Literature DB >> 32049261

Prevalence of dengue, Zika and chikungunya viruses in Aedes (Stegomyia) aegypti (Diptera: Culicidae) in a medium-sized city, Amazon, Brazil.

Fred Júlio Costa Monteiro1, Fábio Rodrigo Paixão Mourão1, Edicelha Soares D'Athaide Ribeiro2, Marlisson Octávio da Silva Rêgo2, Pablo Abdon da Costa Frances3, Raimundo Nonato Picanço Souto4, Marlucia Dos Santos Façanha1, Roozbeh Tahmasebi5, Antônio Charlys da Costa6.   

Abstract

Aedes aegypti is associated with epidemic diseases in Brazil, such as urban yellow fever, dengue, and more recently, chikungunya and Zika viruses infections. More information about Ae. aegypti infestation is fundamental to virological surveillance in order to ensure the effectiveness of control measures in use. Thus, the present study aims to identify and compare infestation and infectivity of Ae. aegypti females in Macapa city, Amapa State (Amazon region), Brazil, between the epidemiological weeks 2017/02 and 2018/20. A total number of 303 Ae. aegypti females were collected at 21 fixed collection points, 171 at the 10 collection points in the Marabaixo neighborhood and 132 at the 11 collection points in the Central neighborhood. Among the collected samples, only two were positive for dengue virus, with a 2.08% (2/96 pools) infectivity rate for Marabaixo. The difference between the medians of Ae. aegypti females captured in Central and Marabaixo sites was not statistically significant. The findings indicate similar mosquito infestation levels between the neighborhoods, and a low-level of mosquito infectivity, although dengue virus was found only in Marabaixo. Virological surveillance of Ae. aegypti was important to identify sites of infection and determine possible routes of transmission to enable health surveillance teams to adopt preventive strategies where infected mosquitoes are present and act faster.

Entities:  

Mesh:

Year:  2020        PMID: 32049261      PMCID: PMC7014551          DOI: 10.1590/S1678-9946202062010

Source DB:  PubMed          Journal:  Rev Inst Med Trop Sao Paulo        ISSN: 0036-4665            Impact factor:   1.846


INTRODUCTION

Introduction of exotic vectors into new areas are associated with human epidemics throughout history[1] . In Brazil, Aedes (Stegomyia) aegypti (Diptera: Culicidae), a vector from Africa[2] , is a known transmitter of the viruses responsible for urban yellow fever, dengue and more recently chikungunya and Zika epidemics[3] . The prevention and control of these arboviral diseases can be performed through immunobiologicals (vaccines against yellow fever[4] and dengue[5] ), by disruption of host-vector contact or vector control actions. Dengue, chikungunya and Zika prevention depends mainly on effective vector control measures, unlike yellow fever, for which vaccination is the most effective method[6] . The main vector control action is to adopt measures to eliminate Ae. aegypti breeding sites. In addition, in places where probable cases of dengue, chikungunya and/or Zika infections are reported, measures to break the chain of transmission in the surrounding area with insecticide application must be considered (Ultra Low Volume)[7] . Surveillance of diseases transmitted by Ae. aegypti is based on entomological indices and mandatory reporting of suspected/confirmed cases, which is often late[8] . Macapa, the State capital of Amapa, has high infestation rates for Ae. aegypti in all the urban areas of the municipality. Summer monsoon brings rain from December to May, with the latter being the rainiest month with the highest recorded density of mosquitoes[9] . The city is 14 meters above sea level and has a humid tropical climate, with small temperature variations (average of 27º C), an average annual relative humidity of 81% and an average rainfall of around 2,600 mm. The driest period is from September to November (quarterly rainfall below 200 mm) and the wettest period from March to May (quarterly rainfall higher than 1,000 mm)[10] . In places where there is a high infestation of Ae. aegypti , it is essential to establish a virological surveillance to determine more effective control measures. Thus, the present study aims to identify and compare the infestation and infectivity of Ae. aegypti females in two neighborhoods in the city of Macapa, between the epidemiological weeks 2017/02 and 2018/20.

MATERIALS AND METHODS

Study area

The research was conducted in the urban zone of the municipality of Macapa, the State capital of Amapa, located in the Brazilian Amazon, with an estimated population of 474,706 inhabitants in 2017[11] . For this research, two neighborhoods were chosen: Central and Marabaixo, located in Central and Western Macapa, respectively ( Figure 1 ). The former is the most urbanized neighborhood in the city, where the commercial and administrative areas are concentrated, and the largest coverage of water supply and sewage occurs. Houses are mostly built with both brick and stone masonry. Marabaixo is an unofficial neighborhood with deficient basic urban infrastructure, lacking coverage of water and sewage networks. The majority of the houses are made of brick and cement plaster, and there are also numerous wooden houses.
Figure 1

A) Map of Brazil, highlighting the Amapa State in gray; B) Map of the Amapa State, showing the Macapa city in gray; C) Marabaixo and Central neighborhoods are highlighted in gray and the sites of collections are black dotted.

Sample collection

Permanent collection points were established randomly, at approximately 400 m from each other, and they were georeferenced using the Universal Transverse Mercator (UTM), by means of the Garmin Oregon 550 GPS (Garmin International, Inc., Olathe, Kansas, USA). Between the epidemiological weeks 2017/02 and 2018/20, at each sampling point, mosquitoes were captured biweekly in peridomiciliary and intradomiciliary environments through electric aspirators[12] , Castro aspirators[13] and insect collection nets. Immediately afterwards, the captured insects were transported to the Vector Laboratory of the Epidemiological Surveillance Department of Amapa. Using the key of Consoli and Oliveira[14] , Ae. aegypti females were identified and classified as either non-blood fed females (without evidence of hematophagia) and blood fed females (females with blood in the abdomen). Following this classification, pools of up to five mosquitoes per tube, per epidemiological week, were prepared for each collection point. During the study, Ae. aegypti males and other trapped species of mosquitoes were discarded.

Sample preparation and Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) assay

Initially, wings and legs were removed and discarded from collected mosquitoes. Samples were placed in 2.0 mL microcentrifuge tubes, then, they were stored at –70 °C until analysis. The pools were macerated in 1 mL phosphate saline (PBS), pH 7.4, through the Retsch Model MM400 Vibratory Mill (Retsch-Allee, Haan, Germany). Then, the samples were centrifuged for 10 min at 16,128 x g. For nucleic acids extraction, approximately 300 µL of the supernatant were pipetted and filtered (0.22 µm) using the PureLinkTM RNA/DNA Mini Kit (Invitrogen, Carlsbad, CA, USA) to obtain 50 μL of purified nucleic acids, as recommended by the manufacturer. Finally, the samples were aliquoted into qRT-PCR Fast plates along with the oligonucleotide sequences for dengue (DENV1, DENV2, DENV3 and DENV4), chikungunya and Zika viruses ( Table 1 ), together with positive and negative controls for further interpretation of the results, as recommended by the manufacturer[15 - 17] .
Table 1

Oligonucleotide sequences used for the detection of dengue, chikungunya and Zika viruses.

Virus5’-3’ SequenceReference
DEN-1 ForwardCAAAAGGAAGTCGTGCAATAJonhson et al .15
DEN-1 ReverseCTGAGTGAATTCTCTCTACTGAACC 
DEN-1 ProbeCATGTGGTTGGGAGCACGC 
DEN-2 ForwardCAGGTTATGGCACTGTCACGAT 
DEN-2 ReverseCCATCTGCAGCAACACCATCTC 
DEN-2 ProbeCTCTCCGAGAACAGGCCTCGACTTCAA 
DEN-3 ForwardGGACTGGACACACGCACTCA 
DEN-3 ReverseCATGTCTCTACCTTCTCGACTTGTCT 
DEN-3 ProbeACCTGGATGTCGGCTGAAGGAGCTTG 
DEN-4 ForwardTTGTCCTAATGATGCTGGTCG 
DEN-4 ReverseTCCACCTGAGACTCCTTCCA 
DEN-4 ProbeTTCCTACTCCTACGCATCGCATTCCG 

Chikungunya - ForwardCATCTGCACYCAAGTGTACCAMichlmayr et al .16
Chikungunya - ReverseGCGCATTTTGCCTTCGTAATG 
Chikungunya - ProbeGCGGTGTACACTGCCTGTGACYGC 

Zika - ForwardCAGCTGGCATCATGAAGAAYCWaggoner et al .17
Zika - ReverseCACCTGTCCCATCTTTTTCTCC 
Zika - ProbeCYGTTGTGGATGGAATAGTGG 

Statistical analysis

For statistical analysis the software BioeEstat version 5.3 (Mamiraua Institute, Manaus, Brazil)[18] was used. The weeks during which collection in either site was not possible were discarded for statistical analysis. Data were tested for Liliefors normality, which proved to be significant, and for this reason nonparametric tests were used. Then, to compare the total of females captured between the studied neighborhoods, the Mann-Whitney test was used. To verify the difference between non-blood fed females and blood fed females in each neighborhood, the same statistical method was applied. The results were considered significant when p≤0.05 .

RESULTS

A total of 303 Ae. aegypti females were collected, of which 132 were from the Central neighborhood (97 non-blood fed females and 35 blood fed females) and 171 from the Marabaixo neighborhood (107 non-blood fed females and 64 blood fed females), resulting in 175 pools, of which 79 were from the Central neighborhood (53 of non-blood fed females and 26 of blood fed females) and 96 from the Marabaixo neighborhood (61 of non-blood fed females and 35 of blood fed females) ( Table 2 ).
Table 2

Number of Ae. aegypti females collected in the survey and the mosquito pools by neighborhood.

Mosquito collection sitesNBFBFTotalNBF PoolEF PoolTotal Pool
Central9735132532679
Marabaixo10764171613596

Total2049930310461175

NBF= Ae. aegypti non-blood fed; BF= Ae. aegypti blood fed

NBF= Ae. aegypti non-blood fed; BF= Ae. aegypti blood fed There was no statistically significant difference between the medians of the total Ae. aegypti females captured in the Central (3) and the Marabaixo (3) neighborhoods (Mann-Whitney Test U = 353.5; Z (U) 0.1903; p = 0.8491). In the Central neighborhood, there was a higher frequency of non-blood fed females (73.48%) than blood fed females (26.52%), with a statistically significant difference between the median number of non-blood fed females (2) and blood fed females (1) (Mann-Whitney U = 243; Z (U) 2.1019; p = 0.0356). In the Marabaixo neighborhood, 62.57% of the captured females were non-blood fed, while 37.43% were blood fed ones, but the difference between the medians of non-blood fed (1) and blood fed (0) females was not statistically significant (Mann-Whitney U test = 305.5 Z (U) 1.0207; p = 0.3074). Regarding the infectivity, the presence of dengue virus was only detected in two samples, both from the Marabaixo neighborhood, with a total infectivity of 2.08% (2/96), one from non-blood fed females (1/61 – DEN-1) and one from blood fed females (1/35 – DEN-4). For Zika and chikungunya viruses, no virus was detected in any sample. According to the Epidemiological Surveillance Department of Amapa, during the research in Central neighborhood, 14 cases of dengue, five of chikungunya and none of Zika virus were confirmed. In Marabaixo neighborhood, 17 cases of dengue, three of chikungunya and one of Zika virus were confirmed.

DISCUSSION

The presence of vectors, the existence of cases of dengue, chikungunya and Zika viruses, and the population susceptibility are conditions that favor the occurrence of epidemics. Ae. aegypti has a high predilection for human blood[19] . Thus, the high number of fed mosquitoes in both neighborhoods showed that vector control measurements have not prevented the host-vector contact. The detection of a non-blood fed female pool highlights the possibility of dengue virus transmission, as the virus can be present in the insect salivary gland and can be transmitted during the blood meal. However, the presence of dengue virus in blood fed female does not distinguish whether the detected virus was present in the blood from the meal or from the mosquito salivary gland. When virological surveillance in Ae. aegypti is performed close to the occurrence of confirmed cases of arboviruses, the percentage of positive females is higher, as demonstrated by Perez-Perez et al. [8] who found in Medelín, Colombia, 35.42% of dengue virus infected female pools. Pérez-Castro et al. [20] reported an infectivity of 62% of Ae. aegypti females in places where there were cases of dengue within 200 m of the collection point and 30 days before the collection date. In addition, in Aracaju city, the State capital of Sergipe, in Northeast Brazil, Costa-Silva et al .[21] found 10% (1/10 pools) of Ae. aegypti infected by chikungunya virus. In contrast, in Rio de Janeiro city, in Southeast Brazil, Ferreira-de-Brito et al .[22] detected a low natural infectivity in Ae. aegypti with Zika virus of 1.15% (3/198 pools). The infectivity rates are lower when virological surveillance is independent from the reporting of positive cases, as is the case in the present study. This is corroborated by Baak-Baak et al .[23] , who found 1.2% (2/166) positivity for dengue virus in churches. Meanwhile, in Belo Horizonte, the State capital of Minas Gerais, Eiras et al. [24] found 4.9% (4/82 pools) and 8.5% (7/82 pools) infectivity to dengue virus and Zika virus, respectively, at the university campus,representing a higher risk of transmission for these populations. Moreover, the possibility of transovarian transmission of dengue[25] , chikungunya[26] and Zika[27 , 28] in Ae. aegypti shows that a varied percentage of mosquitoes can be infected with these viruses. Thus, cases may occur without the need of a previous source of infection. Dengue, chikungunya and Zika are underreported diseases[29] . Sometimes, these infections have subclinical manifestations. Additionally, some populations have less access to public health care, or, as is the case with Zika, laboratory examination is often required only for groups considered at higher risk, such as pregnant women. In Brazil, Ae. aegypti entomological surveillance is based on the monitoring of immature forms (Larval Index Rapid Assay for Ae. aegypti - LIRA) as recommended by the Brazilian Health Ministry. Thus, according to the prevalence of Ae. aegypti immature forms, each stratum (area between 2,000 to 12,000 properties) receives a risk rating: low (≤ 0.9%), medium (1% - 3.9%) or high (≥ 4%)[30] . This method depends on the accuracy of the inspector to collect immature forms. In addition, Macapa city does not have specialized staff equipped with stairs to inspect elevated deposits such as water boxes and gutters. The epidemiological surveillance of dengue, chikungunya and Zika is performed by the follow-up of reported cases, thus helping the health surveillance teams to find sites for implementing vector control actions aimed at interrupting the transmission of the disease[7] . In general, surveillance actions are reactionary rather than preventive. Monitoring the presence of these viruses in Ae. aegypti where there are high levels of vector density means a better guiding for the vector combat teams. Besides optimizing public resources, this process provides a transmission chain break while the virus is inside the mosquito. Moreover, according to Pena-Garcia et al .[31] , density of mosquitoes is not a good predictor of dengue cases. Instead, mosquito infection rates can better explain the dengue heterogeneity, helping to predict infections up to six weeks before the onset of cases. The current Ae. aegypti control program advocates that when a case of Ae. aegypti transmitted disease is identified, control actions should be performed at the probable site of infection, typically the patient’s home. However, transmission often occurs in divergent locations, as the mosquito prefers feeding during the daytime[32] , and it is dispersed throughout the city. The use of molecular methods to detect the presence of these viruses in Ae. aegypti is a powerful tool to perform a fast virological surveillance, allowing the adoption of the most effective prevention measures to deal with these diseases.

CONCLUSION

The Ae. aegypti infestation rates were comparable for both Central and Marabaixo neighborhoods. However, the study only revealed the presence of the dengue virus in mosquitoes from the Marabaixo neighborhood, showing a low infectivity. Virological surveillance for Ae. aegypti was important to identify infectivity sites and determine possible routes of transmission, driving the surveillance health team to adopt strategies to act faster in sites where infected mosquitoes were present.
  22 in total

Review 1.  Invasions by insect vectors of human disease.

Authors:  L Philip Lounibos
Journal:  Annu Rev Entomol       Date:  2002       Impact factor: 19.686

2.  Serotype-specific detection of dengue viruses in a fourplex real-time reverse transcriptase PCR assay.

Authors:  Barbara W Johnson; Brandy J Russell; Robert S Lanciotti
Journal:  J Clin Microbiol       Date:  2005-10       Impact factor: 5.948

3.  Host-feeding pattern of Aedes aegypti and Aedes albopictus (Diptera: Culicidae) in heterogeneous landscapes of South Andaman, Andaman and Nicobar Islands, India.

Authors:  Arun Sivan; A N Shriram; I P Sunish; P T Vidhya
Journal:  Parasitol Res       Date:  2015-07-30       Impact factor: 2.289

4.  First report of naturally infected Aedes aegypti with chikungunya virus genotype ECSA in the Americas.

Authors:  André Luis Costa-da-Silva; Rafaella Sayuri Ioshino; Vivian Petersen; Antonio Fernando Lima; Marielton Dos Passos Cunha; Michael R Wiley; Jason T Ladner; Karla Prieto; Gustavo Palacios; Danuza Duarte Costa; Lincoln Suesdek; Paolo Marinho de Andrade Zanotto; Margareth Lara Capurro
Journal:  PLoS Negl Trop Dis       Date:  2017-06-14

5.  First detection of natural infection of Aedes aegypti with Zika virus in Brazil and throughout South America.

Authors:  Anielly Ferreira-de-Brito; Ieda P Ribeiro; Rafaella Moraes de Miranda; Rosilainy Surubi Fernandes; Stéphanie Silva Campos; Keli Antunes Barbosa da Silva; Marcia Gonçalves de Castro; Myrna C Bonaldo; Patrícia Brasil; Ricardo Lourenço-de-Oliveira
Journal:  Mem Inst Oswaldo Cruz       Date:  2016-10-03       Impact factor: 2.743

6.  Comprehensive innate immune profiling of chikungunya virus infection in pediatric cases.

Authors:  Daniela Michlmayr; Theodore R Pak; Adeeb H Rahman; El-Ad David Amir; Eun-Young Kim; Seunghee Kim-Schulze; Maria Suprun; Michael G Stewart; Guajira P Thomas; Angel Balmaseda; Li Wang; Jun Zhu; Mayte Suaréz-Fariñas; Steven M Wolinsky; Andrew Kasarskis; Eva Harris
Journal:  Mol Syst Biol       Date:  2018-08-27       Impact factor: 11.429

Review 7.  History of domestication and spread of Aedes aegypti--a review.

Authors:  Jeffrey R Powell; Walter J Tabachnick
Journal:  Mem Inst Oswaldo Cruz       Date:  2013       Impact factor: 2.743

8.  Detection of all four dengue serotypes in Aedes aegypti female mosquitoes collected in a rural area in Colombia.

Authors:  Rosalía Pérez-Castro; Jaime E Castellanos; Víctor A Olano; María Inés Matiz; Juan F Jaramillo; Sandra L Vargas; Diana M Sarmiento; Thor Axel Stenström; Hans J Overgaard
Journal:  Mem Inst Oswaldo Cruz       Date:  2016-04       Impact factor: 2.743

9.  Infection Rates by Dengue Virus in Mosquitoes and the Influence of Temperature May Be Related to Different Endemicity Patterns in Three Colombian Cities.

Authors:  Víctor Hugo Peña-García; Omar Triana-Chávez; Ana María Mejía-Jaramillo; Francisco J Díaz; Andrés Gómez-Palacio; Sair Arboleda-Sánchez
Journal:  Int J Environ Res Public Health       Date:  2016-07-21       Impact factor: 3.390

10.  Vertical Transmission of Zika Virus in Aedes aegypti Mosquitoes.

Authors:  Saravanan Thangamani; Jing Huang; Charles E Hart; Hilda Guzman; Robert B Tesh
Journal:  Am J Trop Med Hyg       Date:  2016-08-29       Impact factor: 2.345

View more
  5 in total

1.  Adaptive Evolution of New Variants of Dengue Virus Serotype 1 Genotype V Circulating in the Brazilian Amazon.

Authors:  Geovani de Oliveira Ribeiro; Danielle Elise Gill; Edcelha Soares D'Athaide Ribeiro; Fred Julio Costa Monteiro; Vanessa S Morais; Roberta Marcatti; Marlisson Octavio da S Rego; Emerson Luiz Lima Araújo; Steven S Witkin; Fabiola Villanova; Xutao Deng; Ester Cerdeira Sabino; Eric Delwart; Élcio Leal; Antonio Charlys da Costa
Journal:  Viruses       Date:  2021-04-16       Impact factor: 5.048

2.  Entomological characterization of Aedes mosquitoes and arbovirus detection in Ibagué, a Colombian city with co-circulation of Zika, dengue and chikungunya viruses.

Authors:  María C Carrasquilla; Mario I Ortiz; Cielo León; Silvia Rondón; Manisha A Kulkarni; Benoit Talbot; Beate Sander; Heriberto Vásquez; Juan M Cordovez; Camila González
Journal:  Parasit Vectors       Date:  2021-09-06       Impact factor: 3.876

3.  Entomological Investigation and Detection of Dengue Virus Type 1 in Aedes (Stegomyia) albopictus (Skuse) During the 2018-2020 Outbreak in Zhejiang Province, China.

Authors:  Qinmei Liu; Jinna Wang; Juan Hou; Yuyan Wu; Hengduan Zhang; Dan Xing; Jian Gao; Chunxiao Li; Xiaoxia Guo; Yuting Jiang; Zhenyu Gong; Tongyan Zhao
Journal:  Front Cell Infect Microbiol       Date:  2022-07-01       Impact factor: 6.073

4.  Risk factors for Aedes aegypti household pupal persistence in longitudinal entomological household surveys in urban and rural Kenya.

Authors:  Harun N Ngugi; Sindiso Nyathi; Amy Krystosik; Bryson Ndenga; Joel O Mbakaya; Peter Aswani; Peter S Musunzaji; Lucy W Irungu; Donal Bisanzio; Uriel Kitron; A Desiree LaBeaud; Francis Mutuku
Journal:  Parasit Vectors       Date:  2020-10-01       Impact factor: 3.876

5.  Aedes aegypti from Amazon Basin Harbor High Diversity of Novel Viral Species.

Authors:  Geovani de Oliveira Ribeiro; Vanessa S Morais; Fred Julio Costa Monteiro; Edcelha Soares D'Athaide Ribeiro; Marlisson Octavio da S Rego; Raimundo Nonato Picanço Souto; Fabiola Villanova; Roozbeh Tahmasebi; Philip Michael Hefford; Xutao Deng; Eric Delwart; Ester Cerdeira Sabino; Licia Natal Fernandes; Antonio Charlys da Costa; Élcio Leal
Journal:  Viruses       Date:  2020-08-08       Impact factor: 5.048

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.