.05% 3‐trimethylsilylpropionic acid as an internal standard. After centrifugation at 20 100 g for 10 minutes, the supernatant (550 μL) was transferred into a 5‐mm NMR tube. NMR spectra were recorded using a Bruker AV 500 MHz spectrometer. A transverse relaxation‐edited Call‐Purcell‐Meiboom‐Gill sequence 90‐(τ‐180‐τ)‐n‐acquisition with a total spin‐echo delay (2nτ) of 10 mseconds was used to attenuate the broad signals from the proteins. The 1H‐NMR spectra were acquired over 128 scans into 32‐k data points over a spectral width of 10 000 Hz. The spectra were Fourier‐transformed after multiplying by an exponential window function with a line broadening of 0.5 Hz and then were manually phased and baseline‐corrected using TopSpin software (version 3.0, Bruker Biospin). Data processing and analysis were as described.27

Lung wet/dry weight ratio determination

The wet/dry weight ratio was calculated to assess the lung tissue oedema. Briefly, lung tissues were excised and immediately weighed to record the wet weight. They were then heated at 80°C for 48 hours to obtain the dry weight. The W/D ratio was then calculated.

Histological lung evaluation

To evaluate the histological changes in the lung tissue, the tissues were fixed in 4% paraformaldehyde solution (pH 7.4), for 24 hours at 4°C, dehydrated, embedded in paraffin blocks and sectioned to 4.0 μm thickness. After deparaffinization and dehydration, the sections were stained with haematoxylin and eosin (H&E) using standard histological techniques and observed under a light microscope (Olympus Co., Ltd.).28, 29

Immunohistochemical analysis

The presence of caspase‐3, p53 and COX‐2 was determined in paraffin sections by immunohistochemical staining. Briefly, the paraffin‐embedded sections were deparaffinized and pre‐treated in citrate buffer (pH 6.0) in a microwave, and the endogenous peroxidase activity was neutralized using 0.3% hydrogen peroxide. Then, the tissue was evenly covered with 3% BSA and incubated sealed at 25°C for 30 minutes. The non‐specific protein interactions were blocked with normal rabbit serum. The sections were probed with the primary rabbit anti‐caspase‐3 (1:200), anti‐COX‐2 (1:200) and anti‐p53 (1:500) polyclonal antibodies at 4°C overnight. After rinsing with PBS (pH 7.4), the sections were incubated for 50 minutes at room temperature with HRP‐goat anti‐rabbit IgG antibody (1:200). The sections were then incubated with diaminobenzidine at a chromogenic substrate, counterstained with haematoxylin and visualized under the Olympus IX73. The extent of cell immunopositivity was assessed visually.

TUNEL staining

The lung tissues were fixed in 4% paraformaldehyde prior to paraffin embedding and then cut into 4‐μm sections. TUNEL staining was used to evaluate the apoptosis rate, as previously described.30 The TUNEL assay was performed using a TUNEL assay kit, according to the supplier's protocol. Finally, the samples were stained with 4′,6‐diamidino‐2‐phenylindole (DAPI) for 25°C 10 minutes to visualize the cell nucleus. DAPI stains both apoptotic and non‐apoptotic cells; the apoptotic cells were recognized by coinciding TUNEL and DAPI staining. Under UV illumination, the nucleus stained with DAPI was blue, and the apoptotic nucleus was green. The apoptotic cells were observed under inverted fluorescence microscope (Olympus IX73, Japan), and the results were expressed as the average number of TUNEL‐positive cells per 200 × magnification field.

Measurement of pro‐inflammatory mediator and cytokine levels

The effects of PAF on the expression of LPS‐induced pro‐inflammatory cytokines (TNF‐α, IL‐1β and IL‐6) and the pro‐inflammatory mediator (PEG2) in the lung tissue were determined using the relevant ELISA kits. The optical density of each sample well was assayed at 450 nm using a microplate spectrophotometer (BioTek Epoch). The levels of assayed molecules were calculated based on the appropriate standard curves.

Determination of MDA content, SOD and GSH‐Px activities, and ROS levels in the lung tissue

The MDA content, SOD and GSH‐Px activities, and ROS levels in the lung tissue were determined using commercially available kits, according to the manufacturers’ instructions.

Reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR)

Total RNA was extracted from lung tissues from mice from all groups using TRIzol, following the manufacturer's instructions. RNA was suspended in ultrapure water treated with diethyl pyrocarbonate. The optical density (OD) of samples was measured at 260 and 280 nm using an ultraviolet/visible spectrophotometer (Titertek Berthold Colibri). The concentration of total RNA was determined. The RT step was performed using the PrimeScript™ RT Reagent Kit. The target and reference mRNA were amplified using SYBR® Premix Ex Taq™ II Kit and LightCycler 96 (Roche). The reactions were performed in 10 μL volumes, and gapdh (Sangon Biotech) was the internal reference. The target genes and primers used are presented in Table 1. The amplification reaction involved pre‐incubation at 95°C for 30 seconds; followed by 40 cycles of melting at 95°C for 30 seconds, 65°C for 60 seconds and 97°C for 1 second; and cooling at 37°C for 30 seconds. Experiments were conducted in triplicate for each sample to obtain the mean value. Dissociation curve analysis was used to evaluate the reliability of PCR results. Cycle threshold (Ct) value was obtained from the point of inflection of the amplification curve, and 2−ΔΔCt represented the ratio of the relative expression of the target gene. The following formula was used: ΔΔCT = [Ct (target gene) − Ct (internal)] sample − [Ct (target gene) − Ct (internal)] control.31

TABLE 1

Primers used for RT‐qPCR

Name	Primer sequence (5′ to 3′)	GenBank accession no.	Product size (bp)
TNF‐α	ATGTCTCAGCCTCTTCTCATTC GCTTGTCACTCGAATTTTGAGA	NM_001278601.1	179
IL‐1β	TCGCAGCAGCACATCAACAAGAG TGCTCATGTCCTCATCCTGGAAGG	NM_008361.4	118
IL‐6	CTCCCAACAGACCTGTCTATAC CCATTGCACAACTCTTTTCTCA	NM_001314054.1	97

Western blotting

Western blotting was conducted as previously described.32 Briefly, the lung tissue was lysed in RIPA buffer supplemented with protease inhibitors, 4°C for 30 minutes. The supernatant was collected by centrifugation for 20 minutes at 20 100 g and 4°C. Protein concentrations were quantified by using a BCA Protein Assay Kit. The protein samples were separated on 10% SDS‐polyacrylamide gels and electrophoretically transferred onto PVDF membranes. After blocking in 5% non‐fat milk for 2 hours, the membranes were incubated with antibodies against ERK, p‐ERK, p38, p‐p38, JNK, p‐JNK, NF‐κB (p65) and Nrf2 at 4°C overnight. The membranes were washed three times with TBST and incubated with secondary antibodies. Finally, the protein bands were visualized using an enhanced chemiluminescence reagent (KeyGen Biotechnology, Nanjing, China) and quantified using the ImageJ software.

Statistical analysis

All experiments were repeated at least three times. The experimental results are expressed as the mean ± standard deviation (SD). One‐way analysis of variance (ANOVA) analysis followed by Student's t test for pairwise comparisons was used for the intergroup analysis; P < .05 was considered statistically significant. The principal component analysis (PCA) and partial least‐squares discriminant analysis (PLS‐DA) were performed on SIMCA 14.1 (Umetrics). GraphPad Prism 8.0 software (GraphPad) was used for graphics.

RESULTS

The compound‐target network analysis

To better understand the therapeutic effect of PAF on ALI, 70 PAF components and 159 potential ALI targets were identified and retrieved from relevant databases. After mapping analysis, a network composed of 65 nodes (32 candidate target nodes and 33 compound nodes) and 88 edges was constructed. The PAF compounds from the database are consistent with the compounds identified in our previous work, mainly physalins and flavonoids. According to the analysis of topological parameters, the network was constructed with the degree as the criterion. While quercetin and luteolin occupied a very important position in the network, some targets were regulated by multiple compounds and may play important roles in the treatment of ALI, such as prostaglandin G/H synthase 2 (PTGS2), peroxisome proliferator‐activated receptor gamma (PPARG), adenosine receptor A1 (ADORA1) and tumour necrosis factor (TNF) (Figure 1A; Table 2). Notably, the most important target node was PTGS2. Using a higher than average degree of 2.708 as the screening criterion, the active components and targets greater than the mean degree were selected, forming the core network (Figure 1B).

FIGURE 1

Network pharmacology analysis of PAF. A, Establishment of compound‐target network of PAF. A compound and a target linked if the target protein was hit by the corresponding compound. Node colour is relative to its degree (the darker the colour, the greater the degree). B, The core network of anti‐ALI in PAF. Core targets and compounds are filled with yellow. C, Target‐pathway‐biological process association chart. The different colours indicate the different biological functions or metabolic pathways, and the longer the band, the greater the relevance of the targets to the pathway. D, ClueGO analysis of the candidate targets. The node pie charts represent the molecular function and reactome analysis of these targets. E, Compound‐target‐pathway network

TABLE 2

Information of candidate targets, their corresponding gene symbols and their degrees of correlation with compounds in the core network of anti‐ALI in PAF

Symbol	Target name	UniProt ID	Degree	Betweenness centrality
PTGS2	Prostaglandin‐endoperoxide synthase 2	P35354	22	0.60031628
PPARG	Peroxisome proliferator‐activated receptor gamma	P37231	6	0.39578975
ADORA1	Adenosine a1 receptor	P30542	5	0.28739429
TNF	Tumour necrosis factor	P01375	5	0.01408255
CASP3	Caspase 3 apoptosis‐related cysteine protease	P42574	4	0.08883493
NFE2L2	Nuclear factor, erythroid 2‐like 2	Q16236	3	0.11184012
NFKB1	Nuclear factor‐kappa B, subunit 1	P19838	3	0.08275305
ERBB2	V‐erb‐b2 avian erythroblastic leukaemia viral oncogene homolog 2	P04626	3	0.0601265
TP53	Tumour protein p53	P04637	3	0.01703266
MMP12	Matrix metalloproteinase 12	P39900	3	0.03610124
ALOX5	Arachidonate 5‐lipoxygenase	P09917	3	0.04091226

In addition, 32 candidate targets were subjected to GO analysis involving 121 biochemical processes or pathways (Figure 1C). These 121 metabolic pathways or biological processes represented 16 types of biological functions (Figure 1D): regulation of peptide hormone secretion; regulation of phosphatidylinositol 3‐kinase signalling; response to oxygen levels; regulation of blood vessel diameter; response to hyperoxia; nitric oxide metabolic process; positive regulation of ROS metabolic process; lipid storage; cellular response to external stimulus; response to UV; regulation of reactive oxygen species metabolic process; muscle cell proliferation; regulation of smooth muscle cell proliferation; regulation of oxidoreductase activity; cellular response to oxygen levels; and reactive oxygen species metabolic process. Most of these functional groups are related to redox and oxygen metabolism, with the biochemical processes belonging to the active oxygen metabolism process being the most abundant (ie accounting for the greatest area of the pie chart) and involving 27 candidate targets.

The KEGG pathway enrichment analysis of candidate targets conducted using the online DAVID yielded 64 pathways, diseases or biological processes. After screening at P < .05, 15 signalling pathways were obtained (shown in Table 3). Considering the P‐value of the enrichment data, the distribution of the core target and the results of the correlation analysis between the candidate target and the pathway, we predicted that the mechanism of action of PAF against ALI might be related to NF‐κB, TNF, HIF‐1, MAPK and the apoptotic pathway. At the same time, inextricable links may exist between these pathways and the high‐frequency targets NFKB1, TNF, TP53 and CASP3, and the core target PTGS2.

TABLE 3

The key correlation pathway

Term	Name	%	P value	Genes
hsa04066	HIF‐1 signalling pathway	25	1.00E‐07	EGFR, CDKN1A, HIF1A, HMOX1, ERBB2, NFKB1, NOS2, STAT3
hsa04668	TNF signalling pathway	21.875	4.37E‐06	CASP3, TNF, PTGS2, MAPK14, CXCL2, IL1B, NFKB1
hsa04621	NOD‐like receptor signalling pathway	15.625	8.04E‐05	TNF, MAPK14, CXCL2, IL1B, NFKB1
hsa04071	Sphingolipid signalling pathway	18.75	1.26E‐04	TNF, MAPK14, TP53, NFKB1, ADORA1, PTEN
hsa04068	FoxO signalling pathway	18.75	2.12E‐04	EGFR, CDKN1A, MAPK14, CAT, PTEN, STAT3
hsa04010	MAPK signalling pathway	21.875	5.43E‐04	EGFR, CASP3, TNF, MAPK14, TP53, IL1B, NFKB1
hsa04620	Toll‐like receptor signalling pathway	15.625	9.40E‐04	TNF, MAPK14, TLR2, IL1B, NFKB1
hsa04210	Apoptosis	12.5	.00216	CASP3, TNF, TP53, NFKB1
hsa04115	p53 signalling pathway	12.5	.00269	CDKN1A, CASP3, TP53, PTEN
hsa04064	NF‐kappa B signalling pathway	12.5	.00563	TNF, PTGS2, IL1B, NFKB1
hsa04151	PI3K‐Akt signalling pathway	18.75	.01354	EGFR, CDKN1A, TP53, TLR2, NFKB1, PTEN
hsa04622	RIG‐I‐like receptor signalling pathway	9.375	.03473	TNF, MAPK14, NFKB1
hsa04917	Prolactin signalling pathway	9.375	.03564	MAPK14, NFKB1, STAT3
hsa04020	Calcium signalling pathway	12.5	.03856	EGFR, AGTR1, ERBB2, NOS2
hsa04062	Chemokine signalling pathway	12.5	.04246	NCF1, CXCL2, NFKB1, STAT3

The effect of PAF treatment on LPS‐induced lung injury in mouse

The effects of PAF on LPS‐induced lung injury were first evaluated by histological analysis. We found that LPS elicited severe inflammation, including alveolar hyperaemia, infiltration of inflammatory cells, lung epithelial cell detachment and necrosis. However, treatment with PAF (500 mg/kg) significantly alleviated the observed pathologies (shown in Figure 2A). Furthermore, the lung wet/dry ratio, an important indicator of the severity of pulmonary oedema, indicated no significant differences between the control and PAF groups (P > .05), indicating that PAF did not affect the lung water content in mouse (Figure 2B). The lung wet/dry ratio was obviously increased after the LPS challenge (P < .01). However, PAF pre‐treatment before LPS stimulation reduced the increase in the lung wet/dry ratio (P < .05).

FIGURE 2

The effect of PAF treatment on LPS‐induced lung injury. A, Lung tissue sections were stained with haematoxylin and eosin (H&E) for histopathology analysis (magnification 200×), n = 3. Pathological changes in the LPS + PAF groups were notable improvement and were virtually indistinguishable from those with control group. B, Lung wet/dry ratio. Dissected lung tissues were weighed and oven‐dried at 80°C for 48 h for calculation of wet/dry ratio. The values represent the means ± SD. ## P < .01 vs the control group; *P < .05 vs the LPS group

PAF treatment reduces the levels of apoptosis‐related proteins in the lung tissue of mouse with LPS‐induced ALI

Caspase‐3 is usually found in the cytoplasm in an inactive form. However, when a cell undergoes apoptosis, caspase‐3 is proteolytically activated into cleaved caspase‐3, a biomarker of apoptotic activity.33 Expression of the apoptosis‐related protein p53, a tumour suppressor gene, can promote apoptosis. Apoptotic cells show green fluorescence after TUNEL staining and brown by immunohistochemistry. Therefore, we assessed the degree of apoptosis in cells from the mouse lung tissue based on TUNEL staining and immunohistochemistry. As shown in Figure 3, tissues from the control group and the PAF group contained almost no apoptotic cells, while many green fluorescent (TUNEL‐positive) spots were apparent in the LPS group tissues. After PAF pre‐treatment, however, the number of apoptotic cells in the lung was significantly reduced (P < .01). On the other hand, caspase‐3 and p53 proteins were highly abundant in the lungs of LPS‐induced ALI mice, as determined by immunohistochemistry staining (P < .01). This confirmed and activated the apoptotic pathway in the lung tissue of the LPS group. Compared with the LPS group, the caspase‐3 and p53 protein levels in the LPS + PAF group were significantly decreased, which demonstrated that PAF impaired the activation of the apoptotic pathway and alleviated ALI by reducing the expression of caspase‐3 and p53 gene.

FIGURE 3

Apoptosis detection of LPS‐induced ALI lung injury. A, From top to bottom: DAPI staining, TUNEL staining, immunohistochemistry staining of caspase‐3 and p53 protein (magnification 200×). B, TUNEL staining result, n = 3. C, Representative images of caspase‐3 protein level in lung determined by immunohistochemistry, n = 3. D, Representative images of p53 protein level in lung determined by immunohistochemistry, n = 3. The values represent the means ± SD. ## P < .01 vs the control group; *P < .05, **P < .01 vs the LPS group

PAF treatment inhibits LPS‐induced inflammatory response in the lung

Pro‐inflammatory mediators and cytokines are produced by the activated immune cells and are expeditiously involved in the early phase of inflammatory response. They play a key role in the progression and pathogenesis of ALI/ARDS.34, 35 We observed that PAF treatment significantly decreased TNF‐α, IL‐1β and IL‐6 secretion, and their mRNA levels compared with the LPS group (P < .01; P < .05) (Figure 4A). Furthermore, the expression of the inflammatory mediator prostaglandin E2 (PGE2) in the lung tissue was greatly diminished (Figure 4B). At the same time, immunohistochemical analysis indicated that PAF effectively reduced the COX‐2 protein levels (Figure 4C).

FIGURE 4

Effects of PAF on the LPS‐induced inflammatory response in the lung. A, PAF treatment inhibits the expression of protein and mRNA of pro‐inflammatory cytokines, such as TNF‐α, IL‐6 and IL‐1β, n = 6. B, The effects of PAF on the expression of LPS‐induced pro‐inflammatory mediator (PEG2) in the lung tissue. C, PAF treatment inhibits the expression of COX‐2 protein. D and E, The effects of PAF on LPS‐induced ERK, p‐ERK, JNK, p‐JNK, p38, p‐p38 and NF‐κB expression detected by Western blotting (n = 4). The values represent the means ± SD. # P < .05, ## P < .01 vs the control group; *P < .05, **P < .01 vs the LPS group

NF‐κB is a key transcription factor that increases the expression of pro‐inflammatory enzymes and cytokines but only upon translocation to the nucleus.36 Meanwhile, MAPKs (JNK, p38 and ERK) play important roles in modulating cell growth and differentiation, as well as in the control of the cellular responses to cytokines and various stresses.37 By using Western blotting, we found that PAF significantly blocked nuclear expression of NF‐κB (p65) and phosphorylation of JNK, p38 and ERK (Figure 4D,E). However, no significant changes in the measured parameters were apparent between the PAF group and the control group.

PAF treatment alleviates oxidative damage in the lung of ALI mouse

Oxidative stress modulated by ROS is one of the factors responsible for the occurrence and development of ALI. ROS, including the hydroxyl radical (HO−), superoxide ( ) and hydrogen peroxide (H2O2), are mainly generated by Nox.38 Rising ROS levels accompany the decline in oxidative defence mechanism to establish oxidative stress state.39 MDA is a decomposition product of lipid hydroperoxides, used as an indicator of oxidative damage in cells and tissues. In addition, SOD and GSH‐Px are important radical superoxide scavengers, which protect the cell from oxidative damage.40 The result was confirmed that PAF pre‐treatment significantly reduced the ROS levels and MDA content, as well as increased the activity of SOD and GSH‐Px in LPS‐stimulated ALI mice (Figure 5A,C). Western blotting analysis indicated that Nrf2 levels decrease after LPS stimulation. However, after PAF pre‐treatment, the expression of Nrf2 was significantly increased (P < .01) (Figure 5B), that is, PAF activated the Nrf2 signalling pathway, which could effectively inhibit the continued activation of NF‐κB signalling pathway and reduce the accumulation of ROS.

FIGURE 5

PAF promotes the expression of Nrf2‐mediated antioxidative enzymes and inhibits deposition of ROS. A, The effects of PAF on MDA level as well as SOD and GSH‐Px activities, n = 8 per group. B, The relative expression levels of Nrf2 relative to β‐actin, n = 4. C, The effects of PAF on ROS level, n = 8 per group. D, Schematic diagram of PAF anti‐ALI mechanism. PAF activates Nrf2 signalling pathway to attenuate oxidative stress damage as well as suppresses NF‐κB, MAPK and apoptosis signalling pathway. The values represent the means ± SD. ## P < .01 vs the control group; *P < .05, **P < .01 vs the model group

Metabolomics analysis of the effect of PAF on LPS‐induced ALI in mouse

Analysis of the 1H‐NMR spectra

The normalized typical 1H spectra of the serum samples obtained from the control, LPS, PAF and LPS + PAF groups are presented in Figure 6A. The metabolite peaks were assigned by referencing published data 41, 42 and by searching the publicly accessible metabolomic databases, such as HMDB (http://www.hmdb.ca), KEGG (http://www.kegg.jp) and Chenomx NMR Suite (version 7.5, Chenomx, Inc). Thirty‐two small‐molecule metabolites were identified in the serum, mainly amino acids and sugar metabolites. Details of the identified metabolites are provided in Table 4.

FIGURE 6

Metabolomics analysis of the effect of PAF on LPS‐induced ALI in mice. A, Typical 500 MHz CPMG 1H NMR spectra of the serum samples from mice. Metabolites: 1, isoleucine; 2, leucine; 3, valine; 4, 3‐hydroxyisobutyrate; 5, methylsuccinate; 6, 3‐methyl‐2‐oxovalerate; 7, methylmalonate; 8, 3‐hydroxybutyrate; 9, CH2 in fatty acids; 10, lactate; 11, alanine; 12, lysine; 13, acetate; 14, acetoacetate; 15, pyruvate; 16, succinate; 17, glutamine; 18, citrate; 19, creatine; 20, carnitine; 21, betaine; 22, taurine; 23, glucose; 24, fumarate; 25, tyrosine; 26, phenylalanine; 27, carnosine; 28, anserine; 29, xanthine; 30, tryptophan; 31, oxypurinol; and 32, formate. B, Scores plots for PCA (a) and scores plots for PLS‐DA (b). C, Colour‐coded coefficient loading plots of metabolomic profiles in mouse serum. The red‐coloured variables in the loading plots contributed more to the grouping than the blue‐coloured variables. D, Potential marker metabolites and their fold changes among PAF treatment groups and the associated P‐values in serum based on 1H NMR. Colour coded according to the fold change (FC), red represents higher and blue represents lower concentrations of metabolites. P values corrected by Benjamini‐Hochberg methods were calculated based on a parametric Student's t test or a nonparametric Mann‐Whitney test. *P < .05, **P < .01, ***P < .001

TABLE 4

Identified metabolites of the serum in different groups

NO.	Metabolites	Assignments	Chemical shifts
1	Isoleucine	δCH3, γCH3, αCH	0.94 (t), 1.01 (d), 3.66 (d)
2	Leucine	δCH3, δCH3, γCH, αCH	0.96 (d), 0.97 (d), 1.70 (m), 3.73 (t)
3	Valine	γCH3, γCH3, αCH	1.00 (d), 1.05 (d), 3.62 (d)
4	3‐Hydroxyisobutyrate	CH2, CH3	1.19 (t), 3.65 (q)
5	Methylsuccinate	CH3	1.05 (d)
6	3‐Methyl‐2‐oxovalerate	β‐CH3	1.08 (d)
7	Methylmalonate	CH3	1.18 (d)
8	3‐Hydroxybutyrate	CH3, CH2	1.20 (d), 2.30, 2.41 (dq)
9	CH2 in fatty acids	CH2	1.28 (m)
10	Lactate	CH3, CH	1.33 (d), 4.12 (q)
11	Alanine	βCH3, αCH	1.49 (d), 3.78 (q)
12	Lysine	δCH2, βCH2, εCH2	1.72 (m), 1.91 (m), 3.30 (t)
13	Acetate	CH3	1.92 (s)
14	Acetoacetate	CH3	2.23 (s)
15	Pyruvate	CH3	2.33 (s)
16	Succinate	CH2	2.41 (s)
17	Glutamine	βCH2, γCH2, αCH	2.46 (m)
18	Citrate	CH2	2.65 (m)
19	Creatine	CH3, CH2	3.04 (s), 3.93 (s)
20	Carnitine	CH3	3.19 (s)
21	Betaine	CH3	3.21 (s)
22	Taurine	CH2	3.28 (t), 3.44 (t)
23	Glucose	CH	3.51 (m), 3.73 (m), 3.87 (m)
24	Fumarate	CH	6.52 (s)
25	Tyrosine	CH, CH	6.90 (d), 7.19 (d)
26	Phenylalanine	CH	7.38 (m)
27	Carnosine	CH	7.15 (s), 8.03 (s)
28	Anserine	CH	7.1 (s)
29	Xanthine	CH	7.69 (s)
30	Tryptophan	CH	7.55 (d), 7.74 (d)
31	Oxypurinol	CH	8.17 (s)
32	Formate	CH	8.46 (s)

Abbreviations: d, doublet; dd, doublet of doublets; dq, doublet of quartets; m, multiplet; q, quartet; s, singlet; t, triplet.

Multivariate and univariate data analysis

Standard NMR data were processed by PCA and partial least‐squares discriminant analysis (PLS‐DA) using the SIMCA software. PCA, which is unsupervised and requires no group information for each subject, was used to describe the metabolic patterns and detect outliers among the serum samples.43 The results are presented with score plots, to visualize the classification, and with colour‐coded loading plots, to reveal most differentiating metabolites. The S‐plot was used to visualize metabolites that were distinctive both statistically and biochemically, according to their reliability and contribution to the classification. The further the metabolite was from the centre, the greater its contribution to the separation between the groups. The fold‐change (FC) value for each metabolite and the corresponding P‐value calculated by the Benjamini‐Hochberg procedure are all presented in coloured tables.

Based on the PCA S‐plot and PLS‐DA S‐plot, a good separation between the groups was observed. The LPS group and control group data were located the farthest from one another, with the LPS + PAF group data located between the two, and the PAF group and the control group data located the closest to one another (Figure 6B). This indicated that PAF alleviates the metabolic imbalance caused by ALI in mouse, while simply administering PAF does not change the mouse normal metabolic balance. As indicated by the load chart, many small‐molecule metabolites changed significantly in content between the groups (Figure 6C). The differential metabolites selected based on the PLS‐DA S‐plot were further investigated by univariate analysis. Indeed, most of the important differential metabolites were significantly changed (the results of the analysis are presented as a coloured table, Figure 6D). The corresponding colours in the table reflect the P‐value for the metabolite in group comparisons. The analysis revealed that the content of most of the identified 32 small‐molecule metabolites changed significantly, which was consistent with the results of the multivariate analysis load chart and S‐plot. Compared with the control group, the content of CH2 in fatty acids, acetoacetate and xanthine significantly increased, while that in 3‐hydroxybutyrate, acetate, glucose, pyruvate, glutamine, citrate, betaine, carnitine and other metabolites was greatly reduced in the LPS group (P < .01). After PAF pre‐treatment, these metabolite levels were obviously recovered.

Metabolic pathway analysis

To explore the possible metabolic pathways related to ALI, the list of perturbed endogenous metabolites was imported into the web‐based MetaboAnalyst 3.6 system for pathway analysis and visualization.44 The metabolic pathway analysis data are shown as a bubble chart in Figure 7A. The five major metabolic pathways were as follows: phenylalanine and tyrosine metabolism (a); ketone body metabolism (b); transfer of acetyl groups into the mitochondria (c); carnitine synthesis (d); and tricarboxylic acid citric acid cycle (TCA cycle) (e). Based on the above pathway analysis, we generated a schematic diagram of the metabolic pathway correction by PAF in ALI, as determined by 1H‐NMR. The relationships between the identified metabolic pathways are shown in Figure 7B. It can be seen that LPS‐induced ALI is mainly reflected in energy metabolism and lipid metabolism in the mouse model. In addition, redox reactions involve multiple aspects in the metabolic process. LPS‐induced ALI causes metabolic disorders in mice, and PAF can effectively correct this imbalance.

FIGURE 7

Metabolic pathway analysis. A, The main metabolic pathways in response to LPS‐induced ALI mice. Pathway analysis performed by MetaboAnalyst 3.6. All the matched pathways are displayed as circles. The colour and size of each circle were based on the pathway impact value. The size of the bubble is proportional to the importance of the pathway, and the colour of the bubble corresponds to the significance of the pathway (from red for the most significant to white for the least significant). B, Schematic diagram of pathway analysis for differential metabolites

DISCUSSION

ALI and its severest form, ARDS, are a threat to public health because of high morbidity and mortality. LPS endotoxin, derived from the cell wall of gram‐negative bacteria, induces the infiltration of inflammatory cells, overproduction of inflammatory mediators, tissue oedema and injury.45 LPS‐induced ALI in mouse provides a ideal and reliable research model. PAF belongs to the family Solanaceae, which has attracted increased attention recently because of the potential biological functions. PAF effectively relieves respiratory diseases and is widely used in folk medicine, with an obvious clinical effect demonstrated.46 Therefore, we speculated that PAF could also exert a therapeutic effect on pulmonary inflammatory diseases, and we performed a related system pharmacology research to explore the therapeutic effect and the putative mechanism involved.

Network pharmacology is based on the rapid development of ‐omics and database information, and combines many emerging interdisciplinary disciplines, such as systems biology and bioinformatics. It is used to understand the role of the relationship between drugs and organisms from the perspective of improving or restoring the balance of biological networks, and to conduct an overall analysis of biological system networks.47 It is a new approach of drug‐target exploration and for the identification of potential active ingredients in TCM research.48 In the present study, we used network pharmacology to analyse and predict the main drug targets and mechanism of ALI protection. The analysis predicted that quercetin and luteolin are the core components of the compound‐target network of PAF against ALI. As has been shown by many studies, flavones effectively remove active oxygen clusters and reactive nitrogen clusters in the body, and have antioxidative, anti‐allergy, anti‐inflammatory, antiviral and other pharmacological effects.49, 50 These are used to reduce cell damage caused by oxidative stress and to establish a balance between organisms and toxic active metabolites produced during metabolic processes, especially during inflammatory reactions.

Oxidative stress in the lung tissue has been considered to be an important contributor to the pathogenesis of ALI. ROS can cause serious damage to the cellular structure and function by eliciting DNA damage, lipid peroxidation and activation of transcription factors, such as NF‐κB.51 As determined in multiple related studies, Nrf2 is an important transcription factor that plays a protective role in oxidative stress, and promotes the expression of genes involved in oxidative stress, inflammation, apoptosis and autophagy.52, 53 The importance of Nrf2 activation in the protection against lung injury has also been reported. Under normal physiological conditions, Nrf2 combines with Keap1 in the cytoplasm. When the cells are subjected to a variety of exogenous stimuli, Keap1 is degraded by ubiquitination and dissociates from Nrf2. Then, Nrf2 binds with antioxidant response element in the nucleus and activates the transcription of relevant genes.12, 54, 55 Analysis performed in the current study indicates that quercetin, luteolin and other flavones from PAF can act as ROS scavengers, inhibit ROS production, reduce the content of MDA and activate related antioxidant enzymes (SOD and GSH‐Px), thereby effectively reducing the oxidative stress damage and the production of inflammatory mediators, and activating the Nrf2 signalling pathway to exert antioxidant and anti‐inflammatory effects. The antioxidation effect of PAF is consistent with the GO analysis of network pharmacology, which suggested that PAF could reduce the oxidative stress damage by regulating the redox reaction in the body.

Notably, physalins had a low degree in the network constructed in the current study. They are not the core network components, but they are mostly linked to the core target PTGS2. In addition, they have significant anti‐inflammatory activity.18, 23 We therefore speculated that physalins considerably contribute to the anti‐ALI effect of PAF. PTGS2 is the most important target in the network. It is the target of 22 constituents of PAF and acts in the NF‐κB and TNF signalling pathways. PTGS2, also known as cyclooxygenase‐2 (COX‐2), is a key enzyme in the initiation of prostaglandin synthesis in vivo. Meanwhile, PTGS2 is an inducible inflammatory response gene that produces prostaglandins during inflammation, regulates mitosis and is involved in cell growth. PTGS2 produces PGE2 in a series of complex processes under the action of phospholipase A2 (PLA2) catalysing the release of arachidonic acid (AA) and its enzymes by phospholipids. PGE2 is a potent inflammatory mediator that mediates pain and fever in the inflammatory response. Therefore, PTGS2 mediates the occurrence and development of inflammation, suggesting that the occurrence, development and outcome of ALI are inextricably linked with inflammation. The GO and KEGG analysis indicated that the mechanism of PAF action against ALI may be related to NF‐κB, TNF, MAPK and the apoptosis pathway, while being closely associated with the high‐frequency targets NFKB1, TNF, TP53 and CASP3, and the core target PTGS2. Therefore, based on these predictions of network pharmacology, we moved to validate the mechanism of PAF activity by using the mouse model.

MAPKs are serine/threonine kinases that require dual phosphorylation (threonine and tyrosine) for enzymatic activation. In mammals, they are divided into three major families (ERK, JNK and p38). According to some studies, the activation of JNK and p38 contributed to LPS‐induced organ injury, whereas the inhibition of JNK and p38 improves the survival of septic mice.56 Among the diverse array of MAPKs, extensive attention has been given to p38 MAPK because of its capacity to transduce and amplify the intracellular inflammatory response.57 In the current study, we investigated the phosphorylation of p38, JNK and ERK in the mouse model of ALI and found that these protein levels were significantly reduced after PAF pre‐treatment. That was consistent with the outcomes of network pharmacology analysis and suggests that PAF plays a protective role in ALI by affecting the MAPK signalling pathway.

One of the well‐studied transcription factors downstream of MAPK signalling is NF‐κB. NF‐κB is also one of the downstream core factors of the TLR4 signalling pathway and plays a crucial role in inflammatory response and cellular apoptosis.58 Canonical NF‐κB protein is a heterodimer predominantly located in the cytoplasm. It is activated during inflammation to upregulate the production of cytokines to maintain inflammatory cascades.57, 59 Therefore, inhibition of NF‐κB activation might help to mitigate inflammation and further decrease the damage caused by excessive inflammatory responses. In the network analysis performed in the current study, NF‐κB and TNF are key targets in the core network and most frequently appear in the key association pathways. TNF‐α, the first multifunctional cytokine released by monocytes and macrophages stimulated by LPS, elicits the inflammatory cascade and contributes to the process of ALI, often acting synergistically with IL‐1β and IL‐6.35, 45 In the current study, ELISA and RT‐qPCR data revealed that PAF significantly reduced TNF‐α, IL‐1β and IL‐6 expression on the gene and protein levels, and also significantly reduced the PGE2 levels in the lung. At the same time, the expression of COX‐2 (determined by immunohistochemistry) and NF‐κB (p65) (determined by Western blotting) was significantly reduced. Hence, PAF regulated the inflammation‐related genes and proteins, reducing the release of inflammatory mediators to further inhibit inflammation. Coincidently, this mechanism is in agreement with the putative signalling pathway indicated by network pharmacology analysis.

Apoptosis is inextricably linked with excessive inflammatory cascades and oxidative stress. It is also recognized as a major contributor to LPS‐induced pulmonary dysfunction. LPS upregulates caspase‐3 proteases, causing apoptosis of the pulmonary cells.60 Caspases are important components of the apoptotic pathway and originally exist as an inert zymogen. After stimulation by exogenous or intracellular components, execution‐type caspases (caspase‐3, caspase‐6 and caspase‐7) are hydrolysed and activated to complete the cleavage of specific protein substrates, altering cell morphology and metabolism, ultimately inducing apoptosis and cell clearing.61 Caspase‐3 is therefore a specific performer in the process of apoptosis and is the terminal gene of the apoptotic pathway. Another protein, p53, is a very important tumour suppressor and a central mediator that controls cell proliferation and apoptosis. It can stop cell processes and trigger apoptosis.62 The TUNEL and immunohistochemistry analysis performed in the current study indicated that PAF significantly reduced the high levels of caspase‐3 and p53 induced by LPS. In addition, p53 and caspase‐3 were the core candidate targets in the component target networks. Hence, PAF exerts an anti‐apoptotic effect, which can be attributed to its anti‐inflammatory and antioxidant properties. The apoptotic pathway hence lies at the intersection of NF‐κB, TNF and MAPK signalling pathways associated with ALI and is the final path towards the development of lung cell damage.

According to previous studies, sepsis caused by LPS can lead to increased energy expenditure, resulting in increased muscle breakdown and disturbance in the energy metabolism. Further, LPS‐induced lung injury can cause ATP decline in the lung tissue because of inducing mitochondrial dysfunction.63, 64, 65, 66 At the onset of ALI, the energy production is greatly enhanced to meet the energy demand of the metabolism enhanced in response to an acute inflammatory response.67 When the energy demand increases but the supply is insufficient, energy metabolism becomes imbalanced. In the current study, glucose, pyruvate, citrate, succinate and creatine levels were significantly reduced after LPS induction, and the levels of acetoacetate and xanthine were significantly increased. This indicated energy metabolism imbalance in ALI mouse. The levels of citric acid, an important TCA intermediate, significantly decreased in the serum of the LPS group, indicating that the main energy supply mode (the TCA cycle) was obstructed. The TCA cycle is the most important energy metabolism pathway in the body, and its disturbance will inevitably lead to energy metabolism imbalance.27, 63 The lack of pyruvate feeding into the TCA cycle and the obstruction of the TCA cycle further reduce the formation of citric acid. The aerobic oxidation of sugar is the main energy‐generating pathway in the body. Insufficient energy in turn enhances other energy production pathways, such as the creatine and phosphate creatine (Cr‐PCr) balance system and ketone body metabolism.43 As a reservoir of high‐energy ATP phosphate bonds, phosphate creatine and creatine are also consumed in large amounts to maintain a constant ATP level. Ketone bodies, including acetoacetate, 3‐hydroxybutyrate and acetone, can also be used as fuels when energy is insufficient. ALI greatly increased the energy demand, resulting in enhanced fat breakdown. This could explain the elevated levels of metabolites related to fatty acid β‐oxidation, for instance, increased acetoacetate levels in the LPS group serum. The above findings demonstrate that energy metabolism in the ALI mouse was severely altered.

Further, the metabolic analysis indicated decreased levels of branched‐chain amino acids (leucine, isoleucine and valine) in ALI mouse, which may be related to the excessive energy consumption by the body, and increased levels of xanthine levels, which may increase the accumulation of uric acid and further aggravate inflammatory diseases. Therefore, we speculated that LPS‐induced ALI might also affect amino acid metabolism and nucleic acid metabolism. PAF treatment significantly corrected the content of glucose, pyruvate, citrate and succinate in the serum of mice, indicating that the TCA cycle is significantly enhanced in response to PAF. As the energy supply increased, other compensation pathways were no longer be needed, and the energy metabolism imbalance was alleviated.

Further, the analysis of small‐molecule metabolites indicated that levels of many such metabolites related to antioxidants significantly change after LPS induction. Compared with the control group, the serum levels of betaine, taurine, carnitine and glutamine in the LPS group were significantly reduced, further confirming the occurrence of oxidative stress injury. According to many studies, betaine and taurine not only act as antioxidant agents, but also as organic regulatory osmolytes to protect the cell from oxidative damage, and maintain the structural and functional integrity of the membranes.64, 68 Carnitine is also a widely known antioxidant and protector against apoptosis. In fact, carnitine treatment improved oxygen saturation and bronchus‐associated inflammation.69 In addition, glutamine is an important precursor of GSH, which is a major intracellular antioxidant that plays an important role in preventing oxidative stress.67 At the same time, the significant decrease in glutamine levels after severe trauma is highly likely to be the rate‐limiting factor for GSH synthesis. As a result, the body's antioxidant capacity continues to decrease, lipid peroxidation increases, and the immune response is impaired. In the present study, the activity of GSH‐Px was significantly decreased after LPS induction, which also reflected the possibility that the synthesis of GSH might be hindered and the body's antioxidant capacity decreased. Hence, the decreased levels of these metabolites suggested their overconsumption to counteract the damage caused by oxidative stress in ALI mouse. PAF treatment significantly enhanced the levels of betaine, taurine, carnitine and glutamine, manifesting their ability to improve the oxidative stress status, which could be ascribed to their activation of Nrf2.

In conclusion, we here used systems pharmacology to systematically reveal that PAF can effectively improve oxidative stress damage and inflammatory response induced by ALI. PAF inhibited inflammatory pathways, such as NF‐κB and MAPK signalling pathway, and the transduction of the apoptotic pathway, meanwhile activating the Nrf2 signalling pathway to reduce oxidative stress damage and further inhibit the NF‐κB signalling pathway (Figure 8). In addition, PAF improved energy metabolism imbalance associated with LPS‐induced ALI. Since we did not perform studies of the mitochondrial function, we currently cannot elaborate on the exact relationship between energy metabolism disorder and mitochondrial dysfunction in ALI. In a follow‐up study, we plan to delineate the mechanism whereby PAF regulates the mitochondrial function. Combined with metabolomics analysis, this line of research will help to clarify the complex pathological mechanism of ALI and to more comprehensively evaluate the overall therapeutic effect of PAF in ALI.

FIGURE 8

Schematic diagram illustrating the protective effects of PAF on LPS‐induced acute lung injury via activating Nrf2 signalling pathway, increasing antioxidant content to attenuate oxidative stress damage and suppressing NF‐κB and MAPK signalling pathway, as well as correcting energy metabolism imbalance

CONFLICT OF INTEREST

We declare no conflict of interests.

AUTHOR CONTRIBUTIONS

YY, ZS, BY and XS contributed to the design of the study. YY and ZD wrote the manuscript. YY, RZ, YF and TX performed the experiments. YW and YX analysed the data. All authors read and approved the final manuscript.

Fig S1

Click here for additional data file.