Reham Wasfi1, Ghada Refaat Abdellatif2, Hisham Mohamed Elshishtawy3, Hossam M Ashour4,5. 1. Department of Microbiology and Immunology, Faculty of Pharmacy, October University for Modern Sciences and Arts (MSA), Giza, Egypt. 2. Department of Microbiology and Immunology, Faculty of Pharmacy, Ahram Canadian University (ACU), Giza, Egypt. 3. Microbial Genetics Laboratory, Agricultural Genetic Engineering Research Institute (AGERI), Agricultural Research Center (ARC), Giza, Egypt. 4. Department of Biological Sciences, College of Arts and Sciences, University of South Florida St. Petersburg, St. Petersburg, Florida. 5. Department of Microbiology and Immunology, Faculty of Pharmacy, Cairo University, Cairo, Egypt.
Abstract
Pathogenic bacteria can enter into a viable but non-culturable (VBNC) state under unfavourable conditions. Proteus mirabilis is responsible for dire clinical consequences including septicaemia, urinary tract infections and pneumonia, but is not a species previously known to enter VBNC state. We suggested that stress-induced P. mirabilis can enter a VBNC state in which it retains virulence. P. mirabilis isolates were incubated in extreme osmotic pressure, starvation, low temperature and low pH to induce a VBNC state. Resuscitation was induced by temperature upshift and inoculation in tryptone soy broth with Tween 20 and brain heart infusion broth. Cellular ultrastructure and gene expression were examined using transmission electron microscopy (TEM) and quantitative real-time polymerase chain reaction (qPCR), respectively. High osmotic pressure and low acidity caused rapid entry into VBNC state. Temperature upshift caused the highest percentage of resuscitation (93%) under different induction conditions. In the VBNC state, cells showed aberrant and dwarf morphology, virulence genes and stress response genes (envZ and rpoS) were expressed (levels varied depending on strain and inducing factors). This is the first-time characterization of VBNC P. mirabilis. The ability of P. mirabilis pathogenic strains to enter a stress-induced VBNC state can be a serious public health threat.
Pathogenic bacteria can enter into a viable but non-culturable (VBNC) state under unfavourable conditions. Proteus mirabilis is responsible for dire clinical consequences including septicaemia, urinary tract infections and pneumonia, but is not a species previously known to enter VBNC state. We suggested that stress-induced P. mirabilis can enter a VBNC state in which it retains virulence. P. mirabilis isolates were incubated in extreme osmotic pressure, starvation, low temperature and low pH to induce a VBNC state. Resuscitation was induced by temperature upshift and inoculation in tryptone soy broth with Tween 20 and brain heart infusion broth. Cellular ultrastructure and gene expression were examined using transmission electron microscopy (TEM) and quantitative real-time polymerase chain reaction (qPCR), respectively. High osmotic pressure and low acidity caused rapid entry into VBNC state. Temperature upshift caused the highest percentage of resuscitation (93%) under different induction conditions. In the VBNC state, cells showed aberrant and dwarf morphology, virulence genes and stress response genes (envZ and rpoS) were expressed (levels varied depending on strain and inducing factors). This is the first-time characterization of VBNC P. mirabilis. The ability of P. mirabilis pathogenic strains to enter a stress-induced VBNC state can be a serious public health threat.
Under stressful environmental conditions, some bacteria were reported to enter a phase called the viable but non‐culturable state (VBNC).1 Bacteria in the VBNC state are characterized by low metabolic activities and loss of culturability.2 Cells in the VBNC state are still considered viable because they retain some properties, including metabolic activity, membrane potential, membrane integrity, intracellular enzymatic activity, gene expression and retention of plasmids.3 VBNC‐inducing stresses include nutrient starvation,4 incubation outside normal temperature,5 high osmotic pressure,4 sharp pH changes,4 antibiotic pressure 6 and heavy metals.7 Resuscitation of VBNC cell can occur upon removal of the inducers,8 exposure to amino acids, using host cells such as embryonated chicken eggs and exposure to resuscitation promotion factor.9 Pathogenic bacteria that enter the stress‐induced VBNC phase upon release from the human body to the environment can run undetectable or underestimated and can thus threaten public health.10Some bacteria in the VBNC state were found to display manifestations of their virulence attributes while others can lose part of their virulence properties.11 Bacteria can also display virulence traits upon resuscitation.12 Furthermore, cells in the VBNC state were found to show additional virulence traits, such as antibiotic resistance which were not shown in their normal state.13 This might explain recurrent infections by antibiotic‐resistant bacteria that enter VBNC state and then retain their full activity upon condition improvement.7 A number of pathogenic bacteria have been reported to enter the VBNC state including Campylobacter spp., Escherichia coli, Francisella tularensis, Helicobacter pylori, Legionella pneumophila, Listeria monocytogenes, Mycobacterium tuberculosis, Pseudomonas aeruginosa, several Salmonella and Shigella sp., and numerous pathogenic Vibrio sp.14 However, up to our knowledge and by searching the PubMed database (https://www.ncbi.nlm.nih.gov/pubmed/), there were no studies related to the VBNC state in P. mirabilis.Proteus mirabilis bacteria are Gram‐negative, facultative anaerobes that can be responsible for dire clinical consequences including septicaemia, urinary tract infections and pneumonia.15
Proteus sp. possess several virulence factors including fimbriae, flagella, urease enzyme, lipopolysaccharide, capsular polysaccharide and metalloproteinase (serralysin).16
Proteus sp. are normal flora in the intestinal tract.17 Their presence in soil or water is an indicator of faecal pollution and can consequently cause infection to human consuming contaminated water or contaminated seafood.18 Some sea animals are reported to absorb and accumulate Proteus spp. such as sponges (Spongia offinialis),19 oysters 20 and turtles.21
Proteus sp. is the causative agent for many urinary tract and wound infections as well as nosocomial infections.22 Studies have reported similarities between Proteus sp. isolated from human intestine and those causing urinary tract infection (autoinfection) 23 or food poisoning.21We suggested that P. mirabilis can enter a VBNC state and that this VBNC state impacts gene expression and cellular ultrastructure of the VBNC cells as compared to control cells. We also studied different P. mirabilis VBNC‐inducing factors and resuscitating conditions. To the best of our knowledge, this is the first‐time characterization of VBNC P. mirabilis.
MATERIALS AND METHODS
Bacterial strains
Three P. mirabilis clinical isolates were recovered from patients in Kasr Al‐Aini Hospital, Cairo, Egypt. Approvals from the research ethics committees of the hospital and the faculty of Pharmacy, October University for Modern Sciences and Arts, Giza, Egypt were obtained prior to conducting the study. Two isolates, P6 and P7, were recovered from urinary tract infections, and the isolate, coded P3, was recovered from wound infection. Written consents were obtained from all participants in the study.
Induction of the VBNC state
The VBNC state induction was done according to Pinto et al 24 with some modifications. P. mirabilis strains were grown overnight in tryptone soy broth (TSB) at 37°C with shaking. The culture was centrifuged at 5000 rpm for 10 minutes at 5°C, and pellets were washed twice by sterile saline solution. The resulting pellets were resuspended in sterile deionized water, and the cell concentration was adjusted to be equivalent to McFarland 0.5 (1.5 × 108 CFU/mL). A volume of 400 µL was used to inoculate 40 mL of the induction medium, in a 50‐mL falcon tube, to reach a final density of approximately 106 CFU/mL. Different induction media were used to create different stressful conditions for isolates: (a) deionized water, for starvation and low osmotic pressure stress; (b) deionized water + NaCl (0.9%), for starvation stress; (c) deionized water + NaCl (0.9%) at pH 5, for starvation and acidic condition stresses; (d) deionized water + NaCl (4%), for starvation and high osmotic pressure stresses, and (e) deionized water + NaCl (7%), for starvation and high osmotic pressure. Each induction condition was done in duplicate, and tubes were incubated at 4°C, without shaking and in dark. Culturability on TSA was assessed every week in duplicate plates, and time required for loss of culturability was recorded. Test of culturability was done by testing the growth of 1 mL of culture, and then, when no growth is detected, 10 mL of culture was centrifuged and resuspended in 1 mL and repeated subculture was done. Heat killed bacteria at 100°C for 15 minutes were used as control cells.
RNA isolation and cDNA preparation
30 mL of each VBNC sample was centrifuged at 10 000 g for 10 minutes at 4°C. Total RNA was extracted from cultures using the SV Total RNA Isolation® System (Promega). Extraction was done according to the manufacturer's instructions. RNA was stored in RNase‐free water and then stored at −80°C until use. RNA quantity and quality were measured at wavelengths 260 and 280 nm using ND‐1000 spectrophotometer (NanoDrop Technology). RNA quality was also tested by agarose gel electrophoresis. The RNA samples were treated with RNase‐free DNase I (New England Biolab). Samples were confirmed to be free of genomic DNA by 40 cycles of conventional PCR using 16S rRNA primers (long amplicon, ~1.5 kb). After confirming the absence of genomic DNA by agarose gel analysis, ~l µg DNase‐treated RNA was subjected to reverse transcription using the SensiFastTM cDNA synthesis kit (Bioline) following the supplier's directions (Table 1). Control bacteria for qRT‐PCR were prepared by inoculation in BHI medium and incubation at 37°C for the late exponential phase. This was followed by total RNA extraction using the same methodology that was implemented for the VBNC samples.
Table 1
List of oligonucleotide sequences and the corresponding annealing temperatures
Target gene a
Primer sequence 5’‐3’
Ta*
Amplicon size
(bp)
Reference
FtsZ
For: AAGGCGAAGATCGTGCTGAA
Rev: TGCACGAATGGTGTTACCGA
55
161
This study
FliL
For: TATTTACCCGAAGTTCGTAGT
Rev: GGTAAACAGTACATCGGAGAG
55
150
ZapA
For: TATGCGGAAGATAGTCGCCAA
Rev: AGTCGTATTTGCGCCATAGAG
55
150
Rpos
For: AGGCCTTATTCGTGCTGTTG
Rev: ATCATCGACCGGTTTATCCA
55
200
EnvZ
For: GCTTGGTTTCAAGTTGAAGAC
Rev: TAGACCTAAACCCGCACC
55
120
LuxS
For: TTCGCCAATGGGATGTCGTA
Rev: TCCATAGCTGCCTTCCATGC
55
93
16s rRNAb (short amplicon)
For: CACACTGGAACTGAGACAC
Rev: CTTCTTCTGCGGGTAACG
55
189
69
16s rRNAc (long amplicon)
For: AGA GTT TGA TCC TGG CTC AGU
Rev: GGT TAC CTT GTT ACG ACT T
47
1465
70
Ta* annealing temperature.
ftsZ gene, coding for cell division protein; flil, coding for flagellar basal body protein; zapA, serralysin (metalloprotease); rpoS, stress stationary phase regulator; envZ, two‐component sensor histidine kinase; and luxS, s‐ribosyl homocysteine..
16 s rRNA primer used in VBNC validation and in qPCR.
16 s rRNA primer used for confirmation of complete removal of genomic DNA.
List of oligonucleotide sequences and the corresponding annealing temperaturesAmplicon size(bp)For: AAGGCGAAGATCGTGCTGAARev: TGCACGAATGGTGTTACCGAFor: TATTTACCCGAAGTTCGTAGTRev: GGTAAACAGTACATCGGAGAGFor: TATGCGGAAGATAGTCGCCAARev: AGTCGTATTTGCGCCATAGAGFor: AGGCCTTATTCGTGCTGTTGRev: ATCATCGACCGGTTTATCCAFor: GCTTGGTTTCAAGTTGAAGACRev: TAGACCTAAACCCGCACCFor: TTCGCCAATGGGATGTCGTARev: TCCATAGCTGCCTTCCATGCFor: CACACTGGAACTGAGACACRev: CTTCTTCTGCGGGTAACGFor: AGA GTT TGA TCC TGG CTC AGURev: GGT TAC CTT GTT ACG ACT TTa* annealing temperature.ftsZ gene, coding for cell division protein; flil, coding for flagellar basal body protein; zapA, serralysin (metalloprotease); rpoS, stress stationary phase regulator; envZ, two‐component sensor histidine kinase; and luxS, s‐ribosyl homocysteine..16 s rRNA primer used in VBNC validation and in qPCR.16 s rRNA primer used for confirmation of complete removal of genomic DNA.
Validation of the VBNC state
The RNA expression was used as tool indicating viability of cells.25 After loss of culturability on routine media by VBNC‐induced cells, the continuous expression of the housekeeping genes 16S rRNA (short amplicon, 189 bp) and Rpos was used as confirmation for cell viability under different stressful conditions using specific primers (Table 1). The amplicon was detected using gel electrophoresis for 16S rRNA gene and qRT‐PCR for RpoS gene.
Resuscitation of the VBNC cells
Different conditions of resuscitation were used: (a) temperature upshift, (b) inoculation in TSB with added nutrients of Tween 20 (3% v/v) and (c) inoculation in low‐nutrient medium BHI (1/8 concentration).Resuscitation by temperature upshift was performed according to Zeng et al 26 with modifications. 10 mL of VBNC culture was placed in the incubator at 10°C, and then, the temperature was increased gradually by 5°C every 60 minutes till the temperature reaches 35°C. At this point, 2 mL out of the 10 mL VBNC suspension was seed cultured in TSA plates to check the ability of the cells to regain its culturability.10 mL medium was inoculated with 20 µL from the VBNC suspension. The inoculated media included the following: TSB with added Tween 20 and low‐nutrient medium BHI (1/8 concentration). Inoculated media were incubated at 37°C for 72 hours, and then, the appearance of turbidity indicated resuscitation of VBNC cells and regaining of the culturability of VBNC cells.27
Quantitative PCR conditions
We studied the change in gene expression of the following genes: stress response genes (rpoS and envZ), virulence genes (flil, zapA and luxS) and genes for cell division (ftsZ). Expression in VBNC cells was compared to control cells. The primers were designed using the complete genome sequence of P. mirabilis (HI4320) obtained from the NCBI database (NCBI accession no. https://www.ncbi.nlm.nih.gov/nuccore/NC_010554). Primers for the qPCR used in the current study (Table 1) were synthesized by Invitrogen® (Massachusetts, USA).Quantitative real‐time reverse transcription polymerase chain reaction (qRT‐PCR) was performed by Applied Biosystems StepOne™ Instrument using SensiFast™ SYBR HiRox Master (Bioline, Massachusetts. USA). All reactions (20 μL) were performed using three technical replicates. Each reaction mixture contains 100 ng cDNA and 400 nmol/L primers per reaction. The RT‐PCR cycling conditions were as follows: one cycle with 95°C for 2 min; then 40 cycles of denaturation at 95°C for 5 seconds, annealing at 55°C for 10 seconds, and extension and fluorescent data collection at 72°C for 20 seconds. A dissociation curve was generated at the end of each reaction. In all qPCR runs, negative controls without template were run in parallel. The 16s rRNA gene (housekeeping gene) was selected as the internal control based on the results of BestKeeper® software tool.28 The relative mRNA levels of genes of interest were determined and normalized to the expression of the housekeeping gene using the ∆∆ CT value analysis.29 The qPCR data were expressed as the fold change in expression levels of genes in P. mirabilis potential VBNC as compared to their levels in the control cells unexposed to stress (calibrators) grown in BHI medium and incubated for the late exponential phase. Only genes with a relative 2−∆∆C value above 1.0 or below 1.0 were considered significant. [Correction added on 17 February 2020: 2∆∆C has been changed to 2−∆∆C in the preceding sentence.]
Transmission electron microscopy (TEM)
The structures of control, VBNC and resuscitated cells were investigated using transmission electron microscope (TEM). Cells were harvested by centrifugation, and the bacterial pellets were washed three times with PBS. Cell fixation and processing steps were performed according to the method described in Henriques et al.30 Micrographs for each sample were captured at 10 000 g magnification power, and cells were observed for structural alterations using JEM 100 CX transmission electron microscope (JEOL, Japan) operated at 80 kV. [Correction added on 17 February 2020: 10 000× had been changed to 10 000 g in the preceding sentence.]
Statistics
Results of three replicates were analysed for statistical significance with PRISM 5 (GraphPad). A one‐way analysis of variance (ANOVA) was performed. Data comparisons were performed using Bonferroni's correction for multiple testing.
RESULTS
The samples were exposed to different VBNC induction conditions which include a combination of either acidic or osmotic pressure in addition to both cold and starvation stresses. The number of weeks taken by each of the three samples to enter in the VBNC state varied from 14 to 26 weeks according to the inducing condition (Figure 1). Isolates incubated under isotonic pressure (deionized water + 0.9% NaCl) lost their ability for culturing after a time ranging from 18 to 26 weeks (Average 22 weeks). High osmotic pressure (deionized water + NaCl 4% or 7%) and acidic conditions caused rapid entry into VBNC state compared to isotonic water microcosm. The time range required for entry of low osmotic pressure (deionized water only) was between 16 and 21 weeks (average 18.5 weeks).
Figure 1
The time required for Proteus mirabilis cells to lose culturability under various VBNC induction condition. All samples were incubated at 4°C in water microcosm, hence exposed to cold and starvation stresses. Induction media include the following: (A) Water (W) + 0.9% NaCl. (B) Water (W) + 0.9% NaCl, pH 5. (C) Water (W). (D) Water (W) + 4% NaCl. (E) Water (W) + 7% NaCl
The time required for Proteus mirabilis cells to lose culturability under various VBNC induction condition. All samples were incubated at 4°C in water microcosm, hence exposed to cold and starvation stresses. Induction media include the following: (A) Water (W) + 0.9% NaCl. (B) Water (W) + 0.9% NaCl, pH 5. (C) Water (W). (D) Water (W) + 4% NaCl. (E) Water (W) + 7% NaClSamples that lost their ability for culturing were confirmed to be viable by subjecting them to total RNA extraction followed by reverse transcription to cDNA. After amplification by conventional PCR, the expression of the 16S rRNA and RpoS genes was detected by gel electrophoresis (Figure 2) and qRT‐PCR (Figure 3), respectively. The continuous expression of these genes was detected in all samples under different VBNC induction conditions, and this confirmed the entry into the VBNC state. No detectable 16s rRNA or Rpos in killed control cells after 48 hours of heat treatment.
Figure 2
Gel electrophoresis of PCR product amplified with the 16s rRNA primer set (189 bp) of the cDNA produced by reverse transcription of RNA extracted from P. mirabilis samples 3 (lanes 1‐5) and 6 (lanes 6‐10) exposed to different VBNC conditions at 4°C. Media used include the following: W, deionized water (lanes 1,6); S, deionized water + NaCl 0.9% (lanes 2,7); deionized water + NaCl 0.9% at pH 5 (lanes 3,8); 4%, deionized water + NaCl 4% (lanes 4,9); deionized water + 7% NaCl (lanes 5,10). Lane Lad: represents the molecular size ladder 100‐bp DNA ladder
Figure 3
Transcription levels of selected genes (ftsZ, zapA, fliL, luxS, rpoS and envZ) of each P. mirabilis strain [3(A), 6 (B), 7 (C)] in the VBNC state, incubated in various environmental conditions. The conditions used include: water microcosm, water + 0.9% NaCl, water + 0.9% NaCl, pH5, water + 4% NaCl and water + 7% NaCl. Standard deviations are indicated as vertical bars. Asterisks indicate statistically significant differences in the expression of each gene between VBNC samples and control, as analysed using the one‐way ANOVA with Bonferroni's correction for multiple testing (*P ≤ .05; **P ≤ .01; ***P ≤ .001; ns, no significant difference)
Gel electrophoresis of PCR product amplified with the 16s rRNA primer set (189 bp) of the cDNA produced by reverse transcription of RNA extracted from P. mirabilis samples 3 (lanes 1‐5) and 6 (lanes 6‐10) exposed to different VBNC conditions at 4°C. Media used include the following: W, deionized water (lanes 1,6); S, deionized water + NaCl 0.9% (lanes 2,7); deionized water + NaCl 0.9% at pH 5 (lanes 3,8); 4%, deionized water + NaCl 4% (lanes 4,9); deionized water + 7% NaCl (lanes 5,10). Lane Lad: represents the molecular size ladder 100‐bp DNA ladderTranscription levels of selected genes (ftsZ, zapA, fliL, luxS, rpoS and envZ) of each P. mirabilis strain [3(A), 6 (B), 7 (C)] in the VBNC state, incubated in various environmental conditions. The conditions used include: water microcosm, water + 0.9% NaCl, water + 0.9% NaCl, pH5, water + 4% NaCl and water + 7% NaCl. Standard deviations are indicated as vertical bars. Asterisks indicate statistically significant differences in the expression of each gene between VBNC samples and control, as analysed using the one‐way ANOVA with Bonferroni's correction for multiple testing (*P ≤ .05; **P ≤ .01; ***P ≤ .001; ns, no significant difference)As shown in Table 2, methods of resuscitation included temperature upshift and using different media. Samples incubated in water microcosm showed the highest ability to regain culturability with different resuscitating factors. Raising the incubation temperature from 4°C to 35°C caused higher rate of successful resuscitation that reached 93% of samples incubated in starvation conditions. The low nutrient medium BHI (1/8 concentration) showed the lowest ability to resuscitate different strains with an average resuscitation percentage of 20%. On the other hand, VBNC cells induced by starvation only (water + 0.9% NaCl) were not resuscitable by BHI (1/8). TSBmedia with additive Tween 20 can resuscitate VBNC cells under the ‘water only’ condition (Figure 1).
Table 2
Resuscitation of VBNC‐induced Proteus mirabilis strains
Resuscitating conditions
Strains
3
6
7
W
S
A
F
V
W
S
A
F
V
W
S
A
F
V
Temp. Upshifta
+
+
+
−
+
+
+
+
+
+
+
+
+
+
+
TSB+
3% Tween 20b
+
−
+
+
−
+
−
+
+
+
+
−
+
+
+
BHI
(1/8)c
−
−
−
−
−
+
−
−
−
−
+
−
+
−
−
(+) indicates growth, (‐) indicates no growth.
VBNC induction conditions; W = water; S = W+0.9% NaCl; A = W+0.9% NaCl, pH 5; F = W+4% NaCl; V = W+7% NaCl.
Temperature upshift: increasing incubation temperature from 10 to 35°C at a rate of 5°C every 60 min, followed by culturing in tryptone soy agar medium (TSA).
Twenty microlitres of VBNC‐induced culture inoculated in TSB with additive Tween 20 (3%).
Twenty microlitres of VBNC‐induced culture inoculated in low concentration BHI broth (1/8 concentration).
Resuscitation of VBNC‐induced Proteus mirabilis strainsTSB+3% Tween 20bBHI(1/8)c(+) indicates growth, (‐) indicates no growth.VBNC induction conditions; W = water; S = W+0.9% NaCl; A = W+0.9% NaCl, pH 5; F = W+4% NaCl; V = W+7% NaCl.Temperature upshift: increasing incubation temperature from 10 to 35°C at a rate of 5°C every 60 min, followed by culturing in tryptone soy agar medium (TSA).Twenty microlitres of VBNC‐induced culture inoculated in TSB with additive Tween 20 (3%).Twenty microlitres of VBNC‐induced culture inoculated in low concentration BHI broth (1/8 concentration).We assessed the relative gene expression of tested strains after their entry into the VBNC state as compared to control bacteria grown in TSB to the late exponential phase. Genes studied included stress response genes (rpoS, envZ), virulence genes (zapA, fliL), autoinducers coding genes (luxS) and the gene coding for septum formation during division (ftsZ). Gene expression was normalized relative to the 16S rRNA gene. The ftsZ gene expression was down‐regulated in all VBNC cells (Figure 3).The stress response gene rpoS was significantly up‐regulated under all conditions for isolate number 7 (≃10‐fold). Up‐regulation was observed in strain 6 under the conditions of water, NaCl 4% and NaCl 7%, by 10‐, 2‐ and 10‐fold. In strain 3, significant up‐regulation (2.9‐fold) was observed only in the presence of water, whereas down‐regulation was observed in presence of all other conditions. Significant down‐regulation for the envZ gene was observed under all conditions except the acidic conditions, at which the envZ expression was significantly up‐regulated (1.5‐ to 2‐fold). The expression of the fliL gene coding for basal flagellar protein varied depending on the condition inducing the VBNC state. While the acidic pH caused significant down‐regulation in fliL gene expression, the high osmotic pressure (4% NaCl) caused a significant up‐regulation of the fliL gene expression (an increase of 1.7‐fold in strains 3 and 7 and an increase of 9‐fold in strain 6). The expression of the gene zapA coding for metalloprotease protein was variable depending on strains and conditions inducing VBNC. Significant down‐regulation was observed under all conditions with strain 3 and in the presence of high salt concentrations (4% and 7%) in strain 7. The zapA gene was significantly up‐regulated in isolate 6 under all conditions. The luxS gene coding for autoinducer 2 (AI 2) was generally down‐regulated in all tested isolates under most conditions (Figure 3).Strain 6 entered the VBNC state under the starvation stress (in water microcosm containing 0.9% NaCl) after 182 days. Upon TEM examination of the VBNC cells, cells were aberrant shaped, smaller in size and more rounded than control cells. They had thicker cell walls with condensed dark cytoplasm attached to the cell wall (Figure 4C). Resuscitated cells, in TSB medium containing Tween 3%, had a smaller size (Figure 4B) than actively growing cells in the late exponential phase (Figure 4A).
Figure 4
Representative TEM micrographs showing the structural changes in P. mirabilis (strain 6), in (A) control, (B) resuscitated and (C) VBNC state (after starvation for 182 days in water microcosm + 0.9% NaCl). Samples A and B were examined at magnification 15 000× while VBNC cells were examined at 50 000×
Representative TEM micrographs showing the structural changes in P. mirabilis (strain 6), in (A) control, (B) resuscitated and (C) VBNC state (after starvation for 182 days in water microcosm + 0.9% NaCl). Samples A and B were examined at magnification 15 000× while VBNC cells were examined at 50 000×
DISCUSSION
The VBNC state is a potential public health hazard in the environment,7 because bacterial cells under different environmental stresses such as low or high osmotic pressure,31 starvation 32 and acidic pH 33 can shift to the VBNC state which could run undetected. During the transient existence of pathogenic bacteria in the environment before infecting another person, they might be exposed to stressful conditions that cause the entry of these cells into the VBNC state.34 There are no previous data in the literature that characterizes P. mirabilis VBNC state.In our study, the conditions used for inducing the VBNC state in P. mirabilis were cold temperature (4°C) and starvation accompanied by: low osmotic pressure (deionized water); high osmotic pressure (deionized water + 4 or 7% NaCl); acidic pH (deionized water + 0.9% NaCl at pH 5); and isotonic pressure (deionized water + 0.9% NaCl). The entry of P. mirabilis (starting count 1.5 × 106 CFU/mL) into the VBNC state under cold conditions (4°C) was more rapid than at room temperature (25°C), and the maximum time required for loss of culturability was 26 weeks at 4°C and over than 65 weeks at 25°C (data not shown). The rapid entry into VBNC state at 4°C could be attributed to the inability of the cells to detoxify lethal peroxides produced under stressful conditions, because cold incubation prevents catalase activity and its de novo synthesis35 This can lead to an increase in toxins and failure of the antitoxin effect which is an inducer of the VBNC state.7Proteus mirabilis showed more rapid entry (20 weeks) into the VBNC state compared to the E coli O157:H7 in a study 8 (34 weeks), that used similar starting bacterial concentration and similar VBNC‐inducing conditions. Thus, the speed of entry depends on the microbial species. In our study, it was noticed that exposure of P. mirabilis to combined stressful factors lead to more rapid entry (P < .01) into the VBNC state than exposure to single factor as detected in E. coli by Muela et al36 Putting the cells under starved conditions makes them more resistant to stresses such as acid and oxidizing agents than growing cells.37 Moreover, Proteus sp was found to survive in marine environments due to their halotolerance trait attributed to the polyphosphate kinase encoded by the ppk gene,16, 38 and ppk mutant strains of Campylobacter jejuni were found to exhibit decreased ability to enter the VBNC state,39 which could explain their ability to retain viability while losing culturability under high salt concentrations.The entry of the P. mirabilis isolates into the VBNC state was confirmed by detecting the continuous expression of the 16S rRNA and rpoS genes in tested strains after losing their culturability. RNA detection was used because the half‐life of RNA is 3‐5 minutes and its continuous expression is an indication of continuous viability of bacteria that have lost their culturability.40 The 16S rRNA and Rpos genes were used as viability indicators as they are both housekeeping genes that need to be continuously expressed in living cells. The expression of 16S rRNA remains consistently high in viable cell indicating its validity as a viability indicator. Conversely, the gene is absent in dead bacterial cells after 48 hours of treatment. The rpoS gene is similarly absent in dead cells. This confirmatory method for entry of bacterial cells into the VBNC state was previously used in other studies.41, 42The 16s rRNA genes were not detected after 48 hours from heat treatment at high temperature for 15 minutes as found by McKillip et al43 The RpoS gene was not detected in dead cells as detected by Liu et al 44Several factors play roles in the ability of bacteria to resuscitate from the VBNC state. These factors include the particular strain used and the conditions that can induce the VBNC state and/or resuscitation24 . Some of the mechanisms used for resuscitation include temperature upshift and removal of environmental stressors.8 We have used three conditions for resuscitation including: a) temperature upshift; b) low‐nutrient medium (BHI 1/8 concentration); and c) TSB with Tween 20 (3%v/v). The most successful one was temperature upshift with a resuscitation success rate of 93.3% (14/15), which could be attributed to reaching the optimum temperature for catalase enzyme activity which can catalyse the breakdown of toxic peroxides.35 The lowest percentage of resuscitation was observed using BHI medium (1/8 concentration). By comparing the effect of low‐nutrient (BHI medium of 1/8 concentration) and high‐nutrient medium (TSB with additive Tween 20) on resuscitation, it was observed that the high‐nutrient medium was more efficient in resuscitating VBNC P. mirabilis strains than the low‐nutrient medium. This result is in contrast to what was reported by Bloomfield et al45 who noted that low‐nutrient environment was more efficient in resuscitation because of the toxic effect of high nutrients on cells in the VBNC state as a result of production of free radicals. Adding Tween 20 to TSB medium was assumed to reduce surface tension and improve the interaction between VBNC cells and the culture medium,46 in addition to acting as carbon source that supplies energy to VBNC cells.47The virulence factors known to be involved in pathogenesis of P. mirabilis include adhesins, motility, biofilm formation, immunoavoidance, toxins and nutrient acquisition.48 The gene expression of six different genes in three strains (P3, P6 and P7) was studied using relative qPCR. These genes code for: septum formation (ftsZ), stress response regulators (rpoS and envZ), virulence traits (zapA and fliL) and autoinducer (AI‐2) production (luxS). On assessing the relative expression of ftsZ gene under different induction conditions, the expression of this gene in the tested VBNC cells was reduced by variable folds according to the stress conditions and strains. Down‐regulation of ftsZ expression in VBNC bacteria was previously observed.49, 50 TEMobservation of the VBNC cells of P. mirabilis (P6) incubated in deionized water (containing 0.9% NaCl at 4°Cfor 182 days) revealed that VBNC cells appear aberrant and smaller in size than normal and resuscitated cells with condensed cytoplasm at the poles of the cells, condensed chromosomal DNA and intact cytoplasmic membrane. Upon resuscitation, the bacteria increased back to the normal size. The aberrant and dwarfing shapes were also observed in the VBNC cells of Vibrio parahaemolyticus,51
Vibrio vulnificus,2
Listeria monocytogenes,52
Yersinia pestis
27 and Helicobacter pylori.53 Li et al 54 reported that the starvation state interferes with the normal function of penicillin binding protein (PBP) which is important for cell wall formation during cell division. This interference lead to transition in the morphology of bacteria during their conversion from viable cells to the VBNC state, from rod shaped to coccoid form. The dwarfing size is the result of catabolism of cellular components under conditions of nutrient limitation, which leads to an increase in the surface area for nutrient transportation.55The entry of bacterial cells into the VBNC state provides them with necessary resistance to unfavourable stress conditions.56 Thus, we have studied the differential expression of the stress response genes (rpoS and envZ) under these conditions to determine its role in stress resistance. The envZ gene controls the outer membrane protein (Omp), and thus, it has a role in controlling membrane porins and sensing the change in environmental stimuli. Some studies suggested that envZ gene is vital for entry into the VBNC state and that any mutations in this gene could inhibit the entry into this state but does not affect the survival under the VBNC‐inducing conditions.57 In our study, the envZ gene, which is part of osmoregulating system EnvZ‐OmpR, was down‐regulated under all tested condition except in samples incubated in acidic deionized water where it is up‐regulated (1.6 to 8 folds) compared to normal cells. These results indicate that envZ gene has no role in cell survival under VBNC state except under acidic conditions and this observation was also noticed in a study carried by Kaeriyama et al 58 on E coli, where envZ controlled porins were up‐regulated under low osmotic pressure (0.5% NaCl) at acidic pH. Stress δs factor, coded by rpoS gene, controls the production of trehalose, which acts as a protective osmolyte, and is associated with persistence in the VBNC state.59 Mutation in this gene causes fast entry and less survival time in the VBNC state,59 in addition to delayed ability for resuscitation.9 Regulation and control of rpoS gene expression occurs at two levels: transcriptional and translational. There are differences between factors inducing rpoS gene transcription and those inducing rpoS mRNA translation into δs factor. RpoS gene transcription into rpoS mRNA is induced by reduced growth rate and is negatively controlled by cAMP‐CRP,60 while its translation into functional δs factor is induced by osmotic pressure and high cell density.61 In our study, the expression of rpoS gene was variable under combined effects of starvation with high osmotic pressure and acidic conditions. Gene expression was down‐regulated in strain 3 compared to normal cells while up‐regulation occured in strains 6 and 7. VBNC‐induced cells incubated in water microcosm showed up‐regulation in rpoS expression. The down‐regulation in rpoS gene in strain 3 might explain the lower percentage (44%) of resuscitation in this strain under different resuscitating conditions compared to strains 6 and 7, in which percentages of resuscitation were 64 and 67%, respectively.The ability of pathogenic bacteria to retain their virulence factors in the VBNC state is strain‐dependent.3, 62 We have studied the relative expression of genes coding for selected virulence traits including flagellar basal protein (fliL) and metalloprotease (zapA). Bacterial motility increases under high osmotic pressures 63 which is retained under VBNC conditions as was observed in our study and in the study of Asakura et al31 on VBNC V. vulnificus. Conversely, the expression of fliL gene was down‐regulated in all tested strains under acidic pH, which lead to reduction in flagella formation and motility as reported by Soutourina et al64Proteus mirabilis encodes a metalloproteinase, serralysin (ZapA), which was shown to cleave secretory immunoglobulins and antimicrobial peptides and hence establishing urinary tract infections.65 Although zapA is expressed at low levels in vivo, a P. mirabilis zapA mutant is less efficient than wild type at colonizing the urine, bladder and kidneys in murine infections.66 In our study, the expression of zapA gene was variable depending on the strain and the VBNC induction conditions but it persisted under unfavourable conditions indicating that P. mirabilis retained its metalloproteinase virulence traits during the VBNC state.Proteus mirabilis possesses a luxS homologue and produces AI‐2, which can mediate interactions between species.67 Continuous expression of luxS gene was observed in all tested strains under VBNC conditions. However, AI‐2 does not likely contribute to pathogenicity,67 in spite of studies that suggest the involvement of luxS expression in biofilm formation.68 The down‐regulation of the luxS gene under different VBNC‐inducing conditions in our study might indicate a reduced ability of VBNC cells for biofilm formation.In conclusion, P. mirabilis can enter the VBNC state under several conditions of starvation, extreme osmotic pressure, acidity and low temperature. The time required for entry into a VBNC state is dependent on the inducing condition and the bacterial strain. Removal of the cold stress by temperature upshift on VBNC cells lead to successful bacterial resuscitation. Bacterial cells under the VBNC state showed aberrant dwarf morphology and returned back to their normal shapes after resuscitation but with relatively smaller sizes as compared to normal cells. Gene expression was variable under different conditions and the continuous expression of virulence trait‐coding gene indicated that bacterial cells can retain some of their virulence properties under the VBNC state.
CONFLICT OF INTEREST
The authors declare no competing financial interests.
AUTHOR CONTRIBUTIONS
Dr Reham Wasfi, Dr. Ghada R. Abdellatif, Dr. Hisham M. Elshishtawy and Dr. Hossam M. Ashour contributed to the design of the study, performance of experiments, analysis of the results and writing of the manuscript.
Authors: Giovanni M Giammanco; Patrick A D Grimont; Francine Grimont; Martine Lefevre; Giuseppe Giammanco; Sarina Pignato Journal: Int J Syst Evol Microbiol Date: 2010-08-13 Impact factor: 2.747
Authors: David R Pawlowski; Daniel J Metzger; Amy Raslawsky; Amy Howlett; Gretchen Siebert; Richard J Karalus; Stephanie Garrett; Chris A Whitehouse Journal: PLoS One Date: 2011-03-16 Impact factor: 3.240
Authors: Liangliang Zhang; Yalan Dai; Mengting Lin; Qiuyun Xu; Tingting Lin; Ting Gong; Bo Cheng; Chao Ji; Donghua Cai Journal: Front Med (Lausanne) Date: 2022-04-18