| Literature DB >> 32009300 |
Bo-Youn Moon1, Jiung Jang1,2, Seong-Hee Kim1, Yeon-Hee Kim1, Hyun-Kyoung Lee, ByungJae So1, Choi-Kyu Park2, Kyoung-Ki Lee1.
Abstract
Canine parvovirus type 2 (CPV-2) is an aetiological agent that causes acute haemorrhagic enteritis and fatal myocarditis in dogs. Since CPV-2 first emerged in the late 1970s, its rapid evolution has resulted in three antigenic variants: CPV-2a, CPV-2b and CPV-2c. Here, we report, for the first time in Korea, two cases of CPV-2c infection in two dogs with severe diarrhoea. The complete open reading frame (4,269nt) of CPV-2, encoding both non-structural (NS) and structural (VP) proteins, was sequenced. Based on the amino acid Gln present at residue 426 of the VP2 gene, these strains were typed as CPV-2c, and were named Korea CPV-2c_1 and Korea CPV-2c_2. These strains shared 99.48% reciprocal nucleotide sequence identity and had the highest nucleotide identity (99.77%-99.34%) with Asian CPV strains isolated in China, Italy (found in a dog imported from Thailand), and Vietnam from 2013 to 2017. Phylogenetic analysis based on the non-structural (NS1) and capsid (VP2) genes revealed that Korean CPV-2c strains clustered closely to Asian CPV strains, and separately from strains isolated in Europe, South America and North America. Amino acid changes never reported before were observed in NS1 (Thr70Pro, Cys287Tyr), VP1 (Lys17Arg, Phe33Leu) and VP2 (Gln365His, Ala516Val). Additional observed mutations, including Phe267Tyr, Tyr324Ile and Gln370Arg, have been previously reported in the recent CPV-2c strains with Asian origins. These results suggest that the Korean CPV-2c strains were potentially introduced via neighbouring Asian countries.Entities:
Keywords: South Korea; canine parvovirus 2c; epidemiology; genetic characteristics
Mesh:
Substances:
Year: 2020 PMID: 32009300 PMCID: PMC7228216 DOI: 10.1111/tbed.13501
Source DB: PubMed Journal: Transbound Emerg Dis ISSN: 1865-1674 Impact factor: 4.521
Oligonucleotide primers used for CPV‐2 sequencing in this study
| Primer name | Sequence (5' to 3') | Location |
Product (bp) |
|---|---|---|---|
| CPV 1 F | CTTCTTGTCTTTGACAGAGTGAA | 224–246 | 1,198 |
| CPV 1 R | TGCTATAGCGTGACAAACTTTA | 1399–1420 | |
| CPV 2 F | ATCTTGCAAATTCTAGAACATGTCA | 1344–1368 | 843 |
| CPV 2 R | TTGCACGTCTTTGTGAGTAAC | 2165–2185 | |
| CPV 3 F | ACGTAGTGGACCTTGCACTGGAA | 2079–2101 | 776 |
| CPV 3 R | GATCCTGTAGCTCTTTCATTTCT | 2831–2853 | |
| CPV 4 F | AATCTTGCACCAATGAGTGA | 2774–2793 | 1,169 |
| CPV 4 R | TGACCATGTTGTCTACCAAATGCAT | 3918–3942 | |
| CPV 5 F | TATGAGACCAGCTGAGGTTGGTTA | 3775–3798 | 821 |
| CPV 5 R | AATTTTTCTAGGTGCTAGTTGATATGTAAT | 4566–4595 |
Nucleotide positions refer to the prototype CPV‐N (RefSeq sequence: NC_001539).
Nucleotide sequence similarity between Korea CPV‐2c strains and other CPV‐2 strains
| No. | Details | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
Korea CPV−2 | 1 | CPV−2c_1 Korea 2017 | ||||||||||||||||
| 2 | CPV−2c_2 Korea 2017 | 99.48 | ||||||||||||||||
|
Proto CPV−2 | 3 | CPV−2a Japan 1998 | 99.20 | 98.91 | ||||||||||||||
| 4 | CPV−2b USA 1986 | 99.20 | 98.91 | 99.60 | ||||||||||||||
| 5 | CPV−2c Italy 2001 | 99.22 | 98.98 | 99.60 | 99.67 | |||||||||||||
| Asian‐origin CPV−2 | 6 | CPV−2c China 2017 | 99.77 | 99.72 | 99.20 | 99.20 | 99.27 | |||||||||||
| 7 | CPV−2c Italy 2017 | 99.74 | 99.74 | 99.17 | 99.17 | 99.25 | 99.98 | |||||||||||
| 8 | CPV−2c Vietnam 2013 | 99.46 | 99.46 | 98.94 | 98.98 | 99.06 | 99.69 | 99.72 | ||||||||||
| 9 | CPV−2a China 2014 | 99.44 | 99.34 | 99.27 | 99.17 | 99.22 | 99.62 | 99.60 | 99.46 | |||||||||
| CPV−2c strains with other origins | 10 | CPV−2c Italy 2010 | 99.13 | 98.89 | 99.51 | 99.58 | 99.91 | 99.17 | 99.15 | 98.96 | 99.17 | |||||||
| 11 | CPV−2c France 2009 | 99.10 | 98.86 | 99.48 | 99.55 | 99.88 | 99.15 | 99.13 | 98.94 | 99.10 | 99.79 | |||||||
| 12 | CPV−2c Uruguay 2007 | 99.08 | 98.84 | 99.46 | 99.53 | 99.86 | 99.13 | 99.10 | 98.91 | 99.08 | 99.77 | 99.74 | ||||||
| 13 | CPV−2c Ecuador 2011 | 99.13 | 98.89 | 99.51 | 99.58 | 99.91 | 99.17 | 99.15 | 98.96 | 99.13 | 99.81 | 99.79 | 99.77 | |||||
| 14 | CPV−2c Argentina 2010 | 98.94 | 98.70 | 99.32 | 99.39 | 99.62 | 98.98 | 98.96 | 98.77 | 98.98 | 99.53 | 99.51 | 99.53 | 99.53 | ||||
| 15 | CPV−2c Brazil 2014 | 99.08 | 98.84 | 99.46 | 99.48 | 99.67 | 99.13 | 99.10 | 98.91 | 99.08 | 99.58 | 99.55 | 99.53 | 99.58 | 99.53 | |||
| 16 | CPV−2c Australia 2016 | 99.01 | 98.77 | 99.39 | 99.46 | 99.79 | 99.06 | 99.03 | 98.84 | 99.01 | 99.69 | 99.67 | 99.69 | 99.69 | 99.46 | 99.46 |
GenBank accession numbers of CPV‐2 strains; 1, MK306289; 2, MK306290; 3, D26079; 4, EU659120; 5, MF177239; 6, MG013488; 7, MF510157; 8, LC214969; 9, KR002800; 10, MF177240; 11, MF177227; 12, KM457109; 13, MF177263; 14, MF177249; 15, MF177255; 16, KU508691
Nucleotide and amino acid divergences in CPV‐2c strains from Korea
| Gene | NS | VP | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| VP1 | VP2 | |||||||||||||||||||
| Nucleotides | 163–165 | 208–210 | 403–405 | 859–861 | 1345–1347 | 1399–1401 | 49–51 | 97–99 | 352–354 | 475–477 | 799–801 | 970–972 | 1093–1095 | 1108–1110 | 1276–1278 | 1318–1320 | 1381–1383 | 1546–1548 | 1684–1686 | 1701–1704 |
| Amino acid | 55 | 70 | 135 | 287 | 449 | 467 | 17 | 33 | 118 | 159 | 267 | 324 | 365 | 370 | 426 | 440 | 461 | 516 | 562 | 568 |
| Korea CPV−2c | ||||||||||||||||||||
| CPV−2c_1 Korea 2017 | GAG | ACC | CAT | TGT | TTT | ATT | A |
| CCC | CA | TAT | ATT | CAA | CGA | GAA | ACA | CCA | G | GTA | GGT |
| (MK306289) | Glu | Thr | His | Cys | Phe | Ile |
|
| Pro | Gln | Tyr | Ile | Gln | Arg | Glu | Thr | Pro |
| Val | Gly |
| CPV−2c_2 Korea 2017 | GA |
| CA | T | TT | AT | AAG | TTT | CC | CAA | TAT | ATT | CA | CGA | GAA | ACA | CC | GCT | GT | GG |
| (MK306290) | Glu |
| His |
| Phe | Ile | Lys | Phe | Pro | Gln | Tyr | Ile |
| Arg | Glu | Thr | Pro | Ala | Val | Gly |
| Prototype CPV−2 | ||||||||||||||||||||
| CPV−2a Japan 1998 | GAG | ACC | CAT | TGT | TTT | ATT | AGG | TTT | CCA | CAA | TTT | TAT | CAA | CAA | AAT | ACA | CCA | GCT | GTA | GGT |
| (D26079) | Glu | Thr | His | Cys | Phe | Ile | Lys | Phe | Pro | Gln | Phe | Tyr | Gln | Gln | Asn | Thr | Pro | Ala | Val | Gly |
| CPV−2b USA 1986 | GAG | ACC | CAT | TGT | TTT | ATT | AGG | TTT | CCA | CAA | TTT | TAT | CAA | CAA | GAT | ACA | CCA | GCT | GTA | GGT |
| (EU659120) | Glu | Thr | His | Cys | Phe | Ile | Lys | Phe | Pro | Gln | Phe | Tyr | Gln | Gln | Asp | Thr | Pro | Ala | Val | Gly |
| CPV−2c Italy 2001 | GAG | ACC | CAT | TGT | TTT | ATT | AGG | TTT | CCA | CAA | TTT | TAT | CAA | CAA | GAA | ACA | CCA | GCT | GTA | GGT |
| (MF177239) | Glu | Thr | His | Cys | Phe | Ile | Lys | Phe | Pro | Gln | Phe | Tyr | Gln | Gln | Glu | Thr | Pro | Ala | Val | Gly |
| Recent Asia CPV−2 | ||||||||||||||||||||
| CPV−2c China 2017 | GAG | ACC | CAT | TGT | TTT | ATT | AGG | TTT | CCA | CAA | TAT | ATT | CAA | CGA | GAA | ACA | CCA | GCT | GTA | GGT |
| (MG013488) | Glu | Thr | His | Cys | Phe | Ile | Lys | Phe | Pro | Gln | Tyr | Ile | Gln | Arg | Glu | Thr | Pro | Ala | Val | Gly |
| CPV−2c Italy 2017 | GAG | ACC | CAT | TGT | TTT | ATT | AGG | TTT | CCA | CAA | TAT | ATT | CAA | CGA | GAA | ACA | CCA | GCT | GTA | GGT |
| (MF510157) | Glu | Thr | His | Cys | Phe | Ile | Lys | Phe | Pro | Gln | Tyr | Ile | Gln | Arg | Glu | Thr | Pro | Ala | Val | Gly |
| CPV−2c Vietnam 2013 | GAG | ACC | CAT | TGT | TTT | ATT | AGG | TTT | CCA | CAA | TAT | ATT | CAA | CGA | GAA | ACA | CCA | GCT | GTA | GGT |
| (LC214969) | Glu | Thr | His | Cys | Phe | Ile | Lys | Phe | Pro | Gln | Tyr | Ile | Gln | Arg | Glu | Thr | Pro | Ala | Val | Gly |
Bold character indicates the mutation of nucleotide and amino acid from Korean CPV‐2c strains.
Figure 1Maximum‐likelihood trees based on the complete NS1 (a) and VP2 (b) nucleotide sequences of canine parvovirus type 2 (CPV‐2). Scale bars indicate nucleotide substitutions per site. Bootstrap values at nodes are based on 1,000 replicates and bootstrap values greater than 70 are shown. CPV‐2 strain was shown as ‘CPV variants’, ‘ country’ ‘year of isolation’ and ‘accession number’ and Korean CPV‐2c strain obtained from this study was indicated by black dot marking (●)