Transcriptomic Response in Pseudomonas aeruginosa towards Treatment with a Kaempferol Isolated from Melastoma malabathricum Linn Leaves.

Pseudomonas aeruginosa is one of the main causes of nosocomial infections and is frequently associated with opportunistic infections among hospitalized patients. Kaempferol-3-O-(2',6'-di-O-trans-p-coumaroyl)-β-D glucopyranoside (K F) is an antipseudomonal compound isolated from the leaves of the native medicinal plant Melastoma malabathricum. Herein, an RNA-seq transcriptomic approach was employed to study the effect of K F treatment on P. aeruginosa and to elucidate the molecular mechanisms underlying the response to K F at two time points (6 h and 24 h incubation). Quantitative real-time PCR (qRT-PCR) was performed for four genes (uvrD, sodM, fumC1, and rpsL) to assess the reliability of the RNA-seq results. The RNA-seq transcriptomic analysis revealed that K F increases the expression of genes involved in the electron transport chain (NADH-I), resulting in the induction of ATP synthesis. Furthermore, K F also increased the expression of genes associated with ATP-binding cassette transporters, flagella, type III secretion system proteins, and DNA replication and repair, which may further influence nutrient uptake, motility, and growth. The results also revealed that K F decreased the expression of a broad range of virulence factors associated with LPS biosynthesis, iron homeostasis, cytotoxic pigment pyocyanin production, and motility and adhesion that are representative of an acute P. aeruginosa infection profile. In addition, P. aeruginosa pathways for amino acid synthesis and membrane lipid composition were modified to adapt to K F treatment. Overall, the present research provides a detailed view of P. aeruginosa adaptation and behaviour in response to K F and highlights the possible therapeutic approach of using plants to combat P. aeruginosa infections.

1. Introduction

Pseudomonas aeruginosa sp. is deemed one of the major etiological agents of both acute and chronic human infections ranging from minor skin infections to persistent and often life-threatening diseases in hospitalized or immunocompromised patients [1, 2]. Infections caused by this organism are difficult to treat due to the ability of this bacterium to resist multiple classes of antibiotics [3]. Strains of P. aeruginosa are well known to employ their high levels of intrinsic and acquired resistance mechanisms to combat most antibiotics [4]. In addition, pathogenesis of P. aeruginosa is multifactorial, and many virulence factors are produced that include secreted factors such as cytotoxic pigment pyocyanin, siderophores, alkaline protease, elastase, exotoxin A, rhamnolipid structural component lipopolysaccharide, pili, flagella, and biofilm formation [5]. Therefore, alternative drugs and new therapeutic strategies that present novel avenues against P. aeruginosa infections are increasingly required and gaining more and more attention [4]. Previous studies by our research group demonstrated that KF can induce P. aeruginosa cell wall damage [6, 7]. Thus, we decided to investigate the gene expression profile of P. aeruginosa growing in kaempferol-3-O-(2′,6′-di-O-trans-p-coumaroyl)-β-D glucopyranoside isolated from Melastoma malabathricum known to locals in Malaysia as “senduduk.” Next-generation sequencing (NGS) technology may provide a detailed view of P. aeruginosa adaptation and behaviour in response to KF and could help researchers further understand the transcriptomic response of P. aeruginosa to KF exposure [8]. We compared the transcriptional responses of P. aeruginosa upon exposure to KF at an early time point (6 h incubation) and at a late time point (24 h incubation) to provide information about the KF mechanism of action. Transcriptomic data highlighted a marked modulation of gene expression characterized by the induction of the expression of several genes involved in pathogenesis, iron acquisition, DNA replication and repair, and metabolic adaptation to KF growth conditions. The results presented in this study provide a detailed view of gene expression changes in P. aeruginosa in response to KF exposure, facilitating the understanding of the cellular strategies that are utilized under KF exposure conditions and identifying a potential mechanism for the inhibition of P. aeruginosa after KF exposure.

2. Materials and Methods

2.1. Bacteria and Growth Conditions

P seudomonas aeruginosa strain ATCC 10145 was cultivated in Nutrient Broth (Oxoid, UK) with a shaking incubator at 151 rpm for 3 to 6 h at 37°C to achieve log phase growth. At the log phase (∼6 h incubation), KF was added to the P. aeruginosa culture in Mueller Hinton Broth (Oxoid, UK) at a density of 4 × 105 CFU/mL to achieve a final concentration of 0.5 mg/mL dissolved in 5% dimethyl sulfoxide (DMSO). DMSO (5%) was used as a negative control for untreated cells. The cultures were incubated at 37°C with a shaking incubator at 200 rpm.

2.2. RNA Extraction, cDNA Library Construction, and Illumina Sequencing

Total RNA was extracted from P. aeruginosa (treated or untreated) and harvested after 6 h and 24 h of incubation. RNA was extracted using an innuPREP RNA Mini Kit (Analytik Jena Biometra, Germany). The quantity and integrity were first determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA) and Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). The total RNA was depleted of rRNA using a ScriptSeq™ Complete Kit (Bacteria; Epicenter, San Diego, CA, USA). Total RNA samples were used for cDNA synthesis. Magnetic beads with attached poly T oligos were used to purify mRNA from the total RNA. The mRNA was then cleaved into small fragments by the addition of RNA fragmentation solution. First strand cDNA was synthesized using random hexamer adaptors and StarScript Reverse Transcriptase, followed by the synthesis of second strand cDNA using ScriptSeq v2 Terminal Tagging Premix and DNA polymerase. Exonuclease and polymerase were used to blunt and adenylate the 3′ ends of the DNA fragments, and Illumina PE adapter oligonucleotides were ligated to prepare for hybridization. The cDNA fragments (280 bp) were purified using the Pure AMXP system (Beckman Coulter, Beverly, CA, USA). The cDNA fragments with ligated adaptor molecules were enriched using Illumina PCR Primer Cocktail in a 15-cycle PCR. Finally, the cDNA library was sequenced on the Illumina MiSeq platform (San Diego, CA, USA) using single-end technology in a single run at the Institute of Biosciences, Universiti Putra Malaysia. The Illumina MiSeq software was used to perform the original image processing for sequencing, base calling, and quality value calculations, where 50 bp single-end reads were obtained.

2.3. Analysis of the Differentially Expressed Genes (DEGs)

The raw reads were filtered to obtain the high-quality clean data by removing adaptor sequences and low-quality reads with the Phred quality score ≤30. The clean reads were then mapped to the P. aeruginosa PA01 genome (NCBI reference sequence, NC_002516.2; GenBank accession number AE004091.2). FASTQ read values were calculated and normalized to transform into expression values by using CLC Genomics Workbench version 6.5. Differential expression analysis (fold changes) for RNAseq data was performed to compare two different samples (untreated versus treated samples) using Kal's Z-test. Genes with average fold changes >2 and adjusted p values less than 0.05 (i.e., false discovery rate less than 5%) were identified as significant DEGs. To better understand the biological functions and the metabolic pathways of the identified genes, the DEGs were functionally classified due to Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. The significant DEGs at both 6 h and 24 h were compiled and used to generate a Venn diagram through an online interactive tool [9]. The gene lists of unique and shared genes in each group identified in the Venn diagram were analysed using the Database for Annotation, Visualization, and Integrated Discovery (DAVID) (http://david.abcc.ncifcrf.gov/home.jsp). The DAVID database provides a comprehensive set of functional annotation tools to understand the biological meaning behind the DEGs, including visualizing genes on KEGG pathway maps. In addition, the obtained data were then compiled with public datasets downloaded from the Pseudomonas Genome Database (http://www.pseudomonas.com) for further analysis. The raw RNA-seq data have been submitted to the NCBI Sequence Read Archive (NCBI SRA) under GenBank accession no. SRP060687 (NCBI SRA, http://www.ncbi.nlm.nih.gov/sra?term=SRP060687).

2.4. Validation of DEGs by Quantitative Real-Time PCR (qRT-PCR)

In order to validate the RNA-seq data and to have a concise view of P. aeruginosa gene expression profiles over time, qRT-PCR was employed and gene expression levels were analysed on a subset of genes whose functions were documented to contribute to P. aeruginosa virulence. Four genes with different expression patterns at two time points were chosen for the validation of the RNA-seq results. The template cDNAs were synthesized from 1 μg of total RNA using oligo (dT)18, random hexamer primers, and reverse transcriptase enzyme mix (Maxima First Strand cDNA Synthesis Kit; Thermo Scientific, USA). A Luminaris Color HiGreen Fluorescein qPCR Master Mix (Thermo Scientific, USA) was used as a labelling agent, and L-aspartate oxidase (nadB) served as an internal reference gene. The reaction mixture (20 μL) contained 2 × Master Mix (10 μL), 10 μM forward and reverse primers (1.2 μL and 0.6 μL of each), template cDNA (2 μL), and RNase-free water (6.8 μL). The PCR program was as follows: 2 minutes (min) at 50°C, 10 min at 95°C, followed by 40 cycles for 15 seconds (sec) at 95°C, 40 cycles of 30 sec at 53°C and 40 cycles of 30 sec at 72°C. The reaction was performed on an iCycler iQ5 instrument (Bio-Rad Laboratories, Inc., Hercules, Canada). Two independent biological replicates were included for each sample. The relative expression of a target gene in comparison to a reference gene expression level was calculated using Relative Expression Software Tool Multiple Condition Solver REST-MCS©-version 2 (http://rest.gene-quantification.info).

3. Results

3.1. Transcriptomic Analysis

Genome-wide transcriptomic analysis was conducted to elucidate the mechanism through which KF exerts its killing effect on P. aeruginosa using NGS technology. After statistical analysis (Kal's Z-test), 2405 of the 5681 genes that comprise the P. aeruginosa genome were found to be significantly differentially regulated (p ≤ 0.05). A total of 2405 differentially expressed genes were classified based on the Pseudomonas Genome Database, KEGG pathways, individual operons, and genes potentially encoding targets associated with virulence factors.

Further analysis revealed that 1031 genes showed statistically significant upregulation (>2.0-fold) or downregulation (>2.0-fold) of expression at 6 h and 24 h of exposure to KF. Figure 1 illustrates that more downregulated genes in the functional classes were generally observed at 24 h compared to 6 h of incubation. The most noticeable number of downregulated genes among all functional classes was hypothetical, unclassified, and unknown (HUU) with unknown function.

Figure 1

Histograms representing the number of genes based on their functional classes for P. aeruginosa and for the upregulated expression (blue bars) and downregulated expression (red bars) genes among the 1031 significantly expressed genes at both 6 h and 24 h exposure to KF (0.5 mg/mL). The numbers in parentheses indicate the total number of genes for each functional class in both groups.

Note that 803 of 1031 genes were excluded as hypothetical proteins (HUUs). The Venn diagram for the remaining 228 genes at the two time points shows more uniquely over-represented genes at 24 h (115) than at 6 h (53), suggesting a difference between the early and late responses of P. aeruginosa to KF (Figure 2). A total of 228 genes were placed in six groups based on their expression change direction (Figure 3).

Figure 2

Venn diagram showing the overlap of significantly upregulated expression of genes at 6 h and 24 h exposure to KF (0.5 mg/mL). (a) Venn diagram for early time point (6 h). (b) Venn diagram for late time point (24 h).

Figure 3

Classification of differentially upregulated and downregulated (total of 228) genes into six groups based on their functional classes at 6 h and 24 h exposure to KF (0.5 mg/mL). Group I consisted of genes with upregulated expression at 6 h and 24 h. Group II consisted of genes with upregulated expression at 6 h without significant changes at 24 h. Group III consisted of genes with downregulated expression at 6 h without significant changes at 24 h. Group IV consisted of genes with upregulated expression at 24 h without significant changes at 6 h. Group V consisted of genes with downregulated expression at 24 h without significant changes at 6 h. Group VI consisted of genes with downregulated expression at 6 h and 24 h.

3.1.1. Group I: Genes with Upregulated Expression at 6 h and 24 h

Group I consisted of genes with upregulated expression at both 6 h and 24 h of exposure to KF (Table 1). Growth under KF exposure conditions induced changes in the expression of genes associated with ATP-binding cassette (ABC) transporters (agtABCD operon, PA4500), carbohydrate transporters (PA3190), and inorganic ion transporters (PA3514).

Table 1

List of the group I genes with upregulated expression at 6 h and 24 h.

Genes	6 h fold change	p value	24 h fold change	p value	Description	Functional class
agtA	20.45	0	9.21	0	ABC-type spermidine/putrescine transport systems, ATPase components	TSMs
agtB	32.34	0	8.09	0	ABC-spermidine/putrescine-binding periplasmic protein	TSMs
agtC	25.25	0	4.57	0	ABC-type spermidine/putrescine transport system, permease component I	TSMs; MPs
agtD	15.20	1.68E − 03	3.00	2.68E − 07	ABC-type spermidine/putrescine transport system, permease component II	TSMs; MPs
PA4500	8.02	0	3.11	0	ABC-type dipeptide transport system, periplasmic component	TSMs
PA3190	7.60	2.64E − 04	2.09	0	ABC-type sugar transport system, periplasmic component	TSMs
PA3514	6.95	6.67E − 04	5.08	0	ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component	TSMs
spcS	35.38	0	3.94	0	Specific Pseudomonas chaperone for ExoS, SpcS	SFs; PSEA
pcrV	14.54	0	5.89	0	Type III protein secretion system complex	PSEA
pcrH	7.52	0	4.94	0	Regulatory protein PcrH	SFs; PSEA
popB	11.31	0	4.79	0	Translocator protein PopB	PSEA
popD	9.67	0	3.48	0	Translocator outer membrane protein PopD precursor	PSEA
exsC	10.98	0	4.09	0	ExsC, exoenzyme S synthesis protein C precursor	PSEA
exsE	8.61	2.32E − 06	4.62	0	ExsE	PSEA
exsD	11.895	0	4.572	0	ExsD	PSEA
pscG	7.60	4.15E − 03	2.31	6.10E − 03	Type III export protein PscG	PSEA; CHSPs
exoS	13.43	0	6.71	0	Exoenzyme S	SFs
exoT	9.36	0	4.50	0	Exoenzyme T	SFs
exoY	31.08	0	5.82	0	Adenylate cyclase ExoY	SFs

Group I also contained genes coding for the type III secretion system (T3SS). These genes with upregulated expression include those involved in the secretion and translocation machinery into the host cell plasma (popBD and pcrV); transcription and initiation (exsCED); chaperones that bind secreted proteins to facilitate the secretion process (spcS, pcrH, pscG, and exsC); and effector proteins that are injected into host cells (exoSTY; Table 1).

3.1.2. Group II: Genes with Upregulated Expression at 6 h

Group II is composed of genes with expression levels that increased only at 6 h of exposure to KF (Table 2). The expression of genes involved in the biosynthesis of several amino acids, including histidine (hisC1 and hisE), arginine (argF and argJ), isoleucine (ilvA1), leucine (leuA and leuC), and phenylalanine (pheA), was increased after KF exposure. In addition, we observed the overexpression of genes related to translation class, including genes encoding 30S and 50S ribosomal proteins (the two most upregulated genes, 30S and 50S, are listed in Table 2); aminoacyl-tRNA synthetases associated with tryptophan (trpS), tyrosine (tyrZ), glycine (glyQ), glutamine (glnE), valine (valS), proline (pros), cysteine (cysS), and isoleucine (ileS); translation initiation factor (infC); elongation factor G (fusA2); and peptide chain release factor (prfC) in response to KF treatment.

Table 2

List of the group II genes with upregulated expression at 6 h.

Genes	6 h (fold change)	p value	Description	Functional class
hisC1	4.814	0.013	Histidinol-phosphate aminotransferase	AABM
HisE	3.111	4.06E − 08	Phosphoribosyl-ATP pyrophosphohydrolase	AABM
ArgF	2.723	2.16E − 03	Ornithine carbamoyltransferase, anabolic	AABM
ArgJ	2.601	9.75E − 03	Glutamate N-acetyltransferase	AABM
ilvA1	2.117	0.021	Threonine dehydratase, biosynthetic	AABM
LeuA	5.244	0	2-Isopropylmalate synthase	AABM
LeuC	2.387	7.87E − 12	3-Isopropylmalate dehydratase large subunit	AABM
PheA	2.1	0.018	Chorismate mutase	AABM
RpsL	2.56	0	30S ribosomal protein S12	TPTMD
RplA	3.679	0	50S ribosomal protein L1	TPTMD
TrpS	3.501	1.62E − 05	Tryptophanyl-tRNA synthetase	TPTMD; AABM
TyrZ	3.239	0	Tyrosyl-tRNA synthetase 2	TPTMD; AABM
GlyQ	2.431	0	Glycyl-tRNA synthetase alpha chain	TPTMD; AABM
GlnE	2.912	3.52E − 07	Glutamine synthetase adenylyltransferase	TPTMD
ValS	2.356	3.57E − 10	Valyl-tRNA synthetase	TPTMD; AABM
ProS	2.274	2.36E − 09	Prolyl-tRNA synthetase	TPTMD; AABM
CysS	2.152	2.30E − 05	Cysteinyl-tRNA synthetase	TPTMD; AABM
IleS	2.02	1.72E − 08	Isoleucyl-tRNA synthetase	TPTMD; AABM
InfC	7.182	0	Translation initiation factor IF-3	TPTMD
fusA2	2.313	5.73E − 07	Elongation factor G	TPTMD
PrfC	3.564	0.013	Peptide chain release factor 3	TPTMD
PA5195	3.589	0.028	Probable heat shock protein	CHSPs
HscB	3.187	2.35E − 05	Heat shock protein HscB	CHSPs
AccB	6.303	0	Biotin carboxyl carrier protein (BCCP)	FAPM
AccD	3.579	6.23E − 12	Acetyl-CoA carboxylase beta subunit	FAPM
FabA	2.258	2.67E − 06	Beta-hydroxydecanoyl-ACP dehydrase	FAPM
FabB	2.96	0	Beta-ketoacyl-ACP synthase I	FAPM
NorB	8.614	1.58E − 03	Nitric oxide reductase subunit B	EM
Anr	3.84	0	Transcriptional regulator Anr	EM
NuoB	4.162	0	NADH dehydrogenase I chain B	EM
NuoD	2.982	0	NADH dehydrogenase I chain C,D	EM
NuoF	2.657	5.14E − 09	NADH dehydrogenase I chain F	EM
NuoG	2.761	0	NADH dehydrogenase I chain G	EM
NuoH	3.026	9.62E − 06	NADH dehydrogenase I chain H	EM
NuoI	7.185	3.21E − 14	NADH dehydrogenase I chain I	EM
NuoJ	4.172	3.27E − 03	NADH dehydrogenase I chain J	EM
NuoL	3.459	0	NADH dehydrogenase I chain L	EM
NuoM	2.884	5.40E − 04	NADH dehydrogenase I chain M	EM
NuoN	5.008	2.12E − 07	NADH dehydrogenase I chain N	EM
FlgB	5.197	0	Flagellar basal body rod protein FlgB	CWLC; MA
FlgC	2.907	8.96E − 10	Flagellar basal body rod protein FlgC	CWLC; MA
FlgD	4.125	4.38E − 14	Flagellar basal body rod modification protein FlgD	CWLC; MA
FlgE	4.984	0	Flagellar hook protein FlgE	CWLC; MA
FlgF	4.623	2.03E − 14	Flagellar basal body rod protein FlgF	CWLC; MA
FlgG	3.297	0	Flagellar basal body rod protein FlgG	CWLC; MA
FlgI	2.4	0.01	Flagellar P-ring protein precursor FlgI	CWLC; MA
FlgJ	4.057	3.23E − 13	Flagellar protein FlgJ	CWLC; MA
FlgK	3.85	2.24E − 10	Flagellar hook-associated protein 1 FlgK	CWLC; MA
FliE	4.534	1.18E − 11	Flagellar hook-basal body complex protein FliE	CWLC; MA
FliF	3.433	0	Flagella M-ring outer membrane protein precursor	CWLC; MA
FliG	2.635	6.34E − 10	Flagellar motor switch protein FliG	CWLC; MA

As shown in Table 2, the upregulation of the expression of genes involved in the first step of long-chain fatty acid biosynthesis was also observed. The genes with upregulated expression include those encoding biotin carboxyl carrier protein (accB) and acetyl CoA carboxylase beta subunit (accD). In prokaryotes, this step involves the ATP-dependent carboxylation of acetyl coenzyme A (CoA) to form malonyl CoA by the enzyme acetyl CoA carboxylase. In addition, the expression of fabA and fabB genes, which are involved in the biosynthesis of unsaturated fatty acids (UFAs), was increased in KF samples. Under anaerobic conditions, P. aeruginosa can utilize nitrate, nitrite, or nitrous oxide instead of oxygen as a terminal electron acceptor in the denitrification process. The expression of the nitric oxide reductase gene (norB) required for denitrification was upregulated. Furthermore, the most obvious upregulation of gene expression was found in the oxidative phosphorylation pathway. NADH created by the Krebs cycle can be fed into the oxidative phosphorylation pathway. The expression of NADH dehydrogenase I chain (nuoBDFGHIJLMN) in the oxidative phosphorylation pathway was increased. The anr gene encodes the transcriptional regulator Anr, which is involved in controlling P. aeruginosa gene expression under anaerobic conditions was significantly increased in KF-treated samples, with log2-fold changes of 3.84. Table 2 also shows that the expression of genes related to the flagella assembly pathway (flgBCDEGIJK and fliEFG) was also increased after KF exposure.

3.1.3. Group III: Genes with Downregulated Expression at 6 h

The expression of genes associated with adaptation, protection, and secreted factor functional class was downregulated (Table 3). The genes with downregulated expression include those associated with pyocin S2 (pys2) and pyocin S2 immunity protein (imm2). The expression of cobODUJ genes, which are involved in the aerobic cobalamin biosynthesis process (a cofactor for numerous enzymes mediating methylation, reduction, and intramolecular rearrangements), was reduced.

Table 3

List of the group III genes with downregulated expression at 6 h.

Genes	6 h (fold change)	24 h (fold change)	Description	Functional class
Pys2	−4.084	0	Pyocin S2	AP; SFs
imm2	−2.56	0	Pyocin S2 immunity protein	AP
cobO	−2.684	8.27E − 04	Cob (I) alamin adenosyltransferase	BCPGCs
cobD	−4.229	0.012	Cobalamin biosynthetic protein CobD	BCPGCs
cobU	−4.306	7.36E − 04	Nicotinate-nucleotide-dimethylbenzimidazole phosphoribosyltransferase	BCPGCs
cobJ	−4.9	0	Precorrin-3 methylase CobJ	BCPGCs

3.1.4. Group IV: Genes with Upregulated Expression at 24 h

Exposure to KF increased changes in the expression of genes associated with tripartite ATP-independent periplasmic transporters, including dctP (a C4 dicarboxylate-binding protein) and dctQ and dctM (C4 dicarboxylate transporters) (Table 4). Pseudomonas. aeruginosa preferentially uses C4 dicarboxylates, such as malate, fumarate, and succinate, as carbon and energy sources under anaerobic conditions.

Table 4

List of the group IV genes with upregulated expression at 24 h.

Genes	24 h (fold change)	p value	Description	Functional class
dctP	2.879	0	DctP	MPs; TSMs
dctQ	2.419	1.04E − 06	DctQ	MPs; TSMs
dctM	2.206	4.35E − 05	DctM	MPs; TSMs

3.1.5. Group V: Genes with Downregulated Expression at 24 h

Group V is composed of genes with downregulated expression at 24 h of exposure to KF (Table 5). The expression of the pchR gene, which encodes elements involved in iron Fe3+ acquisition, was reduced. In addition, growth under KF exposure conditions reduced the changes in the expression of genes including members of the extracytoplasmic factor (ECF) subfamily (PA0471-PA0472, PA1300-1301, PA3899-PA3900, PA4895-PA4896, PA0149, PA1912, and PA2896). The expression of the tonB gene (TonB-dependent siderophore receptor) required for chelating Fe3+ was reduced. Furthermore, the expression of genes encoding fumarate hydratase (fumC1), superoxide dismutase (sodM), haemeoxygenase (hemO), and oxidoreductase (PA0853 and PA3768) was downregulated.

Table 5

List of the group V genes with downregulated expression at 24 h.

Genes	24 h (fold change)	p value	Description	Functional class
pchR	−3.116	2.23E − 15	Transcriptional regulator PchR	TRs
PA0471	−2.863	1.61E − 05	Fe2+-dicitrate sensor, membrane component	TCRSs; MPs; TRs
fiuI	−2.171	1.62E − 03	Fe2+-dicitrate sensor, membrane component	TRs
PA1300	−2.201	5.72E − 09	Sigma-70 factor, ECF subfamily	TRs
PA1301	2.386	0.014	Probable transmembrane sensor	MPs; TRs
PA3899	−3.481	0	Probable sigma-70 factor, ECF subfamily	TRs
PA3900	−2.505	0.019	Fe2+-dicitrate sensor, membrane component	MPs; TRs
PA4895	−5.965	1.26E − 09	Fe2+-dicitrate sensor, membrane component	MPs; TRs
PA4896	−3.644	8.33E − 11	Sigma-70 factor, ECF subfamily	TRs
PA0149	−3.859	1.15E − 08	Probable sigma-70 factor, ECF subfamily	TRs
femI	−3.628	0	ECF sigma factor, FemI	TRs
PA2896	−2.495	0	Probable sigma-70 factor, ECF subfamily	TRs
tonB1	−2.067	0	Periplasmic protein TonB, links inner and outer membranes	TSMs
PA4156	−11.36	0	Probable TonB-dependent receptor	TSMs
fumC1	−4.599	0	Fumarate hydratase	EM
sodM	−3.955	0	Superoxide dismutase	AP
hemO	−3.581	0	Heme oxygenase	BCPGCs
PA0853	−3.242	2.66E − 13	Oxidoreductase	PEs
PA3768	−2.622	0	Probable metallo-oxidoreductase	PEs
phzA1	−4.295	1.53E − 07	Probable phenazine biosynthesis protein	SFs
phzB1	−4.708	−4.708	Probable phenazine biosynthesis protein	SFs
phzC1	−2.577	−2.577	Phenazine biosynthesis protein PhzC	SFs
phzA2	−2.625	−2.625	Probable phenazine biosynthesis protein	SFs
phzB2	−3.848	−3.848	Probable phenazine biosynthesis protein	SFs
phzM	−2.125	1.14E − 10	Probable phenazine-specific methyltransferase	PEs
phzS	−2.241	0	Flavin-containing monooxygenase	PEs
secA	−2.166	0	Secretion protein SecA	PSEA
secB	−2.579	0	Secretion protein SecB	PSEA
secD	−3.234	0	Secretion protein SecD	PSEA; MPs
mexG	−2.119	7.29E − 03	Membrane protein	MPs
mexH	−9.088	0	Probable resistance-nodulation-cell division (RND) efflux membrane fusion protein precursor	TSMs
mexI	−5.758	0	Probable resistance-nodulation-cell division (RND) efflux transporter	TSMs; MPs
opmD	−3.241	0	Outer membrane protein precursor	TSMs; MPs
lpxB	−2.148	7.24E − 03	Lipid A-disaccharide synthase	CWLC
lpxA	−2.274	0	UDP-N-acetylglucosamine acyltransferase	CWLC
waaP	−3.174	2.75E − 14	Lipopolysaccharide kinase WaaP	CWLC
waaG	−2.437	0	UDP-glucose:(heptosyl) LPS alpha 1,3-glucosyltransferase WaaG	CWLC
waaF	−2.283	1.48E − 08	Heptosyltransferase II	CWLC
PA4998	−2.482	6.80E − 12	Aminoglycoside 3′-phosphotransferase (APH) and choline kinase family	CWLC
PA5007	−3.124	4.80E − 08	Mn2+−dependent serine/threonine protein kinase	PEs
PA5008	−3.187	7.22E − 15	RIO-like serine/threonine protein kinase fused to N-terminal HTH domain	PEs
rmlA	−2.554	0	Glucose-1-phosphate thymidylyltransferase	CWLC
pilD	−2.377	0	Type 4 prepilin peptidase PilD	SFs; PSEA; MA
pilF	−2.053	0	Type 4 fimbrial biogenesis protein PilF	PSEA; MA
pilM	−3.074	0	Type 4 fimbrial biogenesis protein PilM	MA
pilN	−3.871	0	Type 4 fimbrial biogenesis protein PilN	MA
pilO	−4.476	0	Type 4 fimbrial biogenesis protein PilO	MA
pilP	−3.956	0	Type 4 fimbrial biogenesis protein PilP	MA
pilQ	−3.219	0	Type 4 fimbrial biogenesis outer membrane protein PilQ precursor	MA
pilU	−2.226	0	Twitching motility protein PilU	MA
pilV	−2.382	0	Type 4 fimbrial biogenesis protein PilV	MA
pilW	−2.516	0	Type 4 fimbrial biogenesis protein PilW	MA
pilX	−2.366	0	Type 4 fimbrial biogenesis protein PilX	MA
pilY1	−2.025	0	Type 4 fimbrial biogenesis protein PilY1	MA
pilG	−2.713	0	Twitching motility protein PilG	TCRSs; MA; CT
pilH	−3.112	0	Twitching motility protein PilH	TCRSs; MA; CT
pilI	−2.731	2.20E − 09	Twitching motility protein PilI	MA; CT
pilJ	−5.282	0	Twitching motility protein PilJ	MA; CT
Vfr	−2.047	0	Transcriptional regulator vfr	TRs
chpA	−2.124	0	Component of chemotactic signal transduction system	TCRSs; MA; CT
chpB	−2.315	1.15E − 05	Probable methylesterase	CT
fliC	−2.145	0	Flagellin type B	MA
rpsK	−2.592	0	30S ribosomal protein S11	TPTMD
rplA	−2.375	0	50S ribosomal protein L1	TPTMD
glnS	−2.102	0	Glutaminyl-tRNA synthetase	TPTMD; AABM
glyS	−2.162	2.11E − 13	Glycyl-tRNA synthetase beta chain	TPTMD; AABM
leuS	−2.131	0	Leucyl-tRNA synthetase	TPTMD; AABM
lysS	−2.38	0	Lysyl-tRNA synthetase	TPTMD; AABM
proS	−2.764	0	Prolyl-tRNA synthetase	TPTMD; AABM
valS	−2.13	0	Valyl-tRNA synthetase	TPTMD; AABM
aspS	−2.129	0	Aspartyl-tRNA synthetase	T-RNA-PD; TPTMD
hisF1	−3.599	1.02E − 11	Imidazole glycerol-phosphate synthase, cyclase subunit	AABM
hisG	−2.863	2.04E − 10	ATP-phosphoribosyltransferase	AABM
argB	−2.436	0	Acetylglutamate kinase	AABM
argG	−2.428	0	Argininosuccinate synthase	AABM
argH	−2.127	0	Argininosuccinate lyase	AABM
cysM	−3.436	0	Cysteine synthase B	AABM
trpA	−4.405	0	Tryptophan synthase alpha chain	AABM
trpB	−6.527	0	Tryptophan synthase beta chain	AABM
hslU	−4.255	0	Heat shock protein HslU	CHSPs
hslV	−3.742	0	Heat shock protein HslV	CHSPs
htpG	−2.835	0	Heat shock protein HtpG	CHSPs
htpX	−2.557	0	Heat shock protein HtpX	AP
dnaA	−2.631	0	Chromosomal replication initiation protein	DNA-RRMR
dnaJ	−2.528	0	DnaJ protein	DNA-RRMR; CHSPs; AP
dnaK	−3.087	0	DnaK protein	DNA-RRMR; CHSPs; AP
holC	−2.701	5.25E − 09	DNA polymerase III, chi subunit	DNA-RRMR
mutL	−2.563	0	DNA mismatch repair protein MutL	DNA-RRMR
Phr	−3.012	2.14E − 12	Deoxyribodipyrimidine photolyase	DNA-RRMR
sbcD	−2.056	2.40E − 13	Exonuclease SbcD	DNA-RRMR
recG	−2.105	7.52E − 16	ATP-dependent DNA helicase RecG	DNA-RRMR; TRs
uvrC	−2.622	0	Excinuclease ABC subunit C	DNA-RRMR
uvrD	−3.412	0	DNA helicase II	DNA-RRMR
ccmE	−2.297	7.41E − 10	Cytochrome C-type biogenesis protein CcmE	EM
ccmG	−2.001	3.24E − 06	Cytochrome C biogenesis protein CcmG	TPTMD; CHSPs; EM
PA1600	−2.819	2.31E − 06	Probable cytochrome c	EM
PA4571	−2.708	0	Probable cytochrome c	EM
PA4133	−5.344	0	Cytochrome c oxidase subunit (cbb3-type)	EM
ccoO1	−2.475	0	Cytochrome c oxidase, cbb3-type, CcoO subunit	EM
ccoQ1	−2.235	1.16E − 04	Cytochrome c oxidase, cbb3-type, CcoQ subunit	EM
nuoD	−2.216	0	NADH dehydrogenase I chain C,D	EM
nuoE	−2.162	9.15E − 13	NADH dehydrogenase I chain E	EM
narK1	−2.541	2.23E − 15	Nitrite extrusion protein 1	MPs; TSMs
narK2	−5.637	0	Nitrite extrusion protein 2	MPs; TSMs
narG	−4.157	0	Respiratory nitrate reductase alpha chain	EM
narJ	−2.386	0.014	Respiratory nitrate reductase delta chain	EM
narL	−2.09	0	Two-component response regulator NarL	EM; TCRSs
Dnr	−2.065	8.03E − 14	Transcriptional regulator Dnr	TRs

Table 5 also shows that the expression of virulence-associated genes that are involved in phenazine-1-carboxylic acid (PCA) biosynthesis (phzA1B1C1A2B2) and the conversion of PCA to pyocyanin (phzMS) were decreased. The expression of several genes associated with Sec system proteins was significantly altered. Exposure to KF reduced the changes in the expression of genes such as the inner membrane translocase subunit proteins (secD), a cytoplasmic membrane-associated ATPase (secA), and a chaperone (secB) that binds to presecretory target proteins. The results also showed a downregulation of the expression of the mexGHI-opmD efflux pump system in the KF-treated samples (Table 5). In addition, the expression of several genes involved in the LPS biosynthesis process, including lpxA, lpxB, waaF, waaG, waaP, PA4998, PA5007, PA5008, and rmlA, was decreased. Transcription data of P. aeruginosa showed a downregulation in the expression of type VI pili composed of pilDFMNOPQUVWXY1. The expression levels of vfr (virulence factor regulator) and pilGHIJ-chpAB (Chp chemosensory system) genes were significantly decreased according to the Log2-fold changes. The virulence-associated fliC gene, which encodes flagellin type B, was downregulated under KF exposure conditions.

Growth under KF conditions reduced the expression of genes associated with translation class, including genes encoding the 30S and 50S ribosomal proteins (the two most downregulated 30S and 50S genes are listed in Table 5) and aminoacyl-tRNA synthetase associated with glutamine (glnS), glycine (glyS), leucine (leuS), lysine (lysS), proline (proS), valine (valS), and aspartate (aspS). In addition, the expression of genes involved in the biosynthesis of several amino acids, including histidine (hisF1 and hisG), arginine (argB, argG, and argH), cysteine (cysM), and tryptophan (trpA and trpB), was also decreased after exposure to KF.

RNA-seq data showed a downregulation in the expression of genes associated with DNA replication (dnaJ, dnaK, dnaA, and holC) and repair mechanism (mutL, phr, sbcD, uvrC, uvrD, and recG) (Table 5).

This group also contained several genes related to cytochrome c, which is highly expressed under microaerobic conditions. These genes with downregulated expression include those encoding elements in cytochrome c (ccmEG, PA1600, and PA4571) and cbb3-1 cytochrome c terminal oxidases (ccoO1Q1 and PA4133).

The expression of NADH dehydrogenase I chain subunits (nuoD and nuoE) in the oxidative phosphorylation pathway was significantly decreased in KF-treated samples, with log2-fold changes of −2.216 and −2.162, respectively. Table 5 also shows that the expression of genes involved in energy production in the absence of oxygen through denitrification was decreased after KF treatment. These genes with downregulated expression include those encoding nitrate/nitrite transporters (narK1 and narK2), the dissimilatory nitrate reductase (narG and narJ), the two-component regulator NarL, and the transcriptional regulator Dnr.

3.1.6. Group VI: Genes with Downregulated Expression at 6 h and 24 h

This group consisted of genes with downregulated expression at both 6 h and 24 h (Table 6). Growth under KF exposure conditions induced the downregulation of the expression of genes encoding heat shock proteins (hslVU, htpG, and grpE). The expression of the clpB gene, which encodes the ATP-binding subunit protease, was also downregulated under KF exposure conditions.

Table 6

List of the group VI genes with downregulated expression at 6 h and 24 h.

Genes	6 h (fold change)	p value	24 h (fold change)	p value	Description	Functional class
htpG	−  4.483	0	− 2.835	0	Heat shock protein HtpG	CHSPs
HslV	− 5.567	0	− 3.742	0	Heat shock protein HslV	CHSPs
HslU	− 3.379	0	− 4.255	0	Heat shock protein HslU	CHSPs
grpE	− 2.265	0	− 3.718	0	Heat shock protein GrpE	DNA-RRMR; CHSPs
ClpB	− 5.018	0	− 2.312	0	ATP-binding subunits of clp protease and DnaK/DnaJ chaperones	TPTMD
BfiR	− 2.707	0.033	− 2.584	0	Response regulator	TRs; TCRSs
BfiS	− 4.934	6.31E −  15	− 2.714	0	Signal transduction histidine kinase regulating C4-dicarboxylate transport system	TCRSs

In this group, we observed the downregulation of the expression of genes involved in the initiation stage of biofilm formation (bfiR and bfiS) in KF-treated P. aeruginosa samples. Biofilm formation in P. aeruginosa is regulated by three novel two-component regulatory systems that are involved in (i) the initiation of biofilm formation (BfiRS), (ii) biofilm maturation (BfmRS), and (iii) microcolony formation (MifRS).

3.2. Validation of NGS Results Using Quantitative Real-Time PCR (qRT-PCR)

Four genes identified from RNA-seq data (uvrD, sodM, fumC1, and rpsL) were selected for qRT-PCR analysis. nadB (PA0761) was chosen as the reference control gene that exhibited no change in our transcriptomic data at two treatment times. qRT-PCR data showed the same trend of either upregulation or downregulation of the genes as that in NGS, thereby validating our NGS results (Table 7). The variations were due to the difference in the sensitivity of the two assays.

Table 7

Transcript level comparison of P. aeruginosa genes between qRT-PCR and NGS. qRT-PCR is the mean of two biological replicates with three technical replicates for each gene. Reference gene (nadB): L-aspartate oxidase, uvrD, and sodM were downregulated at 24 h with no change at 6 h; fumC1 was upregulated at 6 h and downregulated at 24 h; rpsL was upregulated at 6 h with NC at 24 h exposure.

Genes ID	Gene symbol	NGS		qRT-PCR		Primers	Length (bp)	Description
		Fold change		Fold change
		6 h	24 h	6 h	24 h	5′-sequence-3′
PA5443	uvrD	NC	−3.412 ± 0	NC	−2.54 ± 0.01	GTGCGCCTGTCCAATAC	17	DNA helicase II
						GCCTTCGAAGTTGAGGATAG	20
PA4468	sodM	NC	−3.955 ± 0	NC	−2.44 ± 0.01	GAGCAGCCGGTGGAAAGTCT	20	Superoxide dismutase
						GCGACATCACGGTCCAGAAC	20
PA4470	fumC1	3.618 ± 0	−4.599 ± 0	3.48 ± 0.69	−5.39 ± 0	TCGGGCAACTTCGAACTGAA	20	Fumarate hydratase
						GAGCTTGCCCTGGTTGACCT	20
PA4268	rpsL	2.56 ± 0	NC	3.53 ± 0.53	NC	CGGCACTGCGTAAGGTATGC	20	30S ribosomal protein S12
						CCCGGAAGGTCCTTTACACG	20
PA0761∗	nadB		Reference gene			CTACCTTTATACCAGCAATCCC	22	L-aspartate oxidase
						CGGTGATGAGGAAACTCTTG	20

4. Discussion

Previous studies have elucidated that KF can inhibit P. aeruginosa growth [6, 7]. In regard to this inhibitory effect, the approach of transcriptomic analysis is useful to identify the differentially expressed genes in this bacterium. The transcriptome profiles of P. aeruginosa treated with KF were examined to demonstrate the changes in gene expression at two time points (6 h and 24 h incubation). Functional analyses were performed to clarify the possible mechanisms underlying the changes in gene expression from a global perspective. In addition, qRT-PCR was used to confirm the RNA-seq results of select genes.

The type III secretion system (T3SS) regulates the virulence of many pathogenic bacteria [10]. The T3SS system is essential for the export of effector proteins through a needle-like structure directly inside target host cells [10]. Transcriptome data showed the continuous upregulation of all T3SS apparatus, regulators, and effector proteins in P. aeruginosa at 6 h and 24 h of KF treatment (Table 1). Interestingly, the expression of P. aeruginosa genes involved in the flagella assembly pathway, which mediates swimming motility and functions in biofilm development, was increased [11]. These findings indicate that the T3SS system and flagella assembly pathway are tuned by different environmental stresses, which might be an essential survival strategy for this bacterium [12].

As shown in Table 2, gene expression analysis of P. aeruginosa grown in KF for 6 h displayed an upregulation of the operon fabAB (Table 2), which is involved in the biosynthesis of unsaturated fatty acids (UFAs). UFAs are required to maintain the fluidity of bacterial membranes [13]. Thus, we assume that the membrane lipid composition might be altered to allow growth under KF exposure conditions.

Pseudomonas aeruginosa has a highly complex respiratory chain with multiple terminal oxidases and can respire both oxygen and nitrogen oxides [14, 15]. Under anaerobic conditions, P. aeruginosa can respire through denitrification [16]. In this process, four reductases (nitrate-, nitrite-, NO-, and nitrous oxide reductases) allow bacterial growth [17]. Thus, during this process, molecular oxygen is replaced by nitrate as the terminal electron acceptor [18]. The P. aeruginosa genome encodes three NADH dehydrogenase chains (NADH-I, NADH-II, and Nqr). When oxygen is not available, the NADH-I chain encoded by the nuoA-N operon is required to translocate protons and oxidize NADH to NAD+ [19, 20]. Chain I links the NADH ubiquinone electron transfer to the transmembrane transport of protons, leading to the production of a proton motive force that is fundamental for ATP synthesis [21]. In prokaryotic microorganisms, ATP synthesis generally occurs by glycolysis using substrate-level phosphorylation and by the oxidative phosphorylation pathway [11]. In the present study, genes associated with the NADH dehydrogenase I chain, which is involved in the oxidative phosphorylation pathway, displayed a very strong induction at 6 h (Table 2), followed by a reduction at 24 h (Table 5). The expression of chain I subunits (nuo-operon) in the oxidative phosphorylation pathway was increased in KF-treated samples at 6 h. The NADH-I chain is coupled to the denitrification pathway [22, 23]. The upregulation of genes encoding NADH-I chain was paralleled by the increased expression of anr gene involved in controlling P. aeruginosa gene expression under anaerobic conditions, suggesting that KF-treated cells underwent a switch to anaerobic respiration in response to oxidative stress. Zimmermann et al. [24] noted that the anr deletion mutant of P. aeruginosa does not grow anaerobically. In addition, the expression of genes encoding several elements of the ATP-binding cassette transporters (ABCs), which exist in all bacterial species and provide a pathway for substrates to cross the cell membrane [25], was upregulated (Table 1). Interestingly, the growth of P. aeruginosa under KF exposure conditions at two time points led to the increased expression of genes encoding ABC transporters of amino acids, carbohydrates, and inorganic ions (Table 1). As amino acids are key intermediates in bacterial metabolism, the increase in the ABC transporter proteins led to increased amino acid or peptide uptake. In conclusion, to maintain energy consumption, the cell increases the oxidative phosphorylation pathway and the expression of ATP synthase to produce ATP.

During host infection, P. aeruginosa utilizes several systems to acquire iron from the surrounding environment [26]. The iron acquisition mechanisms include the production of siderophores (pyoverdine and pyochelin) and heme uptake [27]. Transcriptomic analysis showed a downregulation of the expression of genes involved in iron acquisition in KF-treated samples at 24 h of P. aeruginosa growth. As shown in Table 5, TonB-dependent siderophore receptor (tonB) and haemeoxygenase (hemO) showed a reduction in the expression level at 24 h. The downregulation of the expression of pchR-encoding elements involved in iron Fe3+ acquisition was also observed. In addition, the expression of genes highly regulated by iron starvation was repressed by KF treatment. These genes encode members of the ECF subfamily, which is mainly associated with extracellular functions that include the regulation of periplasmic stress, iron transport, metal ion efflux systems, alginate secretion, and synthesis of membrane-localized carotenoids [28]. Consequently, the results suggested that KF-treated cells underwent conditions of excess intracellular iron, which led to the downregulation of the expression of genes regulated by the ferric uptake regulator (Fur) required for iron acquisition. Ochsner et al. [29] reported that the Fur protein uses Fe2+ as a cofactor and binds to Fur-Fe2+, resulting in the repression of the genes encoding pyochelin and pyoverdin proteins in iron-replete environments. Furthermore, transcriptomic analysis also showed the downregulation of the expression of genes coding for the components of the DNA replication and repair machinery in P. aeruginosa at 24 h of KF treatment. A superoxide (O2−) byproduct is formed by the autoxidation of a variety of reduced electron carriers and redox enzymes [30]. O2− is implicated in the production of oxidative DNA damage by the steady release of iron from storage proteins into the cytosol, and thus, the free iron binds DNA and catalyses electron transfer from the reductant to H2O2 [31, 32]. The resultant ferryl or hydroxyl radical attacks the adjacent DNA [33]. The repression of genes encoding DNA repair proteins was coupled with the repression of genes involved in iron regulation at 24 h, suggesting that KF-treated cells were exposed to an excess concentration of intracellular free iron, leading to either hydroxyl or ferryl radical production, which promotes oxidative DNA damage by increasing the amount of DNA-bound iron. Oxidative DNA damage was also evident by the downregulation of the expression of genes involved in defence (sodM) against reactive oxygen species.

P. aeruginosa pathogenicity depends on the production and secretion of a large variety of virulence factors, including pyocin S2, in response to host environments. pyocin S2 is a protease-sensitive bacteriocin produced by P. aeruginosa that kills sensitive cells by damaging chromosomal DNA through its DNase activity and the inhibition of lipid synthesis [34]. RNA-seq analysis showed reduced expression levels of pyocin S2 protease at 6 h of exposure to KF (Table 3). As shown in Table 5, the growth of P. aeruginosa under K treatment conditions at 24 h led to the decreased expression of genes involved in the LPS biosynthesis process (lpxA, lpxB, waaF, waaG, waaP, PA4998, PA5007, PA5008, and rmlA). LPS is the major component defining the outer membrane of Gram-negative bacteria. The outer membrane is essential for viability and mediates virulence and resistance to toxic and antibacterial agents [35]. Interestingly, a previous study revealed that the waaP gene in P. aeruginosa is required to produce full-length LPS, which is recognized by the outer membrane transport assembly machinery in this bacterium [36]. Therefore, waaP may constitute a good target for the development of novel antipseudomonal agents. Our previous observation is consistent with this finding. Transmission electron microscopy studies have revealed that cells treated with KF exhibit severe membrane damage concurrent with the disruption of membrane integrity, leading to the loss of intracellular material at 24 h of incubation [7]. These results suggest that LPS biosynthesis may be inhibited at 24 h KF exposure. In addition, the MexGHI-OpmD efflux pump system has been implicated in the efflux of xenobiotics, including the antibiotic norfloxacin and the heterocyclic dye acriflavine [37], and the transport of phenazine molecules [38]. Interestingly, the downregulation of the MexGHI-OpmD system observed in the RNA-seq data was coupled with a reduction in the phenazine biosynthesis process KF at 24 h of P. aeruginosa treated with KF (Table 5). The opportunistic pathogen P. aeruginosa is well known for its production of bright blue phenazine pyocyanin, which contributes to the colouration of sputum and pus associated with infections and interferes with multiple host cellular functions [39]. In response to KF treatment, P. aeruginosa repressed the expression of the secretory machinery (Sec system), responsible for the secretion of virulence factors, extracellular degradative enzymes, and other toxins, enabling adaptation to a wide range of ecological niches [40]. Therefore, taken together, these data reveal the marked remodelling of gene transcription characterized by an early and late reduction in the expression of several genes associated with virulence factors of P. aeruginosa in response to KF treatment.

Bacteria can form biofilms on living or nonliving surfaces and can be prevalent in natural, industrial, and hospital settings. Bacterial motility and adhesion are critical for biofilm development [41]. The type IV pili in P. aeruginosa play an important role in the adherence to epithelial cells and microbial intra and interspecies competition, while flagella filament-mediated motility enables bacteria to reach a surface and then divide and spread along the surface [42]. In response to KF treatment at 24 h, the downregulation of type IV and flagellin type B (fliC) genes observed in RNA-seq (Table 5) was paralleled by the decreased expression of genes involved in biofilm formation in P. aeruginosa (Table 6). These findings may indicate that KF treatment affects genes involved in biofilm formation and motility. As a consequence of these combined factors, we thus hypothesise that the swimming and biofilm formation ability of P. aeruginosa would be inhibited under KF treatment conditions.

The treatment of P. aeruginosa with KF for 24 h led to the decreased expression of genes encoding the aminoacyl-tRNA synthetases glutamine, glycine, leucine, lysine, proline, valine, and aspartate. Furthermore, genes associated with the biosynthesis of several amino acids, including histidine, arginine, cysteine, and tryptophan, were also expressed at reduced levels in KF-treated samples at 24 h (Table 5). RNA-seq data showed that the downregulation of the expression of genes hslVU, htpG, and grpE involved in the degradation of unfolded or misfolded proteins that accumulate in the periplasm [43], following heat shock or other stress conditions was coupled with the decreased expression of the clpB gene encoding an ATP-dependent protease, which functions as part of the chaperone network essential for the recovery of stress-induced protein aggregates [44] (Table 6). The altered expression of these genes at two KF exposure time points may be indicative of their essential function in cellular responses to environmental stress. As a consequence of these combined factors, we thus assume that protein synthesis in P. aeruginosa might be affected by KF treatment.

5. Conclusion

The crisis of the antibiotic resistance demands to be met with concerted efforts across many disciplines and areas of expertise. Natural products are mainstays of drugs and still play an essential role in providing chemical diversity, despite a reduced interest shown by pharmaceutical companies. Herein, we could prove efficacy of KF against one of the most notorious pathogen P. aeruginosa. The KF compound is more likely to have multitargets inside the test P. aeruginosa. To the best of our knowledge, the current study is the first report describing the antibacterial effect of KF on P. aeruginosa at the gene expression level through transcriptomic analysis, revealing the regulation of various genes involved in cellular processes that lead to the destabilization of this bacterium. The transcriptomic analysis showed that KF increases the expression of genes involved in the electron transport chain (NADH-I), resulting in the induction of ATP synthesis. KF also increased the expression of genes associated with ATP-binding cassette transporters, flagella, type III secretion system proteins, and DNA replication and repair, which may further affect nutrient uptake, motility, and growth. The major mechanisms through which KF seems to exert its antibacterial effect on P. aeruginosa are by the repression of a broad range of virulence factors associated with LPS biosynthesis, iron homeostasis, cytotoxic pigment pyocyanin production, and motility and adhesion that are representative of an acute P. aeruginosa infection profile. Taken together, the present study is a good demonstration of the therapeutic usefulness of the natural product from plant in validating the traditional medicine, i.e., M. malabathricum, very common in Malaysia. Specifically, attenuations of bacterial virulence factors are likely to be effective solutions in this therapeutic area. Although the current study offers a possible regulatory network of P. aeruginosa induced by KF treatment, further studies will focus on the protein level expression of the target genes. In general, this study has generated scientific evidence that natural product research is perfectly positioned to address and solve the present bacterial resistance crisis and the closely linked antibiotic discovery gap.