Molecular identification of Brucella species and biovars associated with animal and human infection in Iran.

Brucellosis is a costly contagious disease of human, domestic and wild animals. It is a serious health problem in Iran causing significant economic losses therefore, control approaches to prevent its spread are of great importance. In Iran, the species and biovars of virulent Brucella species are still under-reported due to the inadequate diagnostic protocols and insufficient laboratory facilities. The objective of this study was to characterize Brucella isolates obtained from passive animal and human surveillance in Iran from 2011 to 2018 in order to understand the current epidemiological situation of the disease. A total of 419 samples (milk, blood, cerebrospinal fluid, abomasum content and aborted fetus tissues) were collected from 65 cases/case series (human and animals) and examined bacteriologically. The initially identified Brucella isolates were further characterized using phenotypic and molecular approaches. All recovered isolates were either B. abortus or B. melitensis. The infection in sheep appeared to be exclusively associated with B. melitensis, but both B. abortus and B. melitensis were common in bovine samples. Samples from one sheep and one goat were confirmed to be infected by the B. melitensis vaccine strain Rev1. In spite of B. abortus burden in animals (14 cases in cattle and camel), brucellosis in human was predominantly associated with B. melitensis (15 cases). The results confirmed that B. melitensis biovar 1 and B. abortus biovar 3 remain the most prevalent biovars in Iran. This report builds a picture of the significance of different Brucella species in different hosts in Iran and provides applicable information for the healthcare professionals about the public health risks of brucellosis and relevant preventive strategies.

Introduction

Brucellosis is known as a highly contagious disease of ruminants and humans caused by Gram-negative, non-motile coccobacilli of the genus Brucella.[1] Among Brucella spp., B. abortus, B. suis, and B. melitensis are the most pathogenic and invasive species for human and livestock.[2] Brucella canis can also cause human infection but is considered a less significant zoonotic threat.[3] Brucellosis is still an uncontrolled public health issue in some endemic regions in the Mediterranean, northern and eastern Africa, the Middle East and parts of Latin America and Asia. More than 500,000 new human cases of brucellosis are reported annually by World Health Organization (WHO).[4] The efficient preventive approaches have been established in several developed countries such as Australia, Northern European nations, Canada, Japan, and New Zealand,[3] which led to brucellosis eradication. However, brucellosis still represents a threat for human and livestock worldwide,[5] and is also categorized by the Centers for Disease Control and Prevention (CDC) as a class B bioterrorist pathogen that has historically been developed as a bio-weapon.[6]

Iran represents an endemic region for brucellosis.[7] The geographical distribution of brucellosis in this area is constantly changing with new foci of infection emerging or re-emerging.[8],[9] Roushan et al. evaluated the clinical manifestations and epidemiological features of 469 adult patients suffering from brucellosis in the northern part of Iran and reported that the consumption of unpasteurized dairy products, working at a laboratory, practicing in a veterinary profession, and direct contact with livestock as the main routes for brucellosis infection.[10] Other studies reported that the consumption of unsafe dairy products and animal husbandry as the main risk factors of brucellosis in different parts of Iran. [8].[11] The prevalence of human and animal brucellosis have been reported in various parts of Iran such as east,[11],[12] central,[13],[14] west[15],[16] and south.[17],[18] For example, the prevalence of brucellosis from 2002-2006 was 340 per 10,000 in small ruminants and 56.00 per 10,000 in cattle. In addition, the incidence of human brucellosis was 37.00 per 100,000 in the east of Iran.[19] In another study, it was revealed that the mean incidence rate of human brucellosis was 60.00 per 100,000 during 2001-2010 in the central part of Iran. The highest reported incidence rate in humans was 111.5 per 100,000 in 2004, while the lowest incidence rate was 40.50 per 100,000 in 2006.[13 ]In the west of Iran, the incidence of brucellosis in human reached 59.31 per 100,000 in 2013.[16] These represent among the highest incidences for human brucellosis reported globally.[20]

A few studies have reported the isolation and characterization of Brucella from human or livestock samples by approaches such as classical biotyping and modern molecular approaches such as IS711-based (AMOS) PCR.[8],[11],[12] AMOS PCR is described as a recent advance for accurate and rapid diagnosis of brucellosis that has been reported to overcome the limitations of conventional methodology. [9],[10]

A previous study by Zowghi et al. reported that B. abortus biovars 1, 2, 3, 4, 5 and 9 (predominantly 3) were isolated from sheep and a small number of cattle. Also, B. melitensis biovars 1, 2 and 3 (predominantly 1) were isolated from sheep, goats, cattle, camels, dogs, and humans.[21] However other Brucella species such as B. neotomae, B. suis, B. ovis and B. canis were not detected.[21] In another study it was revealed that Brucella isolates causing abortion in small ruminants were predominantly B. melitensis biovar 1, with a smaller number of B. melitensis biovar 2 isolates and a single isolate of B. abortus biovar 3.[22] The present study aims to further evaluate and update the presence and the nature of Brucella spp. in Iran.

Materials and Methods

Sample collection. A number of 419 samples including 151 milk samples (126 cows, one camel, 16 sheep and eigth goats), 58 human blood samples, three human cerebrospinal fluid (CSF) samples, 46 abomasal contents (32 cows, 14 sheep), 94 bovine lymph nodes and 67 tissue samples (kidney, liver, abomasum, spleen, heart and lung) from the aborted fetuses (26 sheep, 39 cows, two goats) were collected from 2011 to 2018. Samples were submitted to the Department of Brucellosis of the Razi Vaccine and Serum Research Institute (Karaj, Iran) from 2011 to 2018. Cows, sheep, and goats with a history of abortion were examined in the farms. Samples from all visceral organs (liver, abomasum content, lungs, kidneys, spleen, and heart) were collected in sterile plastic bags and preserved at – 20.00 ˚C for Brucella culture and isolation. Human cases of brucellosis were patients referred with clinical complaints to the RVSRI Department of Brucellosis with symptoms compatible with brucellosis, and positive Wright and 2ME tests. Milk and serum samples were stored at – 20.00 ˚C until analysis. The animals and human samples were collected from different location of Iran such as Mashhad, Sari, Kashan, Qom, Kerman, Ilam, Shahrekord, Tehran, Shiraz, Karaj, Gharchak, Yazd, Marvdasht, Zanjan, Rey, Semnan and Garmsar from 2011 to 2018.

isolation. For the isolation and identification of brucella, bacteriological assays were performed under appropriate protection in safety hoods at the RVSRI Department of Brucellosis. All individual milk samples, abomasum content and aborted fetal organs, as well as blood samples, were subjected to bacterial culture. Primary isolation of Brucella spp. was performed by inoculating the samples on a Brucella selective supplement containing polymyxin B (2,500 IU), bacitracin (12,500 IU), nystatin (50,000 IU), cycloheximide (50.00 mg), nalidixic acid (2.50 mg) and vancomycin (10.00 mg) all from Oxoid (Basingstoke, UK) and inactivated 5.00% horse serum in Brucella agar (Himedia, Mumbai, India). The inoculated media were incubated for 10 days at 37.00 ˚C with 10.00% CO2. Milk samples were centrifuged for 15 min at 3,500 rpm and afterward, sediments and the creamy upper layer were cultured. After 14 days of incubation, the bacterial cultures were discarded if no growth was visible. Typical colonies of Brucella spp. were sub-cultured and subjected to further analysis to obtain full identification and biotype.

Biotyping. Classical biotyping was performed according to the procedure described by Alton et al.[23] Brucella monospecific antisera A and M and Brucella reference phage of Tbilisi (Tb) were routinely prepared and used for diagnosis and analysis in the Razi Vaccine and Serum Research Institute. A panel of biotyping tests such as CO2 dependence, H2S production, agglutination with specific Brucella antisera, growth in media containing thionin and basic fuchsin, agglutination by acriflavine, and lysis by specific phages were performed[24] and the results were interpreted according to the documented data.[23]

Molecular typing. Genomic DNA was extracted by heat-treating a loopful of bacterial colony dissolved in 300 µL of molecular-grade water at 100 ˚C for 15 min.[25] The suspension was vortexed and centrifuged at 13,000 g for 5 min and then the supernatant containing DNA was collected and stored at − 20.00 ˚C until later use.[26] The DNA concentration was evaluated by measuring the DNA absorbance at 260 nm. After that, the extracted DNA was subjected to IS711-based (AMOS) PCR for Brucella spp.[27] Species-level molecular identification was also performed using seven primer pairs (Table 1) in a multiplex PCR (Bruce-ladder) to reveal different Brucella spp. under the following conditions: initial denaturation at 95.00 ˚C for 5 min, 30 cycles of 95.00 ˚C for 30 sec, 56.00 ˚C for 90 sec, 72.00 ˚C for 3 min and a final extension step at 72.00 ˚C for 10 min.28 The amplified products were resolved by electrophoresis using a 1.50% agarose gel.

Table 1

The list of primer pair names and sequences and the expected amplicon sizes for different Brucella species

Strains	Primer	Primer sequence (5-3’)	Target gene	Amplicon size (bp)	Ref.
B. abortus	IS711 AB	TGCCGATCACTTTCAAGGGCCTTCATGACGAACGGAATTTTTCCAATCCC	IS711	498
B. melitensis	IS711 BM	TGCCGATCACTTTCAAGGGCCTTCATAAATCGCGTCCTTGCTGGTCTGA	IS711	731
B. abortus B. melitensis B. melitensis Rev.1	BMEI0998fBMEI0997r	ATCCTATTGCCCCGATAAGGGCTTCGCATTTTCACTGTAGC	Glycosyltransferase, gene wboA	1682
B. abortus B. melitensis B. melitensis Rev.1	BMEI0535fBMEI0536r	GCG CATTCTTCGGTTATGAACGCAGGCGAAAACAGCTATAA	Immunodominantantigen, gene bp26	450
B. abortus B. melitensis B. melitensis Rev.1	BMEI1436fBMEI1435r	ACGCAGACGACCTTCGGTATTTTATCCATCGCCCTGTCAC	Polysaccharidedeacetylase	794
B. abortus B. melitensis B. melitensis Rev.1	BMEII0428fBMEII0428r	GCCGCTATTATGTGGACTGGAATGACTTCACGGTCGTTCG	Erythritol catabolism, gene eryC	587
B. abortus B. melitensis B. melitensis Rev.1	BMEII0987fBMEII0987r	CGCAGACAGTGACCATCAAAGTATTCAGCCCCCGTTACCT	Transcriptionalregulator, CRP family	152
B. melitensis	BMEII0843fBMEII0844r	TTTACACAGGCAATCCAGCAGCGTCCAGTTGTTGTTGATG	Outer membraneprotein, gene omp31	1071
B. melitensis Rev.1	BMEI0752fBMEI0752r	CAGGCAAACCCTCAGAAGCGATGTGGTAACGCACACCAA	Ribosomal protein S12,gene rpsL	218

Results

Brucella isolates (n=161) were recovered from 48 out of 65 examined cases/case series. These included isolates from human blood (47/58), human CSF (1/3), ovine aborted fetuses (9/26), ovine milk (1/16), bovine milk (49/126), bovine aborted fetuses (3/39), bovine lymph nodes (44/94), bovine abomasum contents (5/32), goat milk (1/8) and camel milk (1/1). Isolated bacteria exhibited common phenotypic features typical of Brucella spp. All isolates grew in 10.00% carbon dioxide (CO2) after 5 to 14 days incubation at 37.00 ˚C. Bacteria isolated were Gram-negative and formed small honey colored, translucent and shiny colonies with a smooth surface. Isolates were characterized to the biovar level and identity confirmed to the species/vaccine level for all isolates by the use of AMOS PCR and Bruce-ladder. Isolates represented either B. abortus, B. melitensis or B. melitensis vaccine strain Rev1.

A number of 89 Brucella isolates identified as B. abortus which they were isolated from 15 cases (cattle 13 cases, human and camel each one case), (Fig. 1). Biotyping was consistent with the presence of B. abortus biovars 1 (two cases), 2 (one case), 3 (eight cases) and 5 (four cases). As expected, only the biovar 1 and 2 isolates gave the 498 bp B. abortus specific band in AMOS PCR, which detects only biovars 1, 2 and 4.[29] However all isolates were confirmed as B. abortus in the Bruce-ladder PCR with PCR products of 1682, 794, 587, 450 and 152 bp in size (Table 1).

Fig. 1

The frequency of B. abortus and B. melitensis biovars in different examined samples

Seventy-two isolates were identified as B. melitensis which they were isolated from 33 cases (Fig. 1) including sheep/goats (eight cases), cows (10 cases) and humans (15 cases). Brucella melitensis isolates belonged to three biovars of those biovar 1 (22 cases) was more common than the other two biovars 2 (two cases) and 3 (seven cases). The last two B. melitensis isolated from a sheep fetus and goat milk sample were B. melitensis Rev 1 vaccine strain on the basis of Bruce-ladder typing. All the other isolates were identified as wild type B. melitensis by both AMOS-PCR with a PCR product of 731 bp and Bruce-ladder with PCR products of 1682, 794, 587, 450, 152 and 1,071 bp in size. Brucella melitensis Rev.1 vaccine strain was differentiated from the other B. melitensis strains through a specific additional band of 218-bp (Table 1).

Geographical distribution of species/ biovars. A map of the distribution of Brucella species/biovars across Iran revealed that B. melitensis biovar 1 is the most prevalent biovar identified in 11 provinces (Tehran, Mazandaran, Alborz, Qom, Zanjan, Esfahan, Ilam, Chahar Mahal-va-Bakhtiari, Semnan, Kerman, and Fars). Brucella melitensis biovar 2 was only identified in Kerman province, while B. melitensis biovar 3 was identified from samples collected from three provinces of Alborz, Kerman and Khorasan-e Razavi. Brucella abortus biovar 1 was detected from samples originating from two provinces of Tehran and Yazd. Brucella abortus biovar 2 was only detected in Yazd Province, biovar 3 in Tehran and Fars, while biovar 5 was identified in provinces of Tehran and Qom. In addition, Rev1 vaccine strain was isolated from samples collected from two provinces of Zanjan and Kerman (Fig. 2).

Fig. 2

The geographical distribution of Brucella species/biovars of animals and humans in Iran. The numbers inside the boxes indicate the frequencies of Brucella biovars

Discussion

Due to the endemic nature of brucellosis in some regions of Iran, the knowledge of epidemiological, and clinical features of common and virulent Brucella species is crucial for better diagnosis, prevention, and control of the disease. The gold standard procedure for the diagnosis of human and animal brucellosis is still the bacterial culture and the isolation of the causative agent followed by bacteriological tests and biotyping. In many Iranian studies, Brucella infection has been investigated using serology and PCR tests, but there are very few studies that examine the actual presence of Brucella species and biovars recently. For this purpose, we performed bacteriological and molecular methods (such as Bruce-ladder not previously applied in Iran) to further characterize Brucella biodiversity in the animal and human infected communities in Iran. The results of the present study extended our knowledge of Brucella species and biovars that are currently associated with this zoonosis disease in Iran. These reports also revealed the passive surveillance for brucellosis over a seven-year period showing the significant burden of both B. abortus and B. melitensis in the past few years. In terms of livestock, while B. abortus appeared to be largely restricted to cattle, B. melitensis appeared to be common in both cattle and small ruminants. This is consistent with the increasing observations of the isolation of B. melitensis from cattle, particularly in Africa and the Middle East[2],[30]-[32] and with previous observations in Iran.21 Human brucellosis though appears predominantly associated with B. melitensis (94.00% of cases), with a much lower burden of B. abortus (6.00%), consistent with the view that B. melitensis is the most significant human pathogen among Brucella species globally.[6],[33]

According to our results, B. melitensis biovar 1 was the significant Brucella species predominantly isolated from humans with rarer isolation of B. melitensis biovars 3 and B. abortus biovars 1. These results are in accordance with the findings of the previous study from different parts of Iran, reporting B. melitensis biovars 1 as endemic and widely spread in humans.[21] This type of brucella was also reported in more recent studies as the most prevalent isolate in humans elsewhere.[6],[34]

Brucella abortus biovar 3 was the most prevalent type in cattle. This finding is in agreement with a previous epidemiological study performed in Iran, recognizing this biovar as the main and the most virulent in cattle.[21] B. abortus biovar 3 has also been reported as a common cause of abortion in dairy cows in Europe, China, and Turkey as well as in Kenya[21],[35] though molecular studies have shown that B. abortus biovar 3 corresponds to multiple separate lineages.[36]

Based on our results, B. melitensis biovars 1, B. melitensis biovars 3 and B. melitensis Rev1 are the only species that have been isolated in the aborted sheep fetus. B. melitensis biovar 1 was first reported from a sheep in the center of Iran (Isfahan) and then spread in different Iranian regions, infecting sheep and goats as well as cattle, camel, dogs, and humans.[21] The study of Ashrafganjooyi et al. on 700 milk samples reported B. melitensis biovar 1 as the most common biovar in sheep and goat milk samples.[37] B. melitensis biovar 1 was also reported in Iran,[21],[22] China,[38] Libya,[39] Israel,[40] Kenya[41] and Oman,[42] while B. abortus biovar 1 is present in Iran,[21] Pakistan,[43] and Kuwait.[44]

This study showed that B. melitensis biovar 3 is also common in Iran that is inconsistent with a previous report from Turkey.[45] In the Middle East countries, B. melitensis biovars 3 has also been reported as the most common cause of Brucella infections in human.[42] According to our data, B. melitensis biovar 2 was only reported in cows from Kerman. In spite of being the most prevalent biovar in China,[38] this biovar seems to be present in a lower extent in the Middle East and Mediterranean countries. Brucella melitensis biovar 2 was previously reported from Saudi Arabia, Iran and Turkey, [22],[42] and our results reported the incidence of this biovar in cattle.

Brucella abortus biovar 5 was isolated from the single Iranian camel sample examined in the present study. The infection of camels with B. melitensis biovar 3 and B. abortus biovar 6 has been reported in Western Sudan.[46] Another study reported the presence of B. abortus biovar 1 from camel milk in Kuwait.[44] Generally, camel brucellosis has been reported in different parts of Iran, Saudi Arabia, Oman, Kuwait, Sudan, Iraq, Egypt, Somalia and Libya as well as in the United Arab Emirates.[47] Although, both B. abortus and B. melitensis can infect camels,[46]-[48] Zaki reported B. abortus as the most common cause of brucellosis in camels.49 Further work is needed to determine the brucellosis burden in Iranian camels.

Two isolates of B. melitensis Rev1 from an ovine foetus and caprine milk confirmed the propensity of Rev1 to be shed in milk and causing abortion in the small ruminants particularly if the timing of vaccination is not optimal.[50] The attenuated B. melitensis Rev 1 strain is currently administrated as the exclusive vaccine for the prevention of brucellosis in sheep and goat in Iran. The full- and reduced-doses of Rev 1 have been suggested as safe and effective approaches for controlling small ruminant brucellosis. Taken together, our results, utilizing both classical methods and newly introduced molecular approaches, demonstrated the frequency of brucellosis infection in Iran and reflects the spread of various B. melitensis and B. abortus biovars. In spite of this update, there are significant gaps in the different Iranian literature on the epidemiology of Brucella in cattle, sheep, camels, and human, therefore, further works are required to fully understand the epidemiology of this disease. This knowledge will ultimately support the design of potential brucellosis control programs and preventive strategies in Iran.