Literature DB >> 32190658

Mechanism of Antibacterial Activity of Bacillus amyloliquefaciens C-1 Lipopeptide toward Anaerobic Clostridium difficile.

Jia Lv1, Rong Da2, Yue Cheng1, Xiaohong Tuo1, Jie Wei1, Kaichong Jiang1, Adediji Omolade Monisayo1, Bei Han1.   

Abstract

Probiotics may offer an attractive alternative for standard antibiotic therapy to treat Clostridium difficile infections (CDI). In this study, the antibacterial mechanism in vitro of newly isolated B. amyloliquefaciens C-1 against C. difficile was investigated. The lipopeptides surfactin, iturin, and fengycin produced by C-1 strongly inhibited C. difficile growth and viability. Systematic research of the bacteriostatic mechanism showed that the C-1 lipopeptides damage the integrity of the C. difficile cell wall and cell membrane. In addition, the lipopeptide binds to C. difficile genomic DNA, leading to cell death. Genome resequencing revealed many important antimicrobial compound-encoding clusters, including six nonribosomal peptides (surfactins (srfABCD), iturins (ituABCD), fengycins (fenABCDE), bacillibactin (bmyABC), teichuronic, and bacilysin) and three polyketides (bacillaene (baeEDLMNJRS), difficidin (difABCDEFGHIJ), and macrolactin (mlnABCDEFGHI)). In addition, there were other beneficial genes, such as phospholipase and seven siderophore biosynthesis gene clusters, which may contribute synergistically to the antibacterial activity of B. amyloliquefaciens C-1. We suggest that proper application of antimicrobial peptides may be effective in C. difficile control.
Copyright © 2020 Jia Lv et al.

Entities:  

Mesh:

Substances:

Year:  2020        PMID: 32190658      PMCID: PMC7073505          DOI: 10.1155/2020/3104613

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Clostridium difficile is an anaerobic, gram-positive, spore-forming bacterium. Clinical signs of C. difficile infection (CDI) range from mild diarrhea to fulminant colitis [1]. The incidence and severity of CDI have increased significantly, especially by the recently emerged and highly virulent epidemic strain BI/NAP1/027 [2]. With increasing antibiotic resistance of C. difficile, there is an urgent need to develop new agents and efficient methods for the treatment and control of CDI [1, 3]. Distinct from the traditional antibiotics, many novel antimicrobial agents, such as ramoplanin, surotomycin, and cadazolid, are currently being investigated in clinical trials for the treatment of CDI. Surotomycin is an orally dosed lipopeptide antibiotic that acts by disrupting the cell membrane [4]. Bacteriocins are ribosomally synthesized antimicrobial peptides with high activity against other bacteria. Bacteriocins are secreted by some probiotic microorganisms, such as Lactobacillus species, Saccharomyces boulardii, and bifidobacteria [5]. Thus, further evaluation should be given to the bacterial resources, antimicrobial mechanisms, and biosafety of probiotics in considering bacteriocins as an alternative or adjunctive therapeutic method for CDI. Except the ribosomally synthesized antimicrobial peptides, Bacillus species could synthetize a mixture of lipopeptides by nonribosomal peptide synthetases, which mainly include surfactin, iturin, lichenysin, and fengycin families, with broad-spectrum biological activities [6-8]. With the described functional secondary metabolites, many Bacillus spp. strains have been developed as biofertilizers and biopesticides, and they are currently regarded as promising environmentally friendly means for plant protection and plant growth promotion, and as secondary metabolite factories [9]. However, for B. amyloliquefaciens, there are only a few reports that describe an antimicrobial activity against toxin-producing C. difficile [10]. We isolated B. amyloliquefaciens C-1 from ready-to-eat fruit samples. The bacterial strain is stored in the China Center for Type Culture Collection as a patent strain with the number of CCTCC M2010177. The supernatant of C-1 showed high antioxidant activity and inhibitory activity against foodborne pathogens (Escherichia coli O157:H7, B. cereus, S. aureus, etc.) and human pathogens (C. difficile, Klebsiella pneumoniae, Enterococcus faecium, etc.) [11, 12]; however, no effect against fungi was found. Comparative genomic analysis showed evolutionary traits for B. amyloliquefaciens strain adaptation to host habitats [13]. The C-1 strain exhibited a biosurfactant activity phenotype against pathogens. The molecular bases/mechanisms of this pathogen-specific activity were unknown. In this study, we investigated the anti-C. difficile mechanisms of the secreted B. amyloliquefaciens C-1 extracellular lipopeptides. We systematically investigated the effects of C-1 lipopeptide on C. difficile cell growth, morphological structure, cell wall and membrane integrity, and genome. Then, we resequenced the entire C-1 genome and identified relevant gene clusters, locations, and potential regulatory sequences, including genes for bacteriocins, ribosomally synthesized antibacterial peptides, phospholipase, siderophores, and genes that provide resistance to toxic compounds.

2. Material and Methods

2.1. Bacterial Strains and Culture

B. amyloliquefaciens C-1, a patent strain (Chinese patent no. ZL201410260574.2), was isolated and stored in our lab. It was inoculated into fermentation medium (12.4 g/l tryptone, 20 g/l glucose, 5 g/l NaCl, 1.5 g/l K2HPO4·3H2O, 0.04 g/l MnSO4·H2O, 1.7 g/l FeSO4·7H2O, and 1.2 g/l MgCl2·6H2O, pH 7.2) and grown with shaking of 200 rpm in flasks for 72 h at 30°C. Clostridium difficile ATCC 9689, 700057, and BAA-1870 strains were obtained from the American Type Culture Collection and stored at -80°C. C. difficile strains were cultured in sterile Reinforced Clostridium Medium (RCM) and incubated overnight at 35°C in an anaerobic chamber (Coy Laboratory Products Inc., Ann Arbor, Michigan) with an atmosphere of 82% N2, 15% CO2, and 3% H2.

2.2. Isolation and Identification of B. amyloliquefaciens C-1 Extracellular Lipopeptide

Lipopeptide isolation was performed by acid precipitation according to Zhang et al. [14]. Briefly, the crude cell-free culture was adjusted to pH 2.0 with 6 M HCl and placed overnight at 4°C. After centrifugation, the precipitate was extracted twice with methanol. The solution was dried in a vacuum freeze dryer, and the dry residue was dissolved in 50 mM Tris-HCl (pH 7.5) and passed through a 0.22 μm filter. The extracted lipopeptide sample was analyzed with a UV-VIS spectrophotometer (UV5, Mettler Toledo).

2.3. Thin-Layer Chromatography

The purified lipopeptide was examined by thin-layer chromatography (TLC) on a silica gel G plate [15]. TLC assay was performed on a silica gel G plate (10 × 20 cm, Silica gel 60, Germany). A chloroform-methanol mixture (10 : 1, v/v) was used as the mobile phase. A sample was spotted onto the TLC plate and hydrolyzed with 6 M HCl for 2 h in a sealed container. Once dried, the plate was developed in the mobile phase. After development, the plate was sprayed with 0.5% ninhydrin and placed in an oven at 110°C for 10 min to detect the peptides as red spots.

2.4. Semipreparative HPLC Analysis

The putative lipopeptides were identified by HPLC analysis. Briefly, crude extract spots were removed from the TLC plates and dissolved in 10% methanol; the supernatants were analyzed by semipreparative high-pressure liquid chromatography using an Agilent LC 1200 system. The chromatographic separation was performed with a C-18 Column (4.6 × 250 mm). The column outlet was coupled to an Agilent MSD Ion Trap XCT mass spectrometer equipped with an ESI ion source. The lipopeptide fragments were selectively desorbed with methanol gradients from 35% to 65% within 140 min. All elution programs used a flow rate of 0.5 ml/min at 214 nm and detection occurred using the negative ion mode at m/z ranging from 400 to 2000. The isolated fragments were collected for the following experiments.

2.5. Detection of Lipopeptide Synthesis-Related Genes

Lipopeptide biosynthesis genes (sfr, ituD, and fenB) were identified by PCR (sfr-F: 5′ ATGAAGATTTACGGAATTTA 3′, sfr-R: 5′ TTATAAAAGCTCTTCGTACG 3′; ituD-F: 5′ ATGAACAATCTTGCCTTTTTA 3′, ituD-R: 5′ TTATTTTAAAATCCGCAATT 3′; fenB-F: 5′ CTATAGTTTGTTGACGGCTC 3′, fenB-R: 5′ CAGCACTGGTTCTTGTCGCA 3′) [9]. PCR conditions consisted of an initial denaturation step at 94°C for 5 min followed by 30 cycles of denaturation at 94°C for 1 min, 54°C annealing for 45 sec (sfr, ituD) or 1 min (fenB), and 72°C extension for 1 min followed by a final extension step at 72°C for 7 min. The amplified PCR product was purified and sequenced by an automated sequencer (3730 DNA Analyzer). PCR product sequences were identified using GenBank nucleotide data and BLAST from the National Center for Biotechnology Information, Bethesda, MD, USA (http://www.ncbi.nlm.nih.gov/blast/).

2.6. The Inhibitory Activity of Lipopeptide against C. difficile

Antimicrobial activities of the lipopeptides were detected by disc diffusion assay. 0.5 McF (106 CFU/ml) of C. difficile cells was inoculated onto the surface of blood agar plates. An Oxford cup (6 mm diameter), containing 100 μl lipopeptide with concentrations of 5, 10, and 15 μg/ml dissolved in 10% methanol, was placed on test C. difficile-seeded plates. A cup containing 100 μl 10% methanol was used as negative control. Each C. difficile strain was plated in triplicate. The plates were incubated anaerobically overnight at 35°C, and antimicrobial activity was evaluated by measuring inhibition zones against the tested C. difficile cells. The minimal inhibitory concentrations (MIC) against C. difficile strains were determined by the broth microdilution method in 96-well microplates with a final concentration of 105 CFU/ml, and the final concentration of the added lipopeptide ranged from 10 μg/ml to 0.0095 μg/ml; bacterial growth without lipopeptide was set as control [16]. The MIC was defined as the lowest lipopeptide concentration at which growth was completely inhibited after overnight anaerobic incubation of the plates at 35°C.

2.7. Growth of C. difficile Incubated with Lipopeptides

For time-kill analyses, 0.5 McF (106 CFU/ml) of C. difficile cells (strains ATCC 9689, ATCC 700057, and ATCC BAA-1870) was prepared and inoculated into fresh RCM containing 0, 0.25, 0.5, and 0.75 MIC of lipopeptide separately, and incubated in the anaerobic chamber at 35°C. Cell viability was determined every 2 h for 24 h [17]. Each treatment was performed with three biological replicates.

2.8. Scanning Electron Microscope Analysis of C. difficile Cells Treated with Lipopeptides

An overnight culture of C. difficile was transferred into fresh RCM medium with 0.5 McF and 0.25 MIC of lipopeptide, and incubated anaerobically at 35°C for 1 h. The C. difficile cells were collected and washed three times with sterile PBS solution. The cells were fixed with 2% glutaraldehyde overnight at 4°C and then dehydrated by a graded series of ethanol (50%, 70%, 80%, 90%, 95%, and 100%) for 20 min at each step. After the critical point of drying and gold coating, the surface structure of treated C. difficile cells was observed with a scanning electron microscope (Hitachi S-2460N, Hitachi, Ltd., Tokyo, Japan) at an acceleration voltage of 20 kV [18].

2.9. Fluorescence Microscope Analysis of C. difficile Cells Treated with Lipopeptides

Propidium iodide (PI) penetrates only damaged cell membranes, whereupon it binds to double-stranded DNA and fluoresces red with 488 nm illumination. To clearly detect an effect on the plasma membrane, 0.5 MIC of the purified lipopeptide was incubated with C. difficile cells (107 cells/ml) in RCM liquid medium. The mixture was incubated anaerobically at 35°C for 1 h. Then, 10 μl of 100 μg/ml PI solution was added to the cell suspension, and the mixture was incubated for 30 min in the dark. Finally, the treated C. difficile cells were observed with a Nikon TI-S fluorescence microscope with the filters set at an excitation wavelength of 488 nm and an emission wavelength of 538 nm. Cells treated with the same amount of sterile water were used as a negative control [19]. All experiments were repeated three times.

2.10. Determination of Extracellular Alkaline Phosphatase Activity of C. difficile Cells Treated with Lipopeptide

An overnight culture of C. difficile was subcultured into fresh RCM liquid medium. Lipopeptide was added separately into the C. difficile culture at final concentrations of 0.25 and 0.5 MIC. Bacterial supernatant (0.5 ml) was collected every 12 h for the measurement of extracellular alkaline phosphatase (AKPase) activity using an AKP assay kit (Nanjing Jiancheng Technology Co., Ltd., Nanjing, China) as described in [20]. The AKPase unit was defined as 1 mg of phenol produced by 100 ml of bacterial culture supernatant reacted with the substrate at 37°C for 15 minutes. Cells treated with the same amount of sterile water were used as negative control. Each test was performed in three biological replicates.

2.11. Lipopeptide Binding to C. difficile Genomic DNA

Gel retardation experiment assays were performed to identify the DNA binding activity of the lipopeptide as described in [21]. Briefly, 50 ng of C. difficile genomic DNA was mixed with 1 μl of 1, 2, and 5 μg/ml lipopeptide in 20 μl of binding buffer (10 mM Tris-HCl, 1 mM EDTA buffer, pH 8.0). One μl of sterilized water mixed with C. difficile genomic DNA was used as negative control. Mixtures were incubated at 35°C for 1 h. All samples were subjected to 1.0% agarose gel electrophoresis and stained with ethidium bromide.

2.12. Whole Genome Sequencing of B. amyloliquefaciens C-1

The genomic DNA of strain C-1 was isolated and purified by a kit (Applied Biosystems® 4413021) and sequenced on the Pacific Bioscience (PacBio) RS II system at Genefund, Shanghai, China. The genome was assembled with SMRT analysis v.2.3 and RS_HGAP_Assembly.3, and the genome assembly was improved by using the software Pilon. Identification of protein-coding open reading frames (ORFs) and annotation of ORFs were performed by using the NCBI Prokaryotic Genome Annotation Pipeline. Genes were functionally annotated by BLAST search in COG (Gene Ontology Consortium), Nr (NCBI RefSeq), and Pfam Databases [22, 23]. KEGG (Kyoto Encyclopedia of Genes and Genomes) database was used in the analysis of metabolic pathways of lipopeptide-producing Bacillus species. All amino acid sequences derived from the Bacillus genomes were submitted to the KEGG database, and the metabolic functions of these sequences were annotated by KASS. The KO (KEGG Orthology) term and corresponding KEGG pathway for each ORF were automatically generated. Secondary metabolite clusters present in the genome of the B. amyloliquefaciens collection have been evaluated using antiSMASH 5.0 [24]. The 16S rRNA gene sequences of Bacillus species were extracted from genome sequences and aligned using the CLUSTALX [25]. Phylogenetic trees were constructed using the neighbor-joining method implemented in the software package MEGA version 7.0.26 [26]. Evolutionary distances were calculated using Kimura's two-parameter model. The C-1 genome sequence data were deposited into the Sequence Read Archive (SRA) of NCBI and can be accessed via accession number SRP127533.

2.13. Statistical Analysis

All experimental data are expressed as the average with standard deviation of at least three independent replicates. Statistical analyses were performed using the t-test and analysis of variance (ANOVA), JMP pro (SAS Institute Inc., NC, US), STAMP10, and SPSS V20.0 (IBM Inc., IL, US). Significant differences were considered at P < 0.05.

3. Results and Discussion

3.1. Production, Purification, and Identification of C-1 Lipopeptide

Bacillus spp. produces abundant secondary metabolites, such as proteinase, amylase, bacteriocin, and exopolysaccharide. In this study, we focused on the lipopeptide-producing B. amyloliquefaciens strain C-1. The growth profile of C-1 is shown in Figure 1. The maximum growth and cell dry weight were reached at 48 h; the maximum lipopeptide production (3.49 ± 0.26 mg/ml) was reached at 72 h. Lipopeptide production was conducted in a fermentation medium. The active compound from the culture supernatant was scanned from 190 to 900 nm, and the maximum absorption occurred at 213 nm, which is the typical absorption wavelength of peptides. Three spots were observed by thin-layer chromatography, and three component peaks were detected by RP-HPLC. Mass spectroscopy showed that the molecular masses of the three components at m/z were 1067 Da, 1477 Da, and 1506 Da, which corresponded to surfactin, fengycin, and iurin, respectively. PCR products of 675 bp, 1400 bp, and 482 bp corresponded to Srf, FenB, and ItuD genes, and the PCR fragments were sequenced and showed 99% identity with surfactin, fengycin, and iturin biosynthesis gene clusters, individually ().
Figure 1

The fermentation and lipopeptide production in B. amyloliquefaciens C-1 for 72 hours. The solid line indicates the growth curve of OD600, the dotted line indicates the growth curve of cell dry weight, and the shaded columns represent the lipopeptide production.

3.2. Antimicrobial Activity of C-1 Lipopeptide against C. difficile

Bacillus spp. lipopeptides have an inhibitory activity against plant pathogenic fungi and pathogenic bacteria and have been developed as biocontrol agents [27]. Although, in our previous report, C-1 did not show any inhibitory activity against fungi, it did have antibacterial activity toward several human pathogens, and this antibacterial activity in the C-1 supernatant was verified to be the contribution of lipopeptide, not exopolysaccharide [11, 12]. In plate tests, the C-1 lipopeptide displayed antagonistic activities against three C. difficile strains. Inhibition zone diameters ranged between 7.05 mm and 22.00 mm, and the largest inhibition zone was from 15 μg/ml lipopeptide against strain C. difficile ATCC 9689 (Table 1). The MICs against C. difficile strains ATCC 9689, ATCC 700057, and ATCC BAA-1870 were 0.75, 2.5, and 2.5 μg/ml, separately. Within a certain concentration range (0.0095 μg/ml-10 μg/ml), the inhibitory effect was positively correlated with the concentration of the C-1 lipopeptide. To analyze the inhibitory effect, we determined the growth curves of the three C. difficile strains. At 24 h of continuous measurement, the maximum OD600 of C. difficile ATCC 9689, ATCC 700057, and ATCC BAA-1870 treated with 1/4 MIC lipopeptide reached 51.57%, 51.54%, and 56.12% of the control. For the 1/2 MIC treatment, growth was reduced to 43.15%, 46.39%, and 46.12% of the control. For the 3/4 MIC treatment, growth was further reduced to 38.95%, 40.21%, and 41.84% of the control. The C. difficile ATCC9689 was significantly the most sensitive to the treatment (P < 0.01), and the inhibitory effect was stronger with an increased concentration of the C-1 lipopeptide (Figure 2).
Table 1

The inhibition of the C-1 lipopeptide against Clostridium difficile in a plate test (the inhibition diameter showed in mm).

Clostridium difficile Concentration (μg/ml)
051015
ATCC 96890.007.05 ± 0.71a,b14.50 ± 0.71a,b22.00 ± 1.41a,b
ATCC 7000570.000.008.40 ± 0.71a11.50 ± 0.71a
ATCC BAA-18700.000.008.50 ± 0.71a10.50 ± 0.71a

aSignificant difference of C-1 lipopeptide treatments vs. negative control (P < 0.01). bSignificant difference of lipopeptide treatments between C. difficile strains ATCC 9689 and ATCC 70057, ATCC 9689, and ATCC BAA-1870 (P < 0.01).

Figure 2

The growth curve of C. difficile ATCC 9689 (a), ATCC 700057 (b), and BAA-1870 (c) treated with different concentrations of the C-1 lipopeptide.

Because C. difficile ATCC9689 was more sensitive to the C-1 lipopeptide, and it was also a tcdA and tcdB positive strain, we assessed the following antibacterial mechanism toward this strain.

3.3. Effect of C-1 Lipopeptide on C. difficile Morphology, Cell Wall Permeability

Scanning electron microscopy showed that the surface of C. difficile ATCC 9689 was damaged after treatment with the C-1 lipopeptide. Exudates surrounded the bacteria, and the cell wall and cell membrane were interrupted and indistinct, whereas untreated cells were smooth and uninterrupted (Figures 3(a) and 3(b)). In addition, with increasing concentrations of lipopeptide, the bacteria were surrounded by exudate that may have been cytoplasm extruded from the cells. Propidium iodide (PI) penetrates only a damaged cell membrane, after which it binds to double-stranded DNA and fluoresces red with illumination at 488 nm. We stained the C-1 lipopeptide-treated and C-1 lipopeptide-untreated C. difficile cells with PI and observed the cells with a fluorescence microscope. C. difficile ATCC 9689 cells treated with lipopeptide were stained with PI as shown by red fluorescence, which indicated a damaged cell membrane (Figures 3(d) and 3(f)), whereas the untreated cells did not show any fluorescence (Figures 3(c) and 3(e)).
Figure 3

Morphological changes of C. difficile ATCC 9689 treated with 0.5 MIC of the C-1 lipopeptide. Observed with a scanning electron microscope (×25000; (a) untreated cells and (b) treated cells). Observed with a light microscope (×400; (c) untreated cells and (e) treated cells). Observed with a fluorescent microscope (PI staining, ×400; (d) untreated cells and (f) treated cells).

The destroyed cell membrane increased the permeability of C. difficile ATCC 9689 after C-1 lipopeptide treatment. To verify the effect of lipopeptide on cell wall permeability, we measured alkaline phosphatase (AKPase) activity. A damaged cell wall and cell membrane increased cell permeability and caused an increase in extracellular AKPase. After lipopeptide treatment, extracellular AKPase activity increased continuously and was significantly higher than that of the untreated cells (). With 36 h of incubation, the extracellular AKPase content of C. difficile ATCC 9689 treated with 1/4 MIC and 1/2 MIC of lipopeptide increased 4.7-fold and 7.7-fold. The antibacterial activity of Bacillus spp. lipopeptide was observed with other pathogens, such as S. aureus [28], Vibrio anguillarum [18], and E. clocae [8]. However, our report is the first to document the effects of lipopeptide on toxin-producing C. difficile. The inhibitory mechanism of the C-1 lipopeptide against C. difficile could be explained by destroying the bacterial cell by forming ion-conducting channels in the cell membrane as described by Etchegaray et al. [29]. This mode of action drastically reduces the chance of the development of resistance by microbes, offering a promising alternative for the treatment of CDI.

3.4. Genome Sequencing of B. amyloliquefaciens C-1

The circular chromosome of C-1 contains 3,934,216 bp, 46.5% GC content, 27 rRNA and 86 tRNA genes (Table 2, Figure 4(a)). Genome annotation at the RAST server showed that the C-1 genome encodes 4013 proteins, and the corresponding functional categorization by COG annotation is in Figure 4(b). The sequence data of the B. amyloliquefaciens C-1 genome were deposited into NCBI and can be accessed via accession number SRP127533.
Table 2

Genome project information summary of B. amyloliquefaciens C-1.

Property/attributesC-1Property/attributesC-1
Finishing qualityHigh-quality draftTotal predicted CDS3805
Sequencing platformPacBio SequelrRNA operons27
Total bases (Mb)757.4tRNA86
NCBI taxonomy ID1386tmRNA1
BioProject IDPRJNA427474Noncoding RNA81
Genome size (bp)3934216Miscellaneous RNA81
GC content (%)46.5
Figure 4

The genome map (a) of B. amyloliquefaciens C-1 and overview of the subsystem category coverage of the C-1 genome based on RAST serve (b). The red circle is the CDS of the forward strand, and the blue circle is the CDS of the reverse strand. The outer circle represents the categorization of predicted protein coding sequences in the C-1 genome in COG annotation, and the inner circle represents the genes encoding function RNA.

Blast searches of the 16S rRNA gene sequence of C-1 showed that it was most similar to other B. amyloliquefaciens isolates. B. amyloliquefaciens isolates appear to group into two clades indicated by phylogenetic tree analysis (). Although C-1 is in the same clade with known strains such as DSM7, ATCC19217, and ATCC 14580, it appears to be phylogenetically distant from most other isolates.

3.5. Secondary Metabolites from B. amyloliquefaciens Strains

As much as 8.5% of the B. amyloliquefaciens C-1 genome CDS was assigned to categories related to the secondary metabolites responsible for the control of pathogens (“Motility and Chemotaxis” [85 CDS], “Membrane Transport” [71 CDS], “Virulence, Disease and Defense” [70 CDS], “Secondary Metabolism” [6 CDS], and “Stress Responses” [108 CDS]). For the functional categories of genes, a possible role in bacteria inhibition may be important. In the carbohydrate transport and metabolism category, 437 genes (10.9% of total genes) were predicted in the C-1 genome. This finding suggests that C-1 possesses a broad battery of genes coding for enzymes required to release a variety of environmental carbon sources. As a Bacillus. spp., B. amyloliquefaciens possesses an enormous potential to synthesize bioactive secondary metabolites, especially nonribosomal-synthesized peptides and polyketides. For the nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKS), we used antiSMASH to identify related giant gene clusters (Table 3, ). C-1 was found to harbor genes encoding six nonribosomal peptides (surfactins (srfABCD), iturins (ituABCD), fengycins (fenABCDE), bacillibactin (bmyABC), teichuronic, and bacilysin) and three polyketides (bacillaene (baeEDLMNJRS), difficidin (difABCDEFGHIJ), and macrolactin (mlnABCDEFGHI)). Compared with other sequenced B. amyloliquefaciens strains, fengycin, difficidin, bacillibactin, bacilysin, macrolactin, and bacillanen showed 100% identity, whereas surfactins had 82% identity (). Surfactin can inhibit a wide range of microorganisms due to its ability to insert into the cell wall and create ion pores. Bacillomycin D, iturin, and fengycin have antifungal properties primarily based on their ability to disrupt the cell wall [30, 31]. Macrolactins, important 24-membered macrolactones produced by Bacillus spp., exhibit antimicrobial activities, where macrolactin A and E and succinyl macrolactin are the representative compounds. And it is assembled by a modular PKS system like macrolides, which could inhibit the H+-transporting ATPase of the bacterial cells [32]. Polyketide compounds inhibit a wide range of microorganisms by preventing protein synthesis [31]. The identity of surfactin among different strains varied from 82% to 96%, including subunit genes of SrfAA, SrfAB, SrfAC, and SrfAD (). C-1 had all the subunit genes, SrfAA, SrfAB, SrfAC, and SrfAD, and the mutation of subunit genes in other strains may indicate loss of the ability to synthesize secondary metabolites [33].
Table 3

Identification of gene clusters potentially involved in the synthesis of secondary metabolites by B. amyloliquefaciens C-1.

ClusteraTypebFromcTocSecondary metabolited
1Saccharide165858190731Unknown
2NRPS556597622004Surfactin
3Fatty acid785309810347Unknown
4NRPS938299967890Iturins
5Other KS11584361199680Butirosin
6Fatty acid12277471248724Unknown
7Terpene12817201302460Unknown
8Fatty acid13145191339344Citrulline
9Putative13789281396630Molybdenum cofactor
10Lantipeptide14066871451837Unknown
11Transatpks16244331706630Macrolactin
12Transatpks-NRPS19327372035409Bacillaene
13Transatpks-NRPS21000372237835Fengycin
14Terpene22630572284940Unknown
15T3PKS23482572389357Unknown
16Transatpks25043422604794Difficidin
17Bacteriocin-NRPS32352043301995Bacillibactin
18Saccharide35046673530078Unknown
19Saccharide36240183678829Teichuronic
20Saccharide38232783895655Bacilysin

aClusters identified using default settings of antiSMASH 5.0. bClass of gene cluster according to antiSMASH 5.0. cLocation of gene clusters in the B. amyloliquefaciens C-1 genome. dSecondary metabolites potentially produced based on the gene clusters.

PCR experiments detected C-1 surfactin, iturin, and fengycin genes, an intact Bac operon that included Bacilysin biosynthesis proteins BacA, BacB, BacC, BacD, and BacE (ORF3909-3913), and the oligopeptide permease operon (ORF1362-1366). Bac proteins, nonribosomally synthesized dipeptides active against a range of bacteria and some fungi, are involved in the biosynthesis of bacilysin. The proteolysis of this dipeptide releases the nonproteinogenic amino acid L-anticapsin, which functions as a competitive inhibitor of glucosamine synthase and can cause lysis of fungal cells [34]. Because there was 100% sequence identity of bacilysin, whereas there was no antifungal activity of the C-1 lipopeptide and exopolysaccharide, the regulation and expression of the encoded Bac operon, and modification of produced bacilysin, deserve more analysis. Other antimicrobial gene clusters were predicted by antiSMASH, such as the lantibiotic amylolysin [35], the bacteriocin amylocyclicin [36], and the aminoglycoside antibiotic butirosin [37]. These antibacterials have not been detected by chemical analysis from C-1 supernatants, possibly because of the fermentation medium or condition that had been used [38]. Potential gene clusters may explain the broad activity of C-1 against pathogens. We also detected in the C-1 genome other beneficial genes, such as phospholipase (ORF767) and siderophore production genes. There were seven gene clusters responsible for siderophore production and iron acquisition, including an ABC-type Fe3+-siderophore transport system (ORF1-2, ORF3417-3418, 4007-4008), an Fe-bacillibactin uptake system (ORF413-415), an iron compound ABC uptake transporter (ORF624-627), and a siderophore biosynthesis protein (ORF1221-1222, 3262-3267). These proteins enable bacteria to sequester iron complexes produced by other pathogens and antagonize certain pathogens [38, 39]. Moreover, we also detected genes for amphiphilic membrane-active biosurfactants and peptide antibiotics that have powerful antibacterial and mosquito larvicidal activity. The giant gene clusters add to the capacity of the C-1 bacterium to contribute to the antimicrobial activity against C. difficile. And we also checked the biosafety of the C-1 strain by using Galleria mellonella and intestinal epithelial cells, which all indicated the safety of B. amyloliquefaciens C-1. A future study of how these gene clusters are expressed and regulated will help explain the synthesis of antimicrobial lipopeptides and augment our knowledge for the control of CDI.

4. Conclusions

B. amyloliquefaciens C-1 fermentation supernatant contains a mixture of lipopeptides, namely, surfactin and fengycin, which had a strong inhibitory effect on C. difficile growth and viability. Systematic research of the antibacterial mechanism showed that the C-1 lipopeptide damages the integrity and permeability barrier of the cell wall and cell membrane, then leads to C. difficile cell death. The ~3.93 Mbp genome of C-1 reveals the genetic basis of its antimicrobial activity, and the antimicrobial compound-encoding gene clusters provide better understanding of the antibacterial mechanisms of this strain. Furthermore, the genome analysis will facilitate the production of effective probiotics that inhibit multidrug resistant pathogens in the host intestinal ecosystem, especially the phospholipase- and siderophore-producing clusters. Until now, the anti-C. difficile activities of the bacteriocins were known predominantly from in vitro studies; thus, the in vivo efficacies of the majority of these bacteriocins deserve further investigation.
  36 in total

1.  Lipopeptides, a novel protein, and volatile compounds contribute to the antifungal activity of the biocontrol agent Bacillus atrophaeus CAB-1.

Authors:  Xiaoyun Zhang; Baoqing Li; Ye Wang; Qinggang Guo; Xiuyun Lu; Shezeng Li; Ping Ma
Journal:  Appl Microbiol Biotechnol       Date:  2013-09-07       Impact factor: 4.813

2.  Amylocyclicin, a novel circular bacteriocin produced by Bacillus amyloliquefaciens FZB42.

Authors:  Romy Scholz; Joachim Vater; Anto Budiharjo; Zhiyuan Wang; Yueqiu He; Kristin Dietel; Torsten Schwecke; Stefanie Herfort; Peter Lasch; Rainer Borriss
Journal:  J Bacteriol       Date:  2014-03-07       Impact factor: 3.490

3.  Activity of a novel cyclic lipopeptide, CB-183,315, against resistant Clostridium difficile and other Gram-positive aerobic and anaerobic intestinal pathogens.

Authors:  D R Snydman; N V Jacobus; L A McDermott
Journal:  Antimicrob Agents Chemother       Date:  2012-03-05       Impact factor: 5.191

4.  Regulation of the Synthesis and Secretion of the Iron Chelator Cyclodipeptide Pulcherriminic Acid in Bacillus licheniformis.

Authors:  Dong Wang; Yangyang Zhan; Dongbo Cai; Xiaoyun Li; Qin Wang; Shouwen Chen
Journal:  Appl Environ Microbiol       Date:  2018-06-18       Impact factor: 4.792

5.  Cyclic lipopeptide signature as fingerprinting for the screening of halotolerant Bacillus strains towards microbial enhanced oil recovery.

Authors:  Bárbara C S Farias; Denise C Hissa; Camila T M do Nascimento; Samuel A Oliveira; Davila Zampieri; Marcos N Eberlin; Deivid L S Migueleti; Luiz F Martins; Maíra P Sousa; Danuza N Moyses; Vânia M M Melo
Journal:  Appl Microbiol Biotechnol       Date:  2017-12-07       Impact factor: 4.813

6.  HMMER web server: interactive sequence similarity searching.

Authors:  Robert D Finn; Jody Clements; Sean R Eddy
Journal:  Nucleic Acids Res       Date:  2011-05-18       Impact factor: 16.971

7.  The antiSMASH database, a comprehensive database of microbial secondary metabolite biosynthetic gene clusters.

Authors:  Kai Blin; Marnix H Medema; Renzo Kottmann; Sang Yup Lee; Tilmann Weber
Journal:  Nucleic Acids Res       Date:  2016-10-24       Impact factor: 16.971

8.  Characterization of lpaH2 gene corresponding to lipopeptide synthesis in Bacillus amyloliquefaciens HAB-2.

Authors:  Pengfei Jin; Haonan Wang; Wenbo Liu; Weiguo Miao
Journal:  BMC Microbiol       Date:  2017-12-04       Impact factor: 3.605

9.  Draft genome sequence of Bacillus velezensis 2A-2B strain: a rhizospheric inhabitant of Sporobolus airoides (Torr.) Torr., with antifungal activity against root rot causing phytopathogens.

Authors:  Inés Martínez-Raudales; Yumiko De La Cruz-Rodríguez; Alejandro Alvarado-Gutiérrez; Julio Vega-Arreguín; Ahuitz Fraire-Mayorga; Miguel Alvarado-Rodríguez; Victor Balderas-Hernández; Saúl Fraire-Velázquez
Journal:  Stand Genomic Sci       Date:  2017-12-05

10.  Comparative Genomics of Bacillus amyloliquefaciens Strains Reveals a Core Genome with Traits for Habitat Adaptation and a Secondary Metabolites Rich Accessory Genome.

Authors:  Lassaad Belbahri; Ali Chenari Bouket; Imen Rekik; Faizah N Alenezi; Armelle Vallat; Lenka Luptakova; Eva Petrovova; Tomasz Oszako; Semcheddine Cherrad; Sébastien Vacher; Mostafa E Rateb
Journal:  Front Microbiol       Date:  2017-08-03       Impact factor: 5.640

View more
  5 in total

1.  Identification of ADS024, a newly characterized strain of Bacillus velezensis with direct Clostridiodes difficile killing and toxin degradation bio-activities.

Authors:  Michelle M O'Donnell; James W Hegarty; Brian Healy; Sarah Schulz; Calum J Walsh; Colin Hill; R Paul Ross; Mary C Rea; Ronald Farquhar; Laurent Chesnel
Journal:  Sci Rep       Date:  2022-06-03       Impact factor: 4.996

Review 2.  Bioengineered Probiotics: Synthetic Biology Can Provide Live Cell Therapeutics for the Treatment of Foodborne Diseases.

Authors:  Karla Cristina P Cruz; Laura O Enekegho; David T Stuart
Journal:  Front Bioeng Biotechnol       Date:  2022-05-17

3.  Probiotic Potential Analysis and Safety Evaluation of Enterococcus durans A8-1 Isolated From a Healthy Chinese Infant.

Authors:  Yi Zhou; Lu Shi; Juan Wang; Jia Yuan; Jin Liu; Lijuan Liu; Rong Da; Yue Cheng; Bei Han
Journal:  Front Microbiol       Date:  2021-12-14       Impact factor: 5.640

4.  Simultaneous Production of Multiple Antimicrobial Compounds by Bacillus velezensis ML122-2 Isolated From Assam Tea Leaf [Camellia sinensis var. assamica (J.W.Mast.) Kitam.].

Authors:  Patthanasak Rungsirivanich; Elvina Parlindungan; Paula M O'Connor; Des Field; Jennifer Mahony; Narumol Thongwai; Douwe van Sinderen
Journal:  Front Microbiol       Date:  2021-11-24       Impact factor: 5.640

Review 5.  Antimicrobial Bacillus: Metabolites and Their Mode of Action.

Authors:  Charlie Tran; Ian E Cock; Xiaojing Chen; Yunjiang Feng
Journal:  Antibiotics (Basel)       Date:  2022-01-12
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.