Literature DB >> 31906958

MiR-182-5p and its target HOXA9 in non-small cell lung cancer: a clinical and in-silico exploration with the combination of RT-qPCR, miRNA-seq and miRNA-chip.

Li Gao1, Shi-Bai Yan2, Jie Yang3, Jin-Liang Kong4, Ke Shi1, Fu-Chao Ma2, Lin-Zhen Huang1, Jie Luo5, Shu-Ya Yin1, Rong-Quan He2, Xiao-Hua Hu6, Gang Chen7.   

Abstract

BACKGROUND: MiR-182-5p, a cancer-related microRNA (miRNA), modulates tumorigenesis and patient outcomes in various human malignances. This study interroted the clinicopathological significance and molecular mechanisms of miR-182-5p in non-small cell lung cancer (NSCLC).
METHODS: The clinical significance of miR-182-5p in NSCLC subtypes was determined based on an analysis of 124 samples (lung adenocarcinomas [LUADs], n = 101; lung squamous cell carcinomas [LUSCs], n = 23) obtained from NSCLC patients and paired noncancer tissues and an analysis of data obtained from public miRNA-seq database, miRNA-chip database, and the scientific literature. The NSCLC samples (n = 124) were analyzed using the real-time quantitative polymerase chain reaction (RT-qPCR). Potential targets of miR-182-5p were identified using lists generated by miRWalk v.2.0, a comprehensive atlas of predicted and validated targets of miRNA-target interactions. Molecular events of miR-182-5p in NSCLC were unveiled based on a functional analysis of candidate targets. The association of miR-182-5p with one of the candidate target genes, homeobox A9 (HOXA9), was validated using in-house RT-qPCR and dual-luciferase reporter assays.
RESULTS: The results of the in-house RT-qPCR assays analysis of data obtained from public miRNA-seq databases, miRNA-chip databases, and the scientific literature all supported upregulation of the expression level of miR-182-5p level in NSCLC. Moreover, the in-house RT-qPCR data supported the influence of upregulated miR-182-5p on malignant progression of NSCLC. In total, 774 prospective targets of miR-182-5p were identified. These targets were mainly clustered in pathways associated with biological processes, such as axonogenesis, axonal development, and Ras protein signal transduction, as well as pathways involved in axonal guidance, melanogenesis, and longevity regulation, in multiple species. Correlation analysis of the in-house RT-qPCR data and dual-luciferase reporter assays confirmed that HOXA9 was a direct target of miR-182-5p in NSCLC.
CONCLUSIONS: The miR-182-5p expression level was upregulated in NSCLC tissues. MiR-182-5p may exert oncogenic influence on NSCLC through regulating target genes such as HOXA9.

Entities:  

Keywords:  HOXA9; Non-small cell lung cancer; RT-qPCR; miR-182-5p; miRNA-chips; miRNA-seq

Year:  2020        PMID: 31906958      PMCID: PMC6945423          DOI: 10.1186/s12920-019-0648-7

Source DB:  PubMed          Journal:  BMC Med Genomics        ISSN: 1755-8794            Impact factor:   3.063


Background

According to data from the National Comprehensive Cancer Network, lung cancer (LC) is responsible for the majority of cancer-associated deaths worldwide [1]. There are two types of LC: non-small cell lung cancer (NSCLC) and small cell lung cancer [2]. Of these, NSLC is the most common and accounts for the majority cases of LC [1-8]. Although improvements in screening (i.e., diagnostic imaging and laboratory tests) and drug therapy have contributed greatly to NSCLC outcomes, the clinical outcome of NSCLC remains poor due to a lack of effective biomarkers for NSCLC [4]. At the time of diagnosis, most of patients have advanced stage disease because of atypical symptoms in the early stage of the disease [2]. Thus, NSCLC survival is poor, with 5-year survival lower than 20% [5]. Therefore, the development of novel screening and therapeutic strategies are of crucial importance for NSCLC patients. MicroRNAs (miRNAs) are small, noncoding RNAs that regulate gene expression by binding specifically to the complimentary sequence of target mRNAs in the 3′ untranslated region (3′-UTR), thereby silencing the translation process and accelerating the degradation of target mRNAs [5, 8–16]. A number of previous studies demonstrated that miRNAs played essential roles in various cancers, including LC, via their effects on various biological events, such as differentiation, apoptosis, and proliferation, at the post-transcriptional level [9, 17–24]. Studies also reported that the miRNA miR-182-5p participated in the occurrence and progression of various human cancers [25-30]. In previous work, we demonstrated a tumor-promoting effect of upregulated miR-182-5p in lung squamous cell carcinomas (LUSCs) [31]. The aim of the present study was to examine the clinicopathological value and molecular mechanisms of miR-182-5p in non-small cell lung cancer (NSCLC). With this aim in mind, we examined miR-182-5p overexpression patterns in lung adenocarcinomas (LUADs) and NSCLC. We expect that the current study will facilitate understanding of the role of miR-182-5p in the pathogenesis of NSCLC and its potential value as a marker of NSCLC subtypes.

Methods

Tissue collection from NSCLC patients

NSCLC tissue samples and paired noncancer tissue samples were obtained from 124 NSCLS patients (LUADs, n = 101; LUSCs, n = 23) undergoing surgery at the First Affiliated Hospital of Guangxi Medical University between January 2012 and February 2014. All the NSCLC cases were diagnosed by two independent pathologists with no involvement in the study. There were 74 males and 50 females in this study. The study was approved by the ethics committee of the First Affiliated Hospital of Guangxi Medical University, and written informed consent was obtained from all the patients. All 124 NSCLC tissues were formalin fixed and paraffin embedded for subsequent experiments.

In-house real-time quantitative polymerase chain reaction (RT-qPCR)

Isolation and normalization of RNA, and the RT-qPCR were carried out as previously described [31-38]. RNU6B was selected as an endogenous control and reference gene of miR-182-5p [34]. The sequences of miR-182-5p and RNU6B were as follows: miR-182-5p: UUUGGCAAUGGUAGAACUCACACU (Cat. no. 4427975–002334); RNU6B: CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU (Cat. no. 4427975–000490). The relative miR-182-5p expression level was computed using the method of 2-Δcq. The statistical analysis for the RT-qPCR was as described previously [39].

MiR-182-5p expression in NSCLC using miRNA-seq data

Level 3 IlluminaHiSeq miRNA-seq data on miR-182-5p expression in NSCLC were obtained from recomputed and normalized the cancer genome atlas (TCGA) data in UCSC Xena (https://xena.ucsc.edu/). Alterations in the expression of miR-182-5p in LUADs, non-LUADs, NSCLC, and non-NSCLC, in addition to the distribution of miR-182-5p in groups of different clinical variables, were calculated to determine the clinical significance of miR-182-5p. The statistical analysis of the miRNA-seq data has been described in detail elsewhere [39].

Analysis of miR-182-5p expression in NSCLC based on data in public miRNA-chip databases

The gene expression omnibus (GEO) database was searched for data deposited up to 12 April 2019. The search terms used were as follows: (cancer OR carcinoma OR adenocarcinoma OR tumour OR tumor OR malignanc* OR neoplas*) AND (lung OR pulmonary OR respiratory OR respiration OR aspiration OR bronchi OR bronchioles OR alveoli OR pneumocytes OR “air way”). All miRNA-chips meeting the listed inclusion criteria were considered eligible for inclusion in the study: (1) the experimental subjects were humans, and (2) miR-182-5p expression was reported for both NSCLC and healthy lung tissues. Only studies where the NSCLC sample size exceeded three and included paired healthy tissues were included. The data extraction and statistical analysis of miR-182-5p expression have been described in detail elsewhere [40].

Search of the scientific literature for data on miR-182-5p expression in NSCLC

We searched the literature for information of miR-182-5p differential expression in NSCLC and noncancer lung tissues. The following databases were searched using the keywords: (cancer OR carcinoma OR adenocarcinoma OR tumour OR tumor OR malignanc* OR neoplas*) AND (Lung OR pulmonary OR respiratory OR respiration OR aspiration OR bronchi OR bronchioles OR alveoli OR pneumocytes OR “air way”) AND (miR-182 OR miRNA-182 OR microRNA-182 OR miR182 OR miRNA182 OR microRNA182 OR “miR 182” OR “miRNA 182” OR “microRNA 182”OR miR-182-5p OR miRNA-182-5p OR microRNA-182-5p): PubMed, Wiley Online Library, EBSCO, Cochrane Central Register of Controlled Trials, Web of Science, Google Scholar, Ovid, EMBASE, and LILACS. Studies that reported expression data for miR-182-5p in NSCLC subtypes and paired noncancer samples were included in a meta-analysis. The meta-analysis included all the in-house RT-qPCR, miRNA-seq, miRNA-chip, and literature data. Pooling of the standard mean difference (SMD) and creation of summary receiver operating characteristic (SROC) curves from all the included studies was done to determine the differential expression miR-182-5p and its potential utility in distinguishing NSCLC and noncancer cases. Details on the data processing and statistical analysis in the meta-analysis have been described in previous studies [40, 41].

Prediction of target genes

An online program, MiRWalk v.2.0, which incorporates 12 prediction platforms (miRanda, Microt4, miRWalk, miRDB, miRbridge, miRMap, Pictar2, miRNAMap, PITA, RNAhybrid, RNA22, and Targetscan), was used for predicting the targets of miR-182-5p. Predicted genes that appeared in at least eight of the 12 prediction platforms were regarded as candidate targets of miR-182-5p.

Functional annotation of candidate target genes of miR-182-5p and construction of a protein–protein interaction (PPI) network

Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were conducted using the ClusterProfiler package in R software v.3.5.2 to explore the enrichment of candidate target genes in biological process, cellular component, and molecular function pathways. Items with a p < 0.05 were considered statistically significant. The top 15 significant biological process, cellular component, and molecular function terms, as well as the top 10 significant KEGG pathway terms, were visualized as a bubble plot and chord plot using the GOplot package of R software v.3.5.2. A PPI network was subsequently built using the Search Tool for the Retrieval of Interacting Genes to illustrate the interactions between target genes.

Validation of miR-182-5p targeting of HOXA9

In a previous study, we detected the expression level of HOXA9 in the same cohort of NSCLC patients using the RT-qPCR [42]. The primers for HOXA9 and the internal control: glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were as follows: 5′-GCTGAGAATGAGAGCGGC-3′ (HOXA9 forward); 5′-CAGTTCCAGGGTCTGGTGTT-3′ (HOXA9 reverse); 5-′TGCACCACCAACTGCTTA-3′ (GAPDH forward); and 5′-GGATGCAGGGATGATGTTC-3′ (GAPDH reverse). The student’s paired t test in SPSS v.22.0 was performed to compare the expression levels of HOXA9 and miR-182-5p. The correlation between HOXA9 and miR-182-5p expression was assessed using Pearson’s correlation test in GraphpadPrism v.7.0. Data on predictive binding sites between HOXA9 and miR-182-5p were obtained from TargetScanHuman v.7.2. A dual luciferase reporter assay was performed to validate the direct target binding between HOXA9 and miR-182-5p. The 3’UTR of HOXA9 (wild type or mutation type) comprising putative miR-182-5p binding sites was cloned into a psiCHECK-2 luciferase reporter vector (Promega, USA) to generate psiCHECK-HOXA9 3′-UTRs or psiCHECK-HOXA9-mut 3′UTRs. HEK-293 T cells were co-transfected with an miR-182-5p mimic, a negative mimic control, and a reporter vector of the psiCHECK-HOXA9 3′UTR or psiCHECK-HOXA9-mut 3′UTR. After incubation for 27 h, the luciferase activity was measured using dual luciferase assay (Promega, USA) according to the manufacturer’s protocol. Luciferase activity was inferred based on the ratios of Renilla and firefly luciferase activity. Each experiment was repeated three times.

Results

Evaluation of the clinicopathological significance of miR-182-5p in NSCLC

Analysis of RT-qPCR data

The analysis of the RT-qPCR data demonstrated that miR-182-5p was significantly upregulated in LUAD tissues as compared with that in paired non-LUAD lung tissues (P < 0.001, Table 1, Additional file 1: Fig. S1). In general, miR-182-5p expression level was markedly higher in the majority of NSCLC tissues than in paired noncancer tissues (P < 0.001, Table 2, Additional file 2: Fig. S2). Overexpression of miR-182-5p in LUAD and NSCLC was strongly associated with clinical parameters including tumor size, TNM stage, and lymph node metastasis (P < 0.05, Tables 1 and 2). As shown by the ROC curve in Additional files 3 and 4: Fig. S3 and S4, miR-182-5p performed moderately well in differentiating LUAD from noncancer lung tissues and better in differentiating NSCLC tissues from noncancer lung tissues (area under the curve [AUC] = 0.68 and 0.82, respectively). Kaplan–Meier survival curves revealed insignificant difference in the survival outcomes of LUAD and NSCLC patients with low or high miR-182-5p expression (data not shown).
Table 1

MiR-182-5p expression in LUAD data from RT-qPCR

Clinicopathological parametersnRelevant expression of miR-182-5p (2−ΔCq)
Mean ± SDt/F-valuep-value
TissueLUAD10130.371 ± 5.47514.035< 0.001*
Noncancerous10122.908 ± 3.728
GenderMale5629.923 ± 5.5671.1500.253
Female4528.609 ± 5.879
Age (years)< 604130.642 ± 5.2381.9640.053
≥606028.446 ± 5.899
SmokeNo2631.159 ± 5.4350.6020.550
Yes1830.138 ± 5.671
Tumor size≤3 cm5325.041 ± 4.651−13.541< 0.001*
> 3 cm4834.082 ± 1.343
Vascular invasionNo7028.986 ± 5.839−0.9270.356
Yes3130.130 ± 5.441
TNMI-II4426.730 ± 5.442−4.377< 0.001*
III-IV5731.350 ± 5.114
Lymph node metastasisNo4526.478 ± 5.243−5.023< 0.001*
Yes5631.635 ± 5.036
Pathological gradingI1727.642 ± 5.8630.915b0.404
II6129.753 ± 5.713
III2329.489 ± 5.641

LUAD: lung adenocarcinoma; SD: standard deviation

* The results were statistically significant (P < 0.05)

Table 2

MiR-182-5p expression in NSCLC data from RT-qPCR

Clinicopathological parametersnRelevant expression of miR-182-5p (2−ΔCq)
Mean ± SDt/F-valuep-value
TissueNSCLC12429.615 ± 5.61613.979< 0.001*
Noncancerous12422.859 ± 3.669
GenderMale7430.144 ± 5.4971.2780.204
Female5028.833 ± 5.755
Age (years)< 605630.913 ± 5.0522.4130.017*
≥606828.547 ± 5.864
SmokeNo3831.184 ± 5.1850.7200.474
Yes2930.237 ± 5.530
Histological typeAdenocarcinoma10129.337 ± 5.717−1.2450.221
Squamous carcinoma2330.836 ± 5.086
Tumor size≤3 cm6024.995 ± 4.570−14.353< 0.001*
> 3 cm6433.947 ± 1.620
Vascular invasionNo9029.456 ± 5.720−0.5120.609
Yes3430.037 ± 5.391
TNMI-II5427.131 ± 5.424−4.632< 0.001*
III-IV7031.532 ± 5.007
Lymph node metastasisNo5626.621 ± 5.128−6.095< 0.001*
Yes6832.081 ± 4.759
Pathological gradingI1727.642 ± 5.8631.246a0.291
II7729.853 ± 5.721
III3030.124 ± 5.131

NSCLC: non-small cell lung cancer; SD: standard deviation

a One-way analysis of variance (ANOVA) was performed

* The results were statistically significant (P < 0.05) 

MiR-182-5p expression in LUAD data from RT-qPCR LUAD: lung adenocarcinoma; SD: standard deviation * The results were statistically significant (P < 0.05) MiR-182-5p expression in NSCLC data from RT-qPCR NSCLC: non-small cell lung cancer; SD: standard deviation a One-way analysis of variance (ANOVA) was performed * The results were statistically significant (P < 0.05)

Analysis of miRNA-seq data

In total, miRNA-seq data were obtained for 784 NSCLC tissues (LUAD, n = 448; LUSC, n = 336) and 89 noncancer tissues. The clinicopathological significance of miR-182-5p in LUAD and NSCLC is summarized in Table 3 and Table 4, respectively. In both LUAD and NSCLC tissues, miR-182-5p expression was markedly higher as compared with that in noncancer tissues (P < 0.001, Additional files 1 and 2: Fig. S1 and S2, Tables 3 and 4). As shown by the ROC curves in Additional files 3 and 4: Fig. S3 and S4, miR-182-5p expression appeared to distinguish LUAD and NSCLC from noncancer tissues (AUC = 0.98 and AUC = 0.96, respectively). The Kaplan–Meier curves revealed no significant relationship between miR-182-5p expression and survival of NSCLC patients and LUAD patients (data not shown). Thus, the prognostic role of miR-182-5p in NSCLC remains unclear and needs to be studied in future work.
Table 3

MiR-182-5p expression in LUAD from miRNA-seq data

CharacteristicsnRelevant expression of miR-182-5p (log2x)
Mean ± SDt/F-valueP-value
TissueLUAD44814.273 ± 0.94717.368< 0.001*
Noncancerous4511.644 ± 1.160
GenderMale20914.259 ± 0.902−0.3060.760
Female23914.286 ± 0.987
Age(years)≤503314.295 ± 1.2050.1750.862
> 5039614.257 ± 0.932
TT1 + T238814.294 ± 0.9540.6790.497
T3 + T45714.203 ± 0.871
NodesNo29314.252 ± 0.966−1.0250.306
Yes14614.349 ± 0.892
MetastasisNo28514.326 ± 0.898−0.3660.715
Yes1914.404 ± 1.027
Pathologic stageI-II35114.249 ± 0.958−0.8100.419
III-IV9214.340 ± 0.918
Anatomic neoplasm subdivisionL-Lower7014.229 ± 0.8250.512a0.727
L-Upper10814.206 ± 0.998
R-Lower8514.214 ± 0.940
R-Middle1814.281 ± 0.789
R-Uppr15514.351 ± 0.986
Tumor locationPeripheral11314.309 ± 0.940−0.7430.459
Central5414.429 ± 1.051

LUAD: lung adenocarcinoma; SD: standard deviation

a One-way analysis of variance (ANOVA) was performed

* The results were statistically significant (P < 0.05)

Table 4

MiR-182-5p expression in NSCLC from miRNA-seq data

Clinicopathological featurenRelevant expression of miR-182-5p (log2x)
Mean ± SDt/F-valueP-value
TissueLung cancer78414.332 ± 1.04221.214< 0.001*
Noncancerous8911.962 ± 0.994
Histological typeAdenocarcinoma44814.273 ± 0.947−1.7850.075
Squamous carcinoma33614.411 ± 1.154
GenderMale46014.367 ± 1.0421.1370.256
Female32414.282 ± 1.042
Age(years)≤6021314.396 ± 1.0401.1690.243
> 6054614.297 ± 1.055
TT1 + T265414.358 ± 1.0381.2420.214
T3 + T412714.232 ± 1.051
NodesNo50914.315 ± 1.050−1.1820.238
Yes26014.408 ± 1.006
MetastasisNo54014.376 ± 1.0410.3280.743
Yes2114.302 ± 1.029
Pathologic stageI-II63114.320 ± 1.063−0.4810.631
III-IV14514.366 ± 0.962
Anatomic organ subdivisionL-Lower11214.285 ± 1.0290.662a0.618
L-Upper19814.240 ± 0.995
R-Lower16014.390 ± 1.073
R-Middle2914.416 ± 1.008
R-Uppr24914.359 ± 1.026
Tumor locationPeripheral18714.342 ± 1.013−0.2100.834
Central16214.366 ± 1.130

NSCLC: non-small cell lung cancer; SD: standard deviation

a One-way analysis of variance (ANOVA) was performed

* The results were statistically significant (P < 0.05)

MiR-182-5p expression in LUAD from miRNA-seq data LUAD: lung adenocarcinoma; SD: standard deviation a One-way analysis of variance (ANOVA) was performed * The results were statistically significant (P < 0.05) MiR-182-5p expression in NSCLC from miRNA-seq data NSCLC: non-small cell lung cancer; SD: standard deviation a One-way analysis of variance (ANOVA) was performed * The results were statistically significant (P < 0.05)

Analysis of miRNA-chip data

The initial search of the GEO database revealed 3204 studies. Of these, 248 studies were excluded after screening the titles and abstracts. The final analysis included data of 25 eligible miRNA-chips on 1656 NSCLC samples (LUAD, n = 350) and 948 noncancer samples. Several of the datasets that contained information on miR-182-5p expression in LUSC (GSE29248, GSE47525, GSE19945, GSE51853, and GSE74190) have been mined in previous work [31]. The characteristics of all the included miRNA-chip data are listed in Table 5. The differential expression of miR-182-5p and the discriminatory ability of miR-182-5p in distinguishing LUAD and NSCLC tissues from noncancer tissues are displayed in Additional file 1-6: Fig. S1–6. The forest plots in Figs. 1 and 2 support a noticeable increase in the miR-182-5p level in LUAD and NSCLC as compared with the level in noncancer lung samples (SMD = 0.81, 95% confidence interval [CI] = 0.59–1.04; SMD = 0.68, 95% CI = 0.59–0.77).
Table 5

Characteristics of included GEO miRNA-chips

First authorExperiment typeSample typePlatformCancer (N)Cancer (M)Cancer (SD)Noncancer (N)Noncancer (M)Noncancer (SD)TPFPFNTN
GSE14936Seike MNon-coding RNA profiling by arraytissueGPL8879107.7630.85098.1370.8198722
GSE15008Tan XNon-coding RNA profiling by arraytissueGPL200918711.4011.2551889.6970.867441143187
GSE16512Lodes MJNon-coding RNA profiling by arrayserumGPL86863−0.0240.03114−0.3380.2311213
GSE17681Keller AmiRNA ProfilingserumGPL90401712.6520.7561912.1740.753711018
GSE18692APuisségur MPNon-coding RNA profiling by arraytissueGPL471770.4580.30470.2510.1535126
GSE18692BPuisségur MPNon-coding RNA profiling by arraytissueGPL4718130.2880.343130.4030.34101132
GSE19945Ohba TNon-coding RNA profiling by arraytissueGPL994820−0.3251.7818−2.7990.55415058
GSE24709Andreas KellerNon-coding RNA profiling by arrayserumGPL90402812.2530.5321911.6260.7751701119
GSE27486Santosh Kumar PatnaikNon-coding RNA profiling by arrayserumGPL11432225.6800.428235.7310.64611101213
GSE27705Chris FentonNon-coding RNA profiling by arraytissueGPL11432200.1060.93410−1.1870.19619119
GSE29248lina maNon-coding RNA profiling by arraytissueGPL8179612.6430.704611.0992.1713036
GSE31568Andreas KellerNon-coding RNA profiling by arrayserumGPL90403212.1730.6077011.8470.9721252065
GSE33045Sonia Molina-PineloExpression profiling by RT-PCRserumGPL139871212.6181.642813.2911.22312701
GSE36681Jin Sung JangNon-coding RNA profiling by arraytissueGPL817910312.1511.21510311.2821.23216187102
GSE40738Santosh Kumar PatnaikNon-coding RNA profiling by arrayserumGPL16016815.2250.581565.0250.675817355
GSE46729Zongli XuNon-coding RNA profiling by arrayserumGPL8786244.5300.227244.4230.215511923
GSE47525Maikel WoutersNon-coding RNA profiling by arraytissueGPL17222184.9270.716144.7270.412711113
GSE48414Maria Moksnes BjaanæsNon-coding RNA profiling by arraytissueGPL16770154−0.3642.54720−3.5482.16612003420
GSE51853Takashi TakahashiNon-coding RNA profiling by arraytissueGPL73411241.1771.0455−1.4590.381120045
GSE53882Heng-Ying PuExpression profiling by arraytissueGPL181303971.2450.4461511.1720.428111386150
GSE56036Satoshi KondoNon-coding RNA profiling by arraytissueGPL15446286.3971.319274.1660.663251326
GSE61741Andreas KellerNon-coding RNA profiling by arrayserumGPL90407212.3420.6569412.3020.51426254669
GSE68951Christina BackesNon-coding RNA profiling by arrayserumGPL167702031.2250.336121.1490.14492111111
GSE74190Lu ShaohuaNon-coding RNA profiling by arraytissueGPL19622660.7611.65044−3.4042.5683613043
GSE93300qu liliNon-coding RNA profiling by arraytissueGPL215769−6.0440.9384−8.1870.8858014

Note: N: number; M: median; SD: standard deviation; TP: true positivity; FP: false positivity; FN: false negativity; TN: true negativity

Fig. 1

Meta-analysis of miRNA-chip data for LUAD. a. Forest plot for overall SMD; b. Subgroup analysis; c. Funnel plot of publication bias; d. Sensitivity analysis

Fig. 2

Meta-analysis of miRNA-chip data for NSCLC. a. Forest plot for overall SMD; b. Subgroup analysis; c. Funnel plot of publication bias; d. Sensitivity analysis

Characteristics of included GEO miRNA-chips Note: N: number; M: median; SD: standard deviation; TP: true positivity; FP: false positivity; FN: false negativity; TN: true negativity Meta-analysis of miRNA-chip data for LUAD. a. Forest plot for overall SMD; b. Subgroup analysis; c. Funnel plot of publication bias; d. Sensitivity analysis Meta-analysis of miRNA-chip data for NSCLC. a. Forest plot for overall SMD; b. Subgroup analysis; c. Funnel plot of publication bias; d. Sensitivity analysis Due to obvious heterogeneity among individual studies (I2 = 82.8%, P < 0.001; I2 = 89.2%, P < 0.001), random-effect models were applied to merge the estimates. A subgroup analysis based on the source of the samples was employed to determine the origin of the heterogeneity. The pooled SMD of miR-182-5p expression in LUAD serum and tissue samples was 0.11 (− 0.20–0.43) and 1.55 (1.23–1.88), respectively (Fig. 1). For NSCLC, the pooled SMD of miR-182-5p expression in NSCLC serum and tissue samples was 0.29 (0.13–0.45) and 0.88 (0.77–0.99), respectively, suggesting that upregulation of miR-182-5p expression was more obvious in the tissue samples than in the serum samples (Fig. 2). A subsequent sensitivity analysis and test for publication bias reported no eccentric study and no publication bias (Figs. 1 and 2). SROC curves accompanied by forest plots of the sensitivity, specificity, positive likelihood ratio, and negative likelihood ratio for NSCLC suggested that miR-182-5p expression in tissue better discriminated cancerous versus noncancerous tissue than miR-182-5p expression in serum (AUC = 0.93 and AUC = 0.69, respectively; Figs. 3 and 4).
Fig. 3

The distinguishing ability of miR-182-5p in NSCLC tissues based on data from miRNA-chips. a. SROC curves; b. Forest plot for sensitivity and specificity; c. Summary of positive likelihood ratio and negative likelihood ratio

Fig. 4

The distinguishing value of miR-182-5p in NSCLC serum based on data from miRNA-chips. a. SROC curves; b. Forest plot for sensitivity and specificity; c. Summary of positive likelihood ratio and negative likelihood ratio

The distinguishing ability of miR-182-5p in NSCLC tissues based on data from miRNA-chips. a. SROC curves; b. Forest plot for sensitivity and specificity; c. Summary of positive likelihood ratio and negative likelihood ratio The distinguishing value of miR-182-5p in NSCLC serum based on data from miRNA-chips. a. SROC curves; b. Forest plot for sensitivity and specificity; c. Summary of positive likelihood ratio and negative likelihood ratio

Results of the meta-analysis incorporating in-house RT-qPCR data, miRNA-seq data and miRNA-chip data

Based on the inclusion and exclusion criteria for the literature search, no studies were eligible for inclusion in the meta-analysis. Thus, the meta-analysis included 2564 NSCLC samples (LUAD, n = 899) and 1161 noncancer samples obtained from the in-house RT-qPCR, miRNA-seq, and miRNA-chip data analyses. The results of this comprehensive meta-analysis were consistent with those of the GEO meta-analysis, which confirmed upregulation of miR-182-5p in NSCLC tissues (SMD = 0.89 (0.55–1.22) Figs. 6). Upregulation of miR-182-5p expression was more apparent in the tissue samples than in the serum samples, and miR-182-5p expression in the tissue samples had stronger discriminating power in terms of cancer versus noncancer than miR-182-5p expression did in serum samples (Figs. 3, 4, 5, 6 and 7).
Fig. 6

The comprehensive meta-analysis for miR-182-5p expression in NSCLC. a. Forest plot for overall SMD; b. Subgroup analysis; c. Funnel plot of publication bias; d. Sensitivity analysis

Fig. 5

The comprehensive meta-analysis for miR-182-5p expression in LUAD. a. Forest plot for overall SMD; b. Subgroup analysis; c. Funnel plot of publication bias; d. Sensitivity analysis

Fig. 7

The distinguishing power of miR-182-5p in NSCLC tissues based on data from all studies. a. SROC curves; b. Forest plot for sensitivity; c. Forest plot for specificity; d. Summary of diagnostic scores

The comprehensive meta-analysis for miR-182-5p expression in LUAD. a. Forest plot for overall SMD; b. Subgroup analysis; c. Funnel plot of publication bias; d. Sensitivity analysis The comprehensive meta-analysis for miR-182-5p expression in NSCLC. a. Forest plot for overall SMD; b. Subgroup analysis; c. Funnel plot of publication bias; d. Sensitivity analysis The distinguishing power of miR-182-5p in NSCLC tissues based on data from all studies. a. SROC curves; b. Forest plot for sensitivity; c. Forest plot for specificity; d. Summary of diagnostic scores

Molecular mechanism of miR-182-5p in NSCLC

Functional annotation of candidate target genes in a PPI network

In total, 774 genes were identified as candidate target genes in eight of the 12 prediction platforms (Additional file 7). As shown in Fig. 8 and Table 6, these candidate target genes were significantly enriched in biological processes, such as axonogenesis, axonal development, and Ras protein signal transduction. According to the chord plot in Fig. 8, these target genes appeared to mainly participate in pathways involved in axonal guidance, melanogenesis, and longevity regulation in multiple species. The complicated interactions between the candidate target genes were illustrated in a PPI network (Fig. 9).
Fig. 8

Functional enrichment analysis for candidate target genes of miR-182-5p. a. Bubble plot for gene ontology enrichment; b. Chord plot for Kyoto Encyclopedia of Genes and Genomes pathway analysis

Table 6

Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of candidate target genes of miR-182-5p

CategoryItemCountP-value
GO-BPaxonogenesis46< 0.001
GO-BPaxon development48< 0.001
GO-BPRas protein signal transduction45< 0.001
GO-BPeye development37< 0.001
GO-BPmesenchyme development30< 0.001
GO-CCcell leading edge37< 0.001
GO-CCactin cytoskeleton400.002
GO-CCcortical cytoskeleton150.002
GO-CClamellipodium210.002
GO-CCcell cortex280.002
GO-MFtranscription factor activity, RNA polymerase II proximal promoter sequence-specific DNA binding41< 0.001
GO-MFtranscriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific DNA binding38< 0.001
GO-MFtranscriptional activator activity, RNA polymerase II proximal promoter sequence-specific DNA binding28< 0.001
GO-MFproximal promoter sequence-specific DNA binding37< 0.001
GO-MFnucleoside-triphosphatase regulator activity31< 0.001
KEGGAxon guidance21< 0.001
KEGGMelanogenesis15< 0.001
KEGGLongevity regulating pathway - multiple species11< 0.001
KEGGParathyroid hormone synthesis, secretion and action14< 0.001
KEGGGlutamatergic synapse14< 0.001

Note: BP: biological process; CC: cellular component; MF: molecular function

Fig. 9

PPI network for candidate target genes of miR-182-5p. Nodes and strings in the network represented target genes and interactions between target genes

Functional enrichment analysis for candidate target genes of miR-182-5p. a. Bubble plot for gene ontology enrichment; b. Chord plot for Kyoto Encyclopedia of Genes and Genomes pathway analysis Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of candidate target genes of miR-182-5p Note: BP: biological process; CC: cellular component; MF: molecular function PPI network for candidate target genes of miR-182-5p. Nodes and strings in the network represented target genes and interactions between target genes

Validation of miR-182-5p targeting of HOXA9

Among the candidate target genes, we selected HOXA9 and studied the relationship between it and miR-182-5p. As expected, HOXA9 was downregulated in 101 LUAD tissue samples and all 125 NSCLC tissue samples, as shown by the RT-qPCR data (P < 0.001, Figs. 10A and C). Importantly, miR-182-5p expression was negatively correlated with HOXA9 expression in 101 LUAD cases and 125 NSCLC cases (r = − 0.235, r = − 0.247, P < 0.001, Figs. 10B and D). The predictive binding sites for miR-182-5p in the 3′-UTR of HOXA9 mRNA were imported from TargetScanHuman v.7.2. (Fig. 10E). According to a luciferase reporter assay, HEK-293 T cells co-transfected with psiCHECK-2/HOXA9 3′-UTR and miR-182-5p mimics showed significantly reduced luciferase activity as compared with that in a control group (P < 0.01, Fig. 10E).
Fig. 10

Validation of the targeting regulatory relationship between HOXA9 and miR-182-5p. a. Differential expression of HOXA9 in LUAD and noncancer tissues from RT-qPCR data; b. Correlation analysis based on in-house RT-qPCR data for miR-182-5p and HOXA9 expression in LUAD; c. Differential expression of HOXA9 in NSCLC and noncancer tissues from RT-qPCR data; d. Correlation analysis based on in-house RT-qPCR data for miR-182-5p and HOXA9 expression in NSCLC; e. Dual-luciferase reporter assay

Validation of the targeting regulatory relationship between HOXA9 and miR-182-5p. a. Differential expression of HOXA9 in LUAD and noncancer tissues from RT-qPCR data; b. Correlation analysis based on in-house RT-qPCR data for miR-182-5p and HOXA9 expression in LUAD; c. Differential expression of HOXA9 in NSCLC and noncancer tissues from RT-qPCR data; d. Correlation analysis based on in-house RT-qPCR data for miR-182-5p and HOXA9 expression in NSCLC; e. Dual-luciferase reporter assay

Discussion

MiRNAs are important in the occurrence and development of LC [43-48]. Recent studies reported that dysregulation of the expression of multiple miRNAs, including miR-182-5p, was significantly correlated with tumorigenesis of LC [34]. Although several studies have demonstrated the oncogenic effect of miR-182-5p in NSCLC [49-52], interactions between miR-182-5p and target genes in NSCLC remained unclear. In particular, the molecular mechanism of miR-182-5p in NSCLC was unclear. We previously demonstrated the oncogenic consequences of miR-182-5p in LUSCs through a combinatory analysis of data from RT-qPCR assays of 23 samples obtained from LUSC patients treated in our hospital, miRNA-seq data, and miRNA-chip data. We hypothesized that the expression pattern of miR-182-5p was similar in all the subtypes of NSCLC. In the present study, miR-182-5p was overexpressed in LUADs according to data from RT-qPCR assays of 124 samples obtained from NSCLC patients treated in our hospital, miRNA-seq data, and miRNA-chip data. Thus, we investigated the clinicopathological significance of miR-182-5p in NSCLC using in-house RT-qPCR data, miRNA-seq data, miRNA-chip data, and data in the scientific literature to explore the underlying molecular mechanism via a functional analysis of target genes. The aforementioned data supported marked upregulation of miR-182-5p in NSCLC. Furthermore, the results of the RT-qPCR assays supported the influence of upregulated miR-182-5p on malignant clinical progression of NSCLC, which was consistent with the findings of previous studies [49-52]. It should be noted that there were some contradictions between the results of the RT-qPCR assays and those of the miRNA-seq data analysis. The discord might stem from different sources of patient cohorts and methods for calculating miR-182-5p expression. The expression of miR-182-5p in the NSCLC samples analyzed using the in-house RT-qPCR was calculated based on the 2-Δcq algorithm In contrast, miR-182-5p expression in the miRNA-seq data was log2 (total_ reads per million + 1) transformed in IlluminaHiSeq_miRNASeq platform. Nevertheless, miR-182-5p was upregulated in both the LUAD and NSCLC cohorts according to the miRNA-seq data, and miR-182-5p exhibited a trend toward elevated expression in samples from patients with malignant clinical progression of NSCLC, which was in agreement with the overall results. The SROC curves generated from all the datasets suggested that miR-182-5p could differentiate between LUAD or NSCLC and noncancer lung tissues. We believe that the large number of LC samples (NSCLC, N = 2564; non cancer, N = 1161) included in the present study support the findings. To yield a deeper understanding of the molecular basis of the role of miR-182-5p in the carcinogenesis of NSCLC, we carried out functional annotations for candidate target genes and created a PPI network. The results indicated that miR-182-5p may exert an oncogenic influence on NSCLC via involvement in various biological processes, such as axonogenesis, axonal development, and Ras protein signal transduction, as well as in pathways including axonal guidance, melanogenesis, and longevity regulation in multiple species. The intricate regulatory network between the candidate target genes in the PPI network indicated that cooperation or antagonism between target genes may constitute an important link in the course of NSCLC. Among the candidate target genes, HOXA9, a member of the HOX gene family, encodes a series of transcription factors with critical roles in cancer [53]. Previous research showed that HOXA9 had oncogenic functions in hematologic cancers and anticancer effects in breast cancer and NSCLC [54, 55]. In this study, to shed light on the regulatory relationship between miR-182-5p and HOXA9, we studied the expression level of HOXA9 in NSCLC and verified the relationships between miR-182-5p and HOXA9 through a correlation analysis and dual-luciferase reporter assay. The results showed that upregulation of miR-182-5p in LUAD or NSCLC was significantly correlated with downregulation of HOXA9 in LUAD or NSCLC. The direct regulatory association between miR-182-5p and HOXA9 was confirmed by the dual-luciferase reporter assay. Based on these findings, we conclude that miR-182-5p may affect the initiation and development of NSCLC by targeting HOXA9 to diminish the tumor-inhibitory effect of HOXA9 on NSCLC. Several limitations of this study should be acknowledged. First, we did not validate the oncogenic effect of miR-182-5p on biological events of NSCLC through in vitro or in vivo experiments. Second, this study focused on the clinicopathological significance of miR-182-5p and the miR-182-5p-centered molecular mechanism in NSCLC. Alterations in the expression of various genes, such as EGFR, ALK, ROS1, KRAS, and BRAF, play essential roles in NSCLC, and these genes serve as targets of chemotherapy [56]. We did not explore the interactions between miR-182-5p and these genes in NSCLC. Third, the diagnostic value of miR-182-5p in serum was not verified in a large clinical NSCLC sample. Exosomal miRNAs have potential as diagnostic biomarkers for cancers because of their stability, nondegradability, and ease of detection [57]. The diagnostic value of exosomal miR-182-5p in NSCLC was not studied in current work.

Conclusions

In conclusion, the oncogenic role of miR-182-5p in NSCLC was confirmed by comprehensively analyzing data obtained from RT-qPCR assays, miRNA-seq and miRNA-chip database. Multiple target genes, including HOXA9, may play a role in the molecular mechanism of HOXA9 in NSCLC. Additional file 1: Figure S1. Differential expression of miR-182-5p in LUAD and noncancer lung tissues based on data from in-house RT-qPCR, miRNA-seq and miRNA-chips. The distribution of miR-182-5p in LUAD and noncancer lung tissues was illustrated in the color of blue and red, respectively. A: GSE19945; B: GSE27486; C: GSE29248; D: GSE33045; E: GSE40738; F: GSE47525; G: GSE48414; H: GSE56036; I: GSE93300; J: GSE51853; K: in-house RT-qPCR; L: miRNA-seq Additional file 2: Figure S2. Differential expression of miR-182-5p in NSCLC and noncancer lung tissues based on data from 9 miRNA-chips, in-house RT-qPCR and miRNA-seq. The distribution of miR-182-5p in NSCLC and noncancer lung tissues was illustrated in the color of blue and red, respectively. A: GSE29248; B: GSE56036; C: GSE93300; D: GSE53882; E: GSE18692-GPL4717; F: GSE18692-GPL4718; G: GSE27705; H: GSE33045; I: GSE36881; J: in-house RT-qPCR; K: miRNA-seq Additional file 3: Figure S3. ROC curves for distinguishing power of miR-182-5p in LUAD based on data from in-house RT-qPCR, miRNA-seq and miRNA-chips. AUC: area under curves. An AUC value ranging from 0.1–1 indicated the increasing distinguishing power of miR-182-5p in LUAD. A: GSE19945; B: GSE27486; C: GSE29248; D: GSE33045; E: GSE40738; F: GSE47525; G: GSE48414; H: 51853; I: GSE56036; J: GSE93300; K: miRNA-seq; L: in-house RT-qPCR Additional file 4: Figure S4. ROC curves for distinguishing power of miR-182-5p in NSCLC based on data from 9 miRNA-chips, miRNA-seq and in-house RT-qPCR. AUC: area under curves. An AUC value ranging from 0.1–1 indicated the increasing distinguishing effect of miR-182-5p in NSCLC. A: GSE56036; B: GSE93300; C: GSE53882; D: GSE18692-GPL4717; E: GSE18692-GPL4718; F: GSE27705; G: GSE33045; H: GSE36881; I: GSE24709; J: miRNA-seq; K: in-house RT-qPCR. Additional file 5: Figure S5. Differential expression of miR-182-5p in NSCLC and noncancer lung tissues based on data from 16 miRNA-chips. The distribution of miR-182-5p in NSCLC and noncancer lung tissues was illustrated in the color of blue and red, respectively. A: GSE16612; B: GSE17681; C: GSE27486; D: GSE31668; E: GSE40738; F: GSE46729; G: GSE61741; H: GSE19945; I: GSE68951; J: GSE14936; K: GSE15008; L: GSE74190; M: GSE47525; N: GSE48414; O: GSE51853; P: GSE24709. Additional file 6: Figure S6. ROC curves for distinguishing power of miR-182-5p in NSCLC based on data from 16 miRNA-chips. AUC: area under curves. An AUC value ranging from 0.1–1 indicated the increasing distinguishing effect of miR-182-5p in NSCLC. A: GSE16512; B: GSE17681; C: GSE27486; D: GSE31568; E: GSE40738; F: GSE46729; G: GSE61741; H: GSE68951; I: GSE14936; J: GSE15008; K: GSE19945; L: GSE47525; M: GSE48414; N: GSE51853; O: GSE74190; P: GSE29248. Additional file 7: Table S1. Predicted target genes of hsa-miR-182-5p from miRWalk database. Putative target genes of hsa-miR-182-5p were predicted by 12 algorithms within mRNA selected regions.
  56 in total

1.  Implication of downregulation and prospective pathway signaling of microRNA-375 in lung squamous cell carcinoma.

Authors:  Wen-Jie Chen; Ting-Qing Gan; Hui Qin; Su-Ning Huang; Li-Hua Yang; Ye-Ying Fang; Zu-Yun Li; Lin-Jiang Pan; Gang Chen
Journal:  Pathol Res Pract       Date:  2017-01-22       Impact factor: 3.250

2.  MicroRNA-92a promotes epithelial-mesenchymal transition through activation of PTEN/PI3K/AKT signaling pathway in non-small cell lung cancer metastasis.

Authors:  Chaojing Lu; Zhengxiang Shan; Jiang Hong; Lixin Yang
Journal:  Int J Oncol       Date:  2017-05-16       Impact factor: 5.650

3.  Identification and functional characterization of microRNAs reveal a potential role in gastric cancer progression.

Authors:  C-Y Li; G-Y Liang; W-Z Yao; J Sui; X Shen; Y-Q Zhang; H Peng; W-W Hong; Y-C Ye; Z-Y Zhang; W-H Zhang; L-H Yin; Y-P Pu
Journal:  Clin Transl Oncol       Date:  2016-05-12       Impact factor: 3.405

Review 4.  RISC assembly: Coordination between small RNAs and Argonaute proteins.

Authors:  Hotaka Kobayashi; Yukihide Tomari
Journal:  Biochim Biophys Acta       Date:  2015-08-22

Review 5.  Clinical significance of circulating miRNA detection in lung cancer.

Authors:  Chen Zhao; Funian Lu; Hongxia Chen; Fuqiang Zhao; Ziwen Zhu; Xianda Zhao; Honglei Chen
Journal:  Med Oncol       Date:  2016-03-31       Impact factor: 3.064

6.  Prognostic microRNAs modulate the RHO adhesion pathway: A potential therapeutic target in undifferentiated pleomorphic sarcomas.

Authors:  Philip Wong; Angela Hui; Jie Su; Shijun Yue; Benjamin Haibe-Kains; Nalan Gokgoz; Wei Xu; Jeff Bruce; Justin Williams; Charles Catton; Jay S Wunder; Irene L Andrulis; Rebecca Gladdy; Brendan Dickson; Brian O'Sullivan; Fei-Fei Liu
Journal:  Oncotarget       Date:  2015-11-17

7.  miR-155 mediates arsenic trioxide resistance by activating Nrf2 and suppressing apoptosis in lung cancer cells.

Authors:  Shiyan Gu; Yanhao Lai; Hongyu Chen; Yuan Liu; Zunzhen Zhang
Journal:  Sci Rep       Date:  2017-09-22       Impact factor: 4.379

8.  Role of downregulated miR-133a-3p expression in bladder cancer: a bioinformatics study.

Authors:  Li Gao; Sheng-Hua Li; Yi-Xin Tian; Qing-Qing Zhu; Gang Chen; Yu-Yan Pang; Xiao-Hua Hu
Journal:  Onco Targets Ther       Date:  2017-07-20       Impact factor: 4.147

9.  MicroRNA 100 sensitizes luminal A breast cancer cells to paclitaxel treatment in part by targeting mTOR.

Authors:  Baotong Zhang; Ranran Zhao; Yuan He; Xing Fu; Liya Fu; Zhengmao Zhu; Li Fu; Jin-Tang Dong
Journal:  Oncotarget       Date:  2016-02-02

10.  A multicenter survey of first-line treatment patterns and gene aberration test status of patients with unresectable Stage IIIB/IV nonsquamous non-small cell lung cancer in China (CTONG 1506).

Authors:  Qing Zhou; Yong Song; Xin Zhang; Gong-Yan Chen; Dian-Sheng Zhong; Zhuang Yu; Ping Yu; Yi-Ping Zhang; Jian-Hua Chen; Yi Hu; Guo-Sheng Feng; Xia Song; Qiang Shi; Lu Lu Yang; Ping Hai Zhang; Yi-Long Wu
Journal:  BMC Cancer       Date:  2017-07-03       Impact factor: 4.430

View more
  10 in total

1.  miR-381-3p attenuates doxorubicin resistance in human anaplastic thyroid carcinoma via targeting homeobox A9.

Authors:  Yan Zhang; Ke Li; Weili Wang; Jingjing Han
Journal:  Int J Exp Pathol       Date:  2021-10-31       Impact factor: 2.793

2.  MicroRNA-891a-5p is a novel biomarker for non-small cell lung cancer and targets HOXA5 to regulate tumor cell biological function.

Authors:  Nianqing Wan; Jianxiao Zheng
Journal:  Oncol Lett       Date:  2021-05-02       Impact factor: 2.967

3.  MicroRNA-182-5p relieves murine allergic rhinitis via TLR4/NF-κB pathway.

Authors:  Aichun Zhang; Yangzi Jin
Journal:  Open Med (Wars)       Date:  2020-12-24

4.  TP53-Activated lncRNA GHRLOS Regulates Cell Proliferation, Invasion, and Apoptosis of Non-Small Cell Lung Cancer by Modulating the miR-346/APC Axis.

Authors:  Ke Ren; Jinghui Sun; Lingling Liu; Yuping Yang; Honghui Li; Zhichao Wang; Jingzhu Deng; Min Hou; Jia Qiu; Wei Zhao
Journal:  Front Oncol       Date:  2021-04-21       Impact factor: 6.244

5.  Downregulated Dual-Specificity Protein Phosphatase 1 in Ovarian Carcinoma: A Comprehensive Study With Multiple Methods.

Authors:  Zi-Qian Liang; Rong-Quan He; Jia-Yuan Luo; Zhi-Guang Huang; Jie Li; Lu-Yang Zhong; Jun-Hong Chen; Su-Ning Huang; Lin Shi; Kang-Lai Wei; Jiang-Hui Zeng; Jing-Jing Zeng; Gang Chen
Journal:  Pathol Oncol Res       Date:  2022-07-15       Impact factor: 2.874

6.  miR-199a-3p/5p regulate tumorgenesis via targeting Rheb in non-small cell lung cancer.

Authors:  Xiaomin Liu; Xianyi Wang; Binshu Chai; Zong Wu; Zhitao Gu; Heng Zou; Hui Zhang; Yanli Li; Qiangling Sun; Wentao Fang; Zhongliang Ma
Journal:  Int J Biol Sci       Date:  2022-06-27       Impact factor: 10.750

Review 7.  The Role of the Selected miRNAs as Diagnostic, Predictive and Prognostic Markers in Non-Small-Cell Lung Cancer.

Authors:  Michał Szczyrek; Paulina Bitkowska; Marta Jutrzenka; Janusz Milanowski
Journal:  J Pers Med       Date:  2022-07-27

8.  MiR-25-3p targets PTEN to regulate the migration, invasion, and apoptosis of esophageal cancer cells via the PI3K/AKT pathway.

Authors:  Liang Zhang; Zhuang Tong; Zhe Sun; Guolian Zhu; Erdong Shen; Yanfeng Huang
Journal:  Biosci Rep       Date:  2020-10-30       Impact factor: 3.840

9.  A Comprehensive Evaluation of miR-144-3p Expression and Its Targets in Laryngeal Squamous Cell Carcinoma.

Authors:  Bin-Yu Mo; Jin-Shu Pang; Wen-Bin Dai; Ya-Si Su; Wei Jiang; Su-Ning Huang
Journal:  Comput Math Methods Med       Date:  2021-07-16       Impact factor: 2.238

10.  Upregulation of microRNA miR-141-3p and its prospective targets in endometrial carcinoma: a comprehensive study.

Authors:  Lin-Jie Yang; Li Gao; Yi-Nan Guo; Zi-Qian Liang; Dong-Ming Li; Yu-Lu Tang; Yi-Hong Liu; Wan-Jing Gao; Jing-Jing Zeng; Lin Shi; Kang-Lai Wei; Gang Chen
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.