| Literature DB >> 32206227 |
Maryam Dadar1, Saeed Alamian1, Ali Mohammad Behrozikhah1, Freshteh Yazdani1, Armin Kalantari1, Afshar Etemadi1, Adrian M Whatmore2.
Abstract
Brucellosis is a costly contagious disease of human, domestic and wild animals. It is a serious health problem in Iran causing significant economic losses therefore, control approaches to prevent its spread are of great importance. In Iran, the species and biovars of virulent Brucella species are still under-reported due to the inadequate diagnostic protocols and insufficient laboratory facilities. The objective of this study was to characterize Brucella isolates obtained from passive animal and human surveillance in Iran from 2011 to 2018 in order to understand the current epidemiological situation of the disease. A total of 419 samples (milk, blood, cerebrospinal fluid, abomasum content and aborted fetus tissues) were collected from 65 cases/case series (human and animals) and examined bacteriologically. The initially identified Brucella isolates were further characterized using phenotypic and molecular approaches. All recovered isolates were either B. abortus or B. melitensis. The infection in sheep appeared to be exclusively associated with B. melitensis, but both B. abortus and B. melitensis were common in bovine samples. Samples from one sheep and one goat were confirmed to be infected by the B. melitensis vaccine strain Rev1. In spite of B. abortus burden in animals (14 cases in cattle and camel), brucellosis in human was predominantly associated with B. melitensis (15 cases). The results confirmed that B. melitensis biovar 1 and B. abortus biovar 3 remain the most prevalent biovars in Iran. This report builds a picture of the significance of different Brucella species in different hosts in Iran and provides applicable information for the healthcare professionals about the public health risks of brucellosis and relevant preventive strategies.Entities:
Keywords: Bruce ladder; Brucella species and biovars; Brucellosis; PCR
Year: 2019 PMID: 32206227 PMCID: PMC7065579 DOI: 10.30466/vrf.2018.89680.2171
Source DB: PubMed Journal: Vet Res Forum ISSN: 2008-8140 Impact factor: 1.054
The list of primer pair names and sequences and the expected amplicon sizes for different Brucella species
|
|
|
|
|
|
|
|---|---|---|---|---|---|
|
|
| TGCCGATCACTTTCAAGGGCCTTCAT |
| 498 | |
|
|
| TGCCGATCACTTTCAAGGGCCTTCATAAATCGCGTCCTTGCTGGTCTGA |
| 731 | |
|
| BMEI0998f | ATCCTATTGCCCCGATAAGG | Glycosyltransferase, | 1682 | |
|
| BMEI0535f | GCG CATTCTTCGGTTATGAA | Immunodominant | 450 | |
|
| BMEI1436f | ACGCAGACGACCTTCGGTAT | Polysaccharide | 794 | |
|
| BMEII0428f | GCCGCTATTATGTGGACTGG | Erythritol catabolism, | 587 | |
|
| BMEII0987f | CGCAGACAGTGACCATCAAA | Transcriptional | 152 | |
|
| BMEII0843f | TTTACACAGGCAATCCAGCA | Outer membrane | 1071 | |
|
| BMEI0752f | CAGGCAAACCCTCAGAAGC | Ribosomal protein S12, | 218 |
Fig. 1The frequency of B. abortus and B. melitensis biovars in different examined samples
Fig. 2The geographical distribution of Brucella species/biovars of animals and humans in Iran. The numbers inside the boxes indicate the frequencies of Brucella biovars