Long noncoding RNA UCA1 promotes cell growth, migration, and invasion by targeting miR-143-3p in oral squamous cell carcinoma.

BACKGROUND: The long noncoding RNA (lncRNA) urothelial carcinoma-associated 1 (UCA1) is dysregulated in many types of tumors; however, its role in oral squamous cell carcinoma (OSCC) remains unclear. This study aims to determine the effect of lncRNA UCA1 on OSCC.
METHODS: Fifty-six paired OSCC and adjacent nontumorous tissues were collected and the levels of UCA1, miR-143-3p, and MYO6 in the tissues were evaluated by qRT-PCR. In in vitro experiments, cell viability, migration, and invasion were measured by, respectively, performing CCK-8, wound healing, and transwell assays. The target relationships among UCA1, miR-143-3p, and MYO6 were verified by dual-luciferase assay. Western blot and immunohistochemistry were carried out to determine the protein levels. Xenograft mouse model was established to explore the effects of UCA1 in vivo.
RESULTS: Levels of UCA1 and MYO6 were increased significantly in OSCC, while the level of miR-143-3p was decreased compared with the adjacent nontumorous tissues. UCA1 promoted OSCC cell growth, migration, and invasion both in vitro and in vivo, while miR-143-3p reversed the progression. MYO6 was validated as a target for miR-143-3p, and MYO6 overexpression reversed the effects of miR-143-3p mimic on OSCC cells.
CONCLUSION: LncRNA UCA1 contributes to the proliferation and metastasis of OSCC cells by targeting miR-143-3p and upregulating its downstream gene MYO6. UCA1 could serve as a promising novel target therapy for treatment of OSCC.

INTRODUCTION

Oral squamous cell carcinoma (OSCC) is the sixth most prevalent malignancy in the world,1 and often occurs in the lips, tongue, buccal mucosa, floor, gingiva, hard palate, and retromolar trigone.2 A study indicates that young white population aged 18‐44 years have a higher rate of developing OSCC.3 Though efforts have been made in advancing the diagnosis and treatment methods, 5‐year survival rate of patients with OSCC is still not satisfactory.4 Therefore, OSCC treatments, including extending survival time, remain a challenge to be solved.

Long noncoding RNAs (lncRNAs) can form complex networks by the interactions with microRNAs (miRNAs), messenger RNAs (mRNAs), and proteins, and play pivotal roles in different cancers.5 LncRNAs are involved in the progress of OSCC through affecting various aspects of cellular homeostasis.6 LncRNA urothelial cancer‐associated 1 (UCA1) exerts critical effects on various cancers. LncRNA UCA1 is elevated in the bile duct carcinoma (BDC) and promotes BDC cell migration and invasiveness.7 Moreover, lncRNA UCA1 can promote human pancreatic ductal adenocarcinoma stem cell properties and suppress tumor growth.8 The oncogenic role of lncRNA UCA1 in other cancers, including glioblastoma,9 bladder,10 gastric,11 and prostate cancer,12 has been reported, the function of UCA1 in OSCC remains to be elucidated.

MiRNAs can also function vitally in the posttranscriptional regulation through binding to the 3’UTR of mRNAs. It is revealed that miRNAs can be separated by lncRNAs from their target mRNAs.13 MiR‐143‐3p shows a tumor‐suppressive role in many cancers such as cervical cancer,14 osteosarcoma,15 colorectal cancer,16 and laryngeal squamous cell carcinoma 17; however, whether miR‐143‐3p has a tumor‐suppressive function in OSCC remains unclear.

Myosin VI (MYO6), which is widely expressed in various organisms and tissues, is a unique member of the myosin superfamily.18 MYO6 could serve as an oncogene in human cancers, for instance, knocking down MYO6 suppresses the growth and induces the apoptosis in prostate cancer, colorectal cancer, and gastric cancer.19, 20, 21 In addition, knockdown of MYO6 also inhibits the proliferation of OSCC cells.22 Although MYO6 has been reported in many human tumors, including OSCC cells, its role in OSCC is unknown.

In the current study, we explore the clinical characteristics and role of lncRNA UCA1 in OSCC. We demonstrated that UCA1 was markedly increased in OSCC tissues and cells, and that UCA1 facilitated the progression of OSCC via regulating the miR‐143‐3p/MYO6 axis.

MATERIALS AND METHODS

Clinical tissues and cell lines

The tissues and matched adjacent normal tissues were collected from 56 OSCC patients (males/females, aged between 32 and 24 years, with a median age of 46 years) at the Affiliated Hangzhou First People's Hospital, Medical College of Zhejiang University from December 2016 to December 2017. The written informed consent was signed by all patients. The experiments were conducted following the ethical standards and were approved by the Affiliated Hangzhou First People's Hospital, Medical College of Zhejiang University, approval number: AHFPH20161221.

Human normal oral cell line HGF‐1 and OSCC cell lines (YD‐38, MK‐1) were obtained from the American Type Culture Collection (ATCC) and Cell Bank (Shanghai, China). The cells were grown in RPMI‐1640 medium containing 10% heat‐inactivated fetal bovine serum (Gibco) and 1% penicillin‐streptomycin (Gibco) at 37°C with 5% CO2.

Cell transfection

For cell transfection, YD‐38 cells (3 × 104/mL) were transfected with negative control (NC) small interfering (si) RNAs, UCA1 siRNA (si‐UCA1, Ribobio), MYO6 siRNA (si‐MYO6, Ribobio), or co‐transfected with si‐UCA1/si‐MYO6 and miR‐143‐3p inhibitor, or miR‐NC inhibitor (GenePharma). MK‐1 cells (3 × 104/mL) were transfected with a blank pcDNA3.1 vector (Invitrogen), a pcDNA3.1 containing UCA1 expression plasmid (pc‐UCA1) or MYO6 plasmid (MYO6), or co‐transfected with pc‐UCA1/MYO6 and miR‐143‐3p mimics, or miR‐NC mimics (GenePharma) using Lipofectamine 2000 (Invitrogen). The final concentration of vectors and miRNAs was 100 nmol/L. After transfection for 48 hours, the cells were preserved for the subsequent assays.

Reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR)

Total RNA was extracted from OSCC tissues and cells by RNAiso Plus (Takara). To determine the levels of lncRNA, miRNA, and mRNA, the cDNA was obtained by RNA using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). The reaction was performed on ABI PRISM 7900HT system (Applied Biosystems) with SYBR Premix Ex Taq (Takara). The levels of UCA1/mRNA and miR‐143‐3p were normalized to GAPDH and U6, respectively. The primers used are listed in Table 1 and the relative expressions were calculated by the 2−ΔΔCt method.23

Table 1

Primers and sequences of qRT‐PCR

Gene	sequence (5′‐3′)
UCA1‐Forward	TGACAACAGATAACCACCT
UCA1‐Reverse	TCCGTATAGAAGACCACCTA
miR‐143‐3p‐Forward	GGGGTGAGATGAAGCACTG
miR‐143‐3p‐Reverse	CAGTGCGTGTCGTGGAGT
MYO6‐Forward	CAGAGCAACGTGCTCCAAAGTC
MYO6‐Reverse	GAAGCGTTGCTG TCGGTTCA
MMP‐2‐Forward	TGATTCTGGTCGCTCAGATG
MMP‐2‐Reverse	CTTGTTTCCCAGGAAGGTGA
MMP‐9‐Forward	AGGACCATGGGGATCCTTAC
MMP‐9‐Reverse	AACACAAGGCTGCCCATTAC
E‐cadherin‐Forward	TAACCGATCAGAATGAC
E‐cadherin‐Reverse	TTTGTCAGGGAGCTCAGGAT
N‐cadherin‐Forward	CAACTTGCCAGAAAACTCCAGG
N‐cadherin‐Reverse	ATGAAACCGGGCTATCTGCTC
U6‐Forward	CTCGCTTCGGCAGCACATA
U6‐Reverse	AACGATTCACGAATTTGCGT
GAPDH‐Forward	CACCATTGGCAATGAGCGGTTC
GAPDH‐Reverse	AGGTCTTTGCGGATGTCCACGT

Differential gene expression analyses

The http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE54672 dataset including one primary tumor tissue and one metastasis tissue was downloaded from the GEO. The differentially expressed genes (DEGs) were identified by interactive online tool GEO2R, with P < .05 and log fold‐change (FC) >2 served as the cutoff criteria. Venny 2.1 was used to identify the overlapping DEGs, which were upregulated in the http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE54672, TargetScan7.2 datasets, and miRanda datasets.

Dual‐luciferase reporter assay

The binding site between UCA1 and miR‐143‐3p was determined by starbase v3.0 and that between MYO6 and miR‐143‐3p was predicted by TargetScan7.2. The UCA1 and MYO6 wt/mut 3′‐UTR were, respectively, inserted into pmirGLO plasmid (Promega). Then, the vectors (2 µg/mL) were co‐transfected with miR‐NC or miR‐143‐3p mimics (50 nmol/L) into the cells using Lipofectamine 2000 reagent (Invitrogen). Luciferase activity was measured by the Dual‐Glo Luciferase assay (Promega).

Cell counting kit‐8 (CCK‐8) assay

Cell growth was detected using CCK‐8 (Dojindo). Briefly, YD‐38 and MK‐1 cells (5 × 103/well) were incubated for 24 or 48 hours. Then, CCK‐8 solution was added and incubated for another 4 hours. The optical density (OD) was measured at 490 nm using a microplate reader (Detie Laboratory Equipment Companya).

Wound healing assays and Transwell invasion assay

The transfected cells (1 × 105/well) were cultured in 6‐well plates until the cell confluence reached over 90%, and then a scratch was created using a 10‐μL pipette tip. The wound closures were observed and photographed at 0 and 24 hours after scratching under a microscope (Olympus). The wound closure was measured by ImageJ (v1.42, NIH).

To detect the invasive ability of OSCC cells, transwell chamber was treated with Matrigel (BD Biosciences). Next, the transfected cells (1 × 105 cells/well) were seeded into the upper chamber containing serum‐free medium, while 600‐μL medium was added into the lower chamber. After incubation for 24 hours, the invaded cells were fixed, stained, and counted under a microscope (Olympus).

Western blot

The protein in tissues and cells was isolated in RIPA lysis buffer (Beyotime) and the concentration of protein was measured using BCA Kit (Beyotime). An equal amount of proteins were separated on 10% SDS‐PAGE (40 µg protein/lane) and then were transferred onto PVDF membranes (Millipore), which were incubated in 5% nonfat milk for 1 hour at room temperature. The membranes were subsequently incubated at 4°C overnight with primary antibodies including anti‐MYO6 (1:1000, ab230478, Abcam), anti‐MMP‐2 (1:1000, ab37150, Abcam), anti‐MMP‐9 (1:1000, ab38898, Abcam), anti‐GAPDH (1:1000, ab8245, Abcam), anti‐E‐cadherin (1:1000, #3195, Cell Signaling Technology), and anti‐N‐cadherin (1:1000, #13116, Cell Signaling Technology). Next, they were incubated with the HRP‐conjugated goat anti‐rabbit IgG (1:10 000, ab6721, Abcam) for 1 hour at room temperature. The bands were detected by enhanced chemiluminescence detection kit (Thermo scientific), and the intensity was quantified using ImageJ software v1.42 (NIH). The GAPDH served as a loading control.

Immunohistochemistry

After immersing the sections in citrate (pH = 6.0) and antigen retrieval buffers, the paraffin‐embedded sections were treated with 3% H2O2 and incubated with 10% goat serum. After that, the sections were washed with Tris‐buffered saline Tween‐20 (TBST) and then incubated with rabbit polyclonal anti‐MYO6 (1:100, ab230478, Abcam) at 4°C overnight. Next, the sections were incubated with HRP‐conjugated goat anti‐rabbit IgG. The signal was detected by DAB Substrate kit following the manufacture's instruction and the images were observed under a microscope (Olympus).

Xenograft animal model

Male nude mice (aged 4‐6 weeks old; weighting 20‐24 g) were purchased from Slac Laboratory Animal Center (Shanghai, China) and housed in an SPF‐grade barrier environment at the Affiliated Hangzhou First People's Hospital, Medical College of Zhejiang University, approval number: AHFPH20171230. The animal protocol was approved by the Institutional Animal Care and Use Committee of the Affiliated Hangzhou First People's Hospital, Medical College of Zhejiang University. The transfected cells (5 × 107/mL, 0.1 mL) were subcutaneously injected into the nude mice (n = 5 per group). Four weeks later, the mice were sacrificed and the tumor tissues were photographed, weighed, and collected for immunohistochemistry and Western blot.

Statistical analysis

GraphPad Prism version 5.0 (GraphPad Software) was used to analyze the data, which were shown as the mean ± standard deviation (SD). Student's t tests were used to examine differences between the two groups, whereas differences between three or more groups were analyzed by one‐way ANOVA. The significance of correlations among UCA1, miR‐143‐3p, and MYO6 levels was assessed by the Pearson correlation coefficient. A P < .05 was considered as statistically significant. All experiments were repeated at least in triplicate.

RESULTS

UCA1 is upregulated in OSCC and sponges miR‐143‐3p

To explore whether UCA1 is abnormal in OSCC, we measured the level of UCA1 in 56 OSCC tissues and matched normal ones. The level of UCA1 was increased more in the tumor tissues than that in normal tissues (P < .001, Figure 1A); however, the level of miR‐143‐3p exhibited an opposite trend (P < .001, Figure 1B), showing a notably negative correlation with UCA1 expression (P < .001, Figure 1C). Similarly, the UCA1 showed a higher level in the two OSCC cell lines than that in human normal oral cells, while miR‐143‐3p had an opposite expression (P < .01, Figure 1D,E).

Figure 1

The level of lncRNA UCA1 is increased and that of miR‐143‐3p is reduced in OSCC, and lncRNA UCA1 is a sponge of miR‐143‐3p. The levels of lncRNA UCA1 (A) and miR‐143‐3p (B) were determined in OSCC tissues and adjacent noncancerous tissues by qRT‐PCR. C, Scatter diagram revealed a negative correlation between UCA1 and miR‐143‐3p in 56 pairs of OSCC tissues by RT‐qPCR. The lncRNA UCA1 (D) and miR‐143‐3p (E) were detected in OSCC cell lines and human normal oral cell line by RT‐qPCR.(F) The miR‐122 binding position on UCA1 was predicted by starbase v3.0. G and H, Dual‐luciferase reporter assay of OSCC cells co‐transfected with wt/mut UCA1 sequence and miR‐143‐3p mimics or the miR‐NC. ** P < .01

To further assess the clinical significance of UCA1 expression in OSCC, the OSCC patients were assigned into high (n = 25) and low (n = 31) expression groups according to the median level of expression. As shown in Table 2, high UCA1 expression was remarkably correlated with lymphatic metastasis and recurrence. We also evaluated the clinical significance of miR‐143‐3p in OSCC. We found that low level of miR‐143‐3p was significantly related to lymphatic metastasis and recurrence (Table 3).

Table 2

The relationship between UCA1 expression and clinical characteristics of oral squamous cell carcinoma

Characteristics	Patients (n = 56)	UCA1		χ2	P
		High (n = 25)	Low (n = 31)
Age
≤60	30	13 (43.33%)	17 (56.67%)	0.045	.832
>60	26	12 (46.15%)	14 (53.85%)
Sex
Male	32	14 (43.75%)	18 (56.25%)	0.024	.877
Female	24	11 (45.83%)	13 (54.17%)
Lymphatic metastasis
Present	23	14 (60.87%)	9 (39.13%)	4.159	.041
Absent	33	11 (33.33%)	22 (66.67%)
Recurrence
Present	18	12 (66.67%)	6 (33.33%)	5.206	.023
Absent	38	13 (34.21%)	25 (65.79%)
Absent	38	24 (63.16%)	14 (36.84%)

Table 3

The relationship between miR‐143‐3p expression and clinical characteristics of oral squamous cell carcinoma

Characteristics	Patients (n = 56)	miR‐143‐3p		χ2	P
		High (n = 30)	Low (n = 26)
Age
≤60	30	15 (50.00%)	15 (50.00%)	0.331	.565
>60	26	15 (57.69%)	11 (42.31%)
Sex
Male	32	17 (53.13%)	15 (46.87%)	0.006	.938
Female	24	13 (54.17%)	11 (45.83%)
Lymphatic metastasis
Present	23	8 (34.78%)	15 (65.22%)	5.540	.019
Absent	33	22 (66.67%)	11 (33.33%)
Recurrence
Present	18	6 (33.33%)	12 (66.67%)	4.368	.037
Absent	38	24 (63.16%)	14 (36.84%)

UCA1 has been reported as ceRNAs to specific miRNAs in regulating tumor progression. Here, starbase v3.0 identified that UCA1 had a complementary binding site with miR‐143‐3p (Figure 1F). Furthermore, the miR‐143‐3p mimics obviously suppressed the luciferase activity of the vector containing UCA1‐WT (P < .01); however, it had no effect on that of the vector with UCA1‐Mut in YD‐38 and MK‐1 cells (Figure 1G,H).

MiR‐143‐3p reverses the UCA1‐induced OSCC cell proliferation, migration, and invasion

To validate our speculation that UCA1 promotes proliferation, migration, and invasion of OSCC cells by acting as a sponge of miR‐143‐3p, the UCA1 and miR‐143‐3p expressions in transfected cells were determined. The UCA1 expression was notably decreased by si‐UCA1 but were increased in the cells transfected with pc‐UCA1 (P < .01); meanwhile, the miR‐143‐3p mimics or inhibitors had no significant effects on the UCA1 expression (Figure 2A,B). In addition, the levels of miR‐143‐3p in si‐UCA1 group and mimic group were upregulated but could be inhibited by pc‐UCA1 and inhibitors (P < .01, Figure 2C,D). The CCK8 assay results showed that compared with the controls, knocking down UCA1 in YD‐38 cells significantly suppressed the cell viability, which, however, was rescued by the miR‐143‐3p inhibitors (P < .05, Figure 2E). In MK‐1 cells, the overexpressed UCA1 greatly promoted cell proliferation, and miR‐143‐3p mimics attenuated the effect of UCA1 (P < .05, Figure 2F).

Figure 2

LncRNA UCA1 promotes OSCC cell proliferation, migration, and invasion by inhibiting miR‐143‐3p. A and B, The lncRNA UCA1 expression in YD‐38 and MK‐1 cells 48 h after transfection was determined by RT‐qPCR. C and D, The miR‐143‐3p expressions in YD‐38 and MK‐1 cells 48 h after the transfection were determined by RT‐qPCR. E and F, CCK‐8 assays of YD‐38 and MK‐1 cell proliferation at 24 h and 48 h. G and H, Representative images of cell migration in each group of YD‐38 and MK‐1 cells at 0 h and 24 h. I and J, Representative images of cell invasion in each group of YD‐38 and MK‐1 cells at 24 h. K and L, Migration distance in each group of YD‐38 and MK‐1 cells. M and N, The number of invasive cells in each group of YD‐38 and MK‐1 cells. * P < .05, ** P < .01

To further investigate the effect of UCA1 on metastasis, wound healing and transwell assays were performed (Figure 2G‐J). The inhibition of UCA1 by siRNA effectively suppressed cell migration and invasion, while overexpressed UCA1 greatly accelerated the migration and invasion in comparison to those in control groups; however, these effects of UCA1 were reversed by miR‐143‐3p (P < .01, Figure 2K‐N).

UCA1 positively regulates MYO6 by sponging miR‐143‐3p

The genes that were potentially regulated by miR‐143‐3p were determined. For the http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE54672 dataset, a total of 2232 upregulated DEGs were extracted, and 17 DEGs, including MYO6, had overlapping area in the three databases (Figure 3A). The targeted binding site between miR‐143‐3p and MYO6 was predicted by TargetScan7.2 (Figure 3B), and luciferase reporter assays verified that miR‐143‐3p mimics markedly reduced the luciferase activity in the MYO6‐wt group but it had no effect on the MYO6‐mut group in YD‐38 and MK‐1 cells (Figure 3C,D). The protein and mRNA levels of MYO6 were detected by Western blot and RT‐qPCR in transfected OSCC cells. The pc‐UCA1 or miR‐143‐3p inhibitors increased MYO6, which was significantly suppressed by si‐UCA1 or miR‐143‐3p mimics (P < .01, Figure 4A‐F). The MYO6 expression in co‐transfected cells exhibited no significant difference from that in the control group. Moreover, the RT‐qPCR and immunohistochemistry results showed that MYO6 in the OSCC tissues was greatly elevated compared with that in normal tissues (P < .01, Figure 4G‐I). We found that MYO6 was negatively correlated with miR‐143‐3p but positively correlated with UCA1 in 56 pairs of OSCC tissues by qRT‐PCR (P < .001, Figure 4J,K).

Figure 3

MiR‐143‐3p directly targets MYO6 in OSCC cells. A, The http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE54672 dataset, miRDB website, and Targetscan website were used to predict the overlapped mRNA of miR‐143‐3p. B, The predicted miR‐143‐3p binding site in the MYO6 using Targetscan7.2. C and D, Dual‐luciferase reporter assay of OSCC cells co‐transfected with wt/mut MYO6 and miR‐143‐3p mimics or the miR‐NC. ** P < .01

Figure 4

MYO6 is elevated in OSCC. A, Western blot of MYO6 in each group of YD‐38 cells. B, The protein levels of the MYO6 in YD‐38 cells. C, The mRNA expression of MYO6 in each group of YD‐38 cells. D, Western blot of MYO6 in each group of MK‐1 cells. E, The protein levels of the MYO6 in MK‐1 cells. F, The mRNA expression of MYO6 in each group of MK‐1 cells. G, The MYO6 was detected in OSCC tissues and adjacent noncancerous tissues by qRT‐PCR. H, Representative immunohistochemical images of OSCC tumor sections for MYO6 (scale bar = 100 μm). I, The staining intensity of MYO6 by immunohistochemistry. J and K, Scatter diagram showed a positive correlation of UCA1 and MYO6 and a negative correlation of miR‐143‐3p and MYO6 in 56 pairs of OSCC tissues by RT‐qPCR. * P < .05, ** P < .01

MYO6 promotes OSCC cell proliferation and metastasis in vitro

To confirm the effect of MYO6 on the OSCC progression, MYO6 expression in OSCC cells was determined at the protein and mRNA levels. The knockdown of MYO6 in YD‐38 cells and overexpression of MYO6 in MK‐1 cells were effective, and miR‐143‐3p reversed the expression tendency of MYO6 (P < .01, Figure 5A‐F).

Figure 5

MiR‐143‐3p negatively regulates MYO6 in OSCC cell lines. A, Western blot analysis of MYO6 in each group of YD‐38 cells. B, The protein expression of the MYO6 in YD‐38 cells. C, The mRNA expression of MYO6 in each group of YD‐38 cells. D, Western blot analysis of MYO6 in each group of MK‐1 cells. E, The protein expression of the MYO6 in MK‐1 cells. F, The mRNA expression of MYO6 in each group of MK‐1 cells. * P < .05, ** P < .01

The CCK‐8 results showed that proliferation of YD‐38 cells was sharply inhibited by the knockdown of MYO6 but significantly increased by miR‐143‐3p inhibitors (P < .01, Figure 6A). Moreover, the MK‐1 cell growth was greatly improved by overexpressing MYO6 but suppressed by miR‐143‐3p mimics (P < .01, Figure 6B). Similarly, the inhibitory effect of miR‐143‐3p on cell migration and invasion was also rescued by MYO6 (P < .01, Figure 6C‐J).

Figure 6

MiR‐143‐3p inhibits OSCC cell proliferation, migration, and invasion by inhibiting MYO6. A and B, CCK‐8 assays of YD‐38 and MK‐1 cell proliferation in each group at 24 and 48 h. C and D, Representative images of cell migration in each group of YD‐38 and MK‐1 cells at 0 and 24 h. E and F, Representative images of cell invasion in each group of YD‐38 and MK‐1 cells at 24 h. G and H, Migration distance in each group of YD‐38 and MK‐1 cells. I and J, The number of invasive cells in each group of YD‐38 and MK‐1 cells. * P < .05, ** P < .01

UCA1 facilitates tumor progression in vivo

To further determine the role of UCA1 in OSCC tumorigenesis in vivo, transfected cells were injected into the nude mice, and we found that UCA1 silencing significantly suppressed tumor weight and size in xenograft mice; however, overexpressing UCA1 noticeably accelerated tumor growth, and the effect of UCA1 was attenuated by miR‐143‐3p (P < .01, Figure 7A‐D). Additionally, the protein and mRNA expressions of MYO6 were significantly reduced in the si‐UCA1 group but elevated in the pc‐UCA1 group, and miR‐143‐3p overturned these functions of UCA1 (P < .01, Figure 7E‐J). Moreover, immunohistochemical staining for MYO6 was also consistent with the protein and mRNA expressions of MYO6 (P < .01, Figure 8A‐D).

Figure 7

LncRNA UCA1 promotes tumor growth in a xenograft mouse model of OSCC. A‐D, Xenograft tumor was photographed and tumor weight was measured in each group of YD‐38 and MK‐1 cells. E, Western blot analysis of MYO6 in each group of YD‐38 cells. F, The protein expression of the MYO6 in YD‐38 cells. G, The mRNA expression of MYO6 in each group of YD‐38 cells. H, Western blot analysis of MYO6 in each group of MK‐1 cells. I, The protein expression of the MYO6 in MK‐1 cells. J, The mRNA expression of MYO6 in each group of MK‐1 cells. * P < .05, ** P < .01

Figure 8

LncRNA UCA1 upregulates MYO6 in a xenograft mouse model of OSCC. A, Representative immunohistochemical images for MYO6 of tumor sections from xenograft mice injected with YD‐38 cells (scale bar = 100 μm). B, The staining intensity of MYO6 by immunohistochemistry. C, Representative immunohistochemical images for MYO6 of tumor sections from xenograft mice injected with MK‐1 cells (scale bar = 100 μm). D, The staining intensity of MYO6 by immunohistochemistry. * P < .05, ** P < .01

To understand the effect of UCA1 on the OSCC metastasis, we measured the epithelial‐mesenchymal transition (EMT) markers and two matrix metalloproteinases (MMPs) of the tumor tissues in the mice. When UCA1 was suppressed, the expression of E‐cadherin (epithelial marker) was notably increased in the mRNA and protein levels, while the N‐cadherin (mesenchymal marker), MMP‐2, and MMP‐9 were downregulated (P < .01, Figure 9A‐C). However, when UCA1 was upregulated, the expression patterns of these molecules were the opposite (P < .01, Figure 9D‐F).

Figure 9

LncRNA UCA1 promotes EMT makers in a xenograft mouse model of OSCC. A, Western blot of EMT makers in each group of tumors from xenograft mice injected with YD‐38 cells. B and C, The protein and mRNA levels of the EMT makers in tumors from xenograft mice injected with YD‐38 cells. D, Western blot of EMT makers in each group of tumors from xenograft mice injected with MK‐1 cells. E and F, The protein and mRNA expression of the EMT makers in tumors from xenograft mice injected with MK‐1 cells. * P < .05, ** P < .01

DISCUSSION

Evidence indicated that lncRNAs are vital regulators in physiological process of cancers.24, 25 However, there are still limited studies performed on lncRNAs in OSCC. Therefore, it is urgent to determine the molecular mechanism of OSCC progression and discover effective therapy targets based on lncRNA.

Dysregulation of lncRNAs, including HOXA11‐AS, LEF1‐AS1, and TUG1, is involved in OSCC progression.26, 27, 28 Moreover, lncRNA ADAMTS9‐AS2 can promote tongue squamous cell carcinoma proliferation, migration, and EMT.29 However, the roles of lncRNAs in OSCC progression have not been clearly elucidated. Herein, we investigated the potential effect of the lncRNA UCA1 on OSCC, and found that UCA1 promotes OSCC cell proliferation, migration, and invasion in vitro and in vivo, suggesting that it could be a potential therapeutic target for treating OSCC.

Studies suggest that UCA1 serves as an oncogene in various human cancers, for instance, it promotes the growth of adrenocortical cancer cells, while silencing UCA1 can inhibit hemangioma cell growth, migration, and invasion.30, 31 UCA1 also plays an oncogenic role in nasopharyngeal carcinoma,32 osteosarcoma,33 colon,34 and pancreatic cancer.35 Additionally, UCA1 can act as a potential molecular marker for metastasis and prognosis in multiple cancers.36 In our study, UCA1 increased both in OSCC tissues and cells and promoted OSCC progression in vitro and in vivo.

Moreover, high expression of UCA1 was associated with lymphatic metastasis and recurrence of OSCC patients. Previous studies showed that EMT plays a pivotal role in tissue metastasis.37 LncRNAs are involved in EMT, for instance, the knockdown of lncRNA SNHG7 suppresses EMT in prostate cancer,38 and downregulated HAGLR inhibits EMT and metastatic potential in esophageal cancer.39 As a result, UCA1 may be conducive to OSCC metastasis via facilitating the EMT process. To further confirm our speculation, we detected the EMT markers (E‐cadherin and N‐cadherin) and MMPs in tumors from xenograft mice, and discovered that E‐cadherin was notably increased but N‐cadherin, MMP‐2, and MMP‐9 were greatly suppressed by si‐UCA1, indicating that the overexpression of UCA1 can enhance proliferation and EMT to cause an aggressive clinical outcome to OSCC patients.

LncRNAs can act as molecular sponges to miRNAs.40 UCA1 is reported to regulate cancer progression by acting as a sponge for miR‐582‐5p,41 miR‐204,42 miR‐495‐3p,43 and other miRNAs. Therefore, we identified some potential target miRNAs of UCA1 in OSCC using bioinformatics tools, and miR‐143‐3p was confirmed as a potential target for UCA1. Previous reports have revealed that miR‐143‐3p inhibits colorectal cancer metastases by targeting ITGA6 and ASAP3.44 In addition, miR‐143‐3p suppresses the growth and invasiveness of melanoma cells by targeting cyclooxygenase‐2.45 Furthermore, miR‐143‐3p can be targeted by other lncRNAs, including ADAMTS9‐AS2,46 OIP5‐AS1,47 and OECC,48 to inhibit tumor cell invasion and migration. Herein, we found that miR‐143‐3p mimics exerted an inhibitory effect on the OSCC cell growth and metastasis and was related to lymphatic metastasis and recurrence of patients with OSCC.

We discovered that miR‐143‐3p suppressed OSCC progression via targeting MYO6. The data revealed that MYO6 exhibited a tumor‐promoting property in various cancers, including prostate,19 gastric,21 breast,49 and lung cancer.50 Moreover, consistent with previous studies, we observed that MYO6 is a downstream target for miR‐143‐3p,51 and that MYO6 can also be regulated by lncRNA such as SOX21‐AS1.52 We also found that MYO6 was elevated in OSCC tissues and cells, and increased MYO6 reversed the inhibitory effects of miR‐143‐3p on OSCC cells, suggesting that miR‐143‐3p attenuated OSCC cell proliferation, migration, and invasion by suppressing MYO6. However, this study is still incomplete, and we still need to further verify the effect of MYO6 on EMT of OSCC cells.

CONCLUSION

In conclusion, our study indicates that UCA1 expression was significantly elevated in OSCC tissues and cells and was correlated with the metastasis and recurrence of OSCC patients. Moreover, the overexpression of UCA1 markedly promoted OSCC progression in vitro and in vivo by upregulating MYO6 expression as a sponge of miR‐143‐3p.

CONFLICT OF INTEREST

The authors declare no conflict of interest.