Warning: Undefined array key "mm" in /www/wwwroot/www.ai-bt.com/si.php on line 10 Deprecated: trim(): Passing null to parameter #1 ($string) of type string is deprecated in /www/wwwroot/www.ai-bt.com/si.php on line 10 5'-Levulinyl and 2'-tetrahydrofuranyl protection for the synthesis of oligoribonucleotides by the phosphoramidite approach.

Literature DB >> 3186438

5'-Levulinyl and 2'-tetrahydrofuranyl protection for the synthesis of oligoribonucleotides by the phosphoramidite approach.

Abstract

The levulinyl group has been employed for protection of the 5'-hydroxyl group in the synthesis of oligoribonucleotides by the phosphoramidite approach, using the acid-labile 2'-tetrahydro-furanyl group. The hydrazine treatment was performed for 10 minutes in order to remove the levulinyl group on controlled pore glass. Four decaribonucleotides (AAAAAAAAAU, GGGGGGGGGU, CCCCCCCCCU and UUUUUUUUUU) and a heneicosamer (GCCUAGCUGAUGAAGGGUGAU) were prepared with an automatic synthesizer in good yields.

Entities: Chemical

Mesh：

Substances：

Year: 1988 PMID： 3186438 PMCID： PMC338755 DOI： 10.1093/nar/16.20.9443

Source DB: PubMed Journal: Nucleic Acids Res ISSN： 0305-1048 Impact factor: 16.971

12 in total

1. Self-cleaving transcripts of satellite DNA from the newt.

Authors: L M Epstein; J G Gall
Journal: Cell Date: 1987-02-13 Impact factor: 41.582

2. Construction of a series of several self-cleaving RNA duplexes using synthetic 21-mers.

Authors: M Koizumi; S Iwai; E Ohtsuka
Journal: FEBS Lett Date: 1988-02-15 Impact factor: 4.124

3. Studies on the sequence of the 3'-terminal region of turnip-yellow-mosaic-virus RNA.

Authors: M Silberklang; A Prochiantz; A L Haenni; U L Rajbhandary
Journal: Eur J Biochem Date: 1977-02

4. Optical properties of sixteen dinucleoside phosphates.

Authors: M M Warshaw; I Tinoco
Journal: J Mol Biol Date: 1966-09 Impact factor: 5.469

5. DNA sequence analysis: a general, simple and rapid method for sequencing large oligodeoxyribonucleotide fragments by mapping.

Authors: E Jay; R Bambara; R Padmanabhan; R Wu
Journal: Nucleic Acids Res Date: 1974-03 Impact factor: 16.971

6. Solid phase synthesis of oligoribonucleotides using o-nitrobenzyl protection of 2'-hydroxyl via a phosphite triester approach.

Authors: T Tanaka; S Tamatsukuri; M Ikehara
Journal: Nucleic Acids Res Date: 1986-08-11 Impact factor: 16.971

7. Solid-phase synthesis of oligoribonucleotides.

Authors: I Hirao; M Ishikawa; K Miura
Journal: Nucleic Acids Symp Ser Date: 1985

8. Polymer support oligonucleotide synthesis XVIII: use of beta-cyanoethyl-N,N-dialkylamino-/N-morpholino phosphoramidite of deoxynucleosides for the synthesis of DNA fragments simplifying deprotection and isolation of the final product.

Authors: N D Sinha; J Biernat; J McManus; H Köster
Journal: Nucleic Acids Res Date: 1984-06-11 Impact factor: 16.971

9. A new solid-phase synthesis of oligoribonucleotides by the phosphoro-p-anisidate method using tetrahydrofuranyl protection of 2'-hydroxyl groups.

Authors: S Iwai; E Yamada; M Asaka; Y Hayase; H Inoue; E Ohtsuka
Journal: Nucleic Acids Res Date: 1987-05-11 Impact factor: 16.971

10. Solid-phase synthesis of polynucleotides. III. Synthesis of polynucleotides with defined sequences by the block coupling phosphotriester method.

Authors: K Miyoshi; T Huang; K Itakura
Journal: Nucleic Acids Res Date: 1980-11-25 Impact factor: 16.971

12 in total

1. Chemical synthesis of biologically active oligoribonucleotides using beta-cyanoethyl protected ribonucleoside phosphoramidites.

Authors: S A Scaringe; C Francklyn; N Usman
Journal: Nucleic Acids Res Date: 1990-09-25 Impact factor: 16.971

2. Chemical synthesis of the 24 RNA fragments corresponding to hop stunt viroid.

Authors: H Tanimura; M Maeda; T Fukazawa; M Sekine; T Hata
Journal: Nucleic Acids Res Date: 1989-10-25 Impact factor: 16.971

3. Use of synthetic oligoribonucleotides to probe RNA-protein interactions in the MS2 translational operator complex.

Authors: S J Talbot; S Goodman; S R Bates; C W Fishwick; P G Stockley
Journal: Nucleic Acids Res Date: 1990-06-25 Impact factor: 16.971

4. Forks and combs and DNA: the synthesis of branched oligodeoxyribonucleotides.

Authors: T Horn; M S Urdea
Journal: Nucleic Acids Res Date: 1989-09-12 Impact factor: 16.971

5. Solid-phase synthesis of oligoribonucleotides using 9-fluorenylmethoxycarbonyl (Fmoc) for 5'-hydroxyl protection.

Authors: C Lehmann; Y Z Xu; C Christodoulou; Z K Tan; M J Gait
Journal: Nucleic Acids Res Date: 1989-04-11 Impact factor: 16.971

6. Orthogonal combinatorial mutagenesis: a codon-level combinatorial mutagenesis method useful for low multiplicity and amino acid-scanning protocols.

Authors: P Gaytán; J Yáñez; F Sánchez; X Soberón
Journal: Nucleic Acids Res Date: 2001-02-01 Impact factor: 16.971

7. A convenient approach to the synthesis of medium size oligodeoxyribonucleotides by improved new phosphite method.

Authors: H Hosaka; Y Suzuki; H Sato; S Gug-Kim; H Takaku
Journal: Nucleic Acids Res Date: 1991-06-11 Impact factor: 16.971

8. Synthesis and applications of oligoribonucleotides with selected 2'-O-methylation using the 2'-O-[1-(2-fluorophenyl)-4-methoxypiperidin-4-yl] protecting group.

Authors: B Beijer; I Sulston; B S Sproat; P Rider; A I Lamond; P Neuner
Journal: Nucleic Acids Res Date: 1990-09-11 Impact factor: 16.971

9. Use of new phosphonylating and coupling agents in the synthesis of oligodeoxyribonucleotides via the H-phosphonate approach.

Authors: O Sakatsume; H Yamane; H Takaku; N Yamamoto
Journal: Nucleic Acids Res Date: 1990-06-11 Impact factor: 16.971

10. Binding of nucleic acids to E. coli RNase HI observed by NMR and CD spectroscopy.

Authors: Y Oda; S Iwai; E Ohtsuka; M Ishikawa; M Ikehara; H Nakamura
Journal: Nucleic Acids Res Date: 1993-10-11 Impact factor: 16.971