Analysis of PMEPA1 Isoforms (a and b) as Selective Inhibitors of Androgen and TGF-β Signaling Reveals Distinct Biological and Prognostic Features in Prostate Cancer.

Dysfunctions of androgen/TGF-β signaling play important roles in prostate tumorigenesis. Prostate Transmembrane Protein Androgen Induced 1 (PMEPA1) inhibits androgen and TGF-β signaling via a negative feedback loop. The loss of PMEPA1 confers resistance to androgen signaling inhibitors and promotes bone metastasis. Conflicting reports on the expression and biological functions of PMEPA1 in prostate and other cancers propelled us to investigate isoform specific functions in prostate cancer (PCa). One hundred and twenty laser capture micro-dissection matched normal prostate and prostate tumor tissues were analyzed for correlations between quantitative expression of PMEPA1 isoforms and clinical outcomes with Q-RT-PCR, and further validated with a The Cancer Genome Atlas (TCGA) RNA-Seq dataset of 499 PCa. Cell proliferation was assessed with cell counting, plating efficiency and soft agar assay in androgen responsive LNCaP and TGF-β responsive PC3 cells. TGF-β signaling was measured by SMAD dual-luciferase reporter assay. Higher PMEPA1-a mRNA levels indicated biochemical recurrence (p = 0.0183) and lower PMEPA1-b expression associated with metastasis (p = 0.0173). Further, lower PMEPA1-b and a higher ratio of PMEPA1-a vs. -b were correlated to higher Gleason scores and lower progression free survival rate (p < 0.01). TGF-β-responsive PMEPA1-a promoted PCa cell growth, and androgen-responsive PMEPA1-b inhibited cancer cell proliferation. PMEPA1 isoforms -a and -b were shown to be promising candidate biomarkers indicating PCa aggressiveness including earlier biochemical relapse and lower disease specific life expectancy via interrupting androgen/TGF-β signaling.

1. Introduction

Prostate cancer is a commonly diagnosed malignancy in United States with an estimated 31,620 deaths in 2019 [1]. It is imperative to uncover the candidate biomarkers for monitoring prostate tumor initiation, the development of castration resistance prostate cancer (CRPC) and metastasis, as well as prognostic evaluation through elucidating the biology of lethal prostate cancer. Although the underlying etiology of lethal prostate cancer including CRPC and metastasis is still not fully understood, it has been shown that alterations of androgen receptor (AR) mediated signaling, including AR splice variants and transforming growth factor-β (TGF-β) signaling, contribute to prostate tumorigenesis and disease progression [2,3,4,5,6].

The Prostate Transmembrane Protein Androgen Induced 1 (PMEPA1) gene was originally identified by our group as an androgen responsive gene with abundance in the prostate [7,8,9]. Our earlier study showed that PMEPA1 degraded the AR protein via the E3 ubiquitin ligase NEDD4 mediated proteasome-ubiquitin pathway, and the PMEPA1 gene suppressed androgen signaling by, for example, decreasing the expression of the androgen responsive gene PSA/KLK3 in hormone responsive prostate cancer cells [10]. PMEPA1 was also reported to be induced by TGF-β and PMEPA1 protein inhibited TGF-β signaling by blocking the binding between TGF-β receptor I and R-Smads [6,11,12,13,14,15].

We further showed that PMEPA1 gene expression was reduced or absent in about 65% of prostate tumors and methylation of the PMEPA1 gene promoter was one of the major mechanisms of silencing PMEPA1 in prostate cancer [16,17,18]. Furthermore, depletion of PMEPA1 in androgen responsive prostate cancer cells facilitated the development of resistance to AR inhibitors (enzalutamide and bicalutamide) in vitro. Importantly, knockdown of PMEPA1 promoted LNCaP derived xenograft growth in both a hormone dependent and independent manner [19]. Similarly, the PMEPA1 gene promoted bone metastasis via activation of TGF-β signaling and subsequently increased bone metastasis associated genes in prostate cancer cells [6]. All these findings defined PMEPA1 as a key regulator of AR/TGF-β signaling. Together with the roles of AR/TGF-β signaling in prostate cancer progression, it was hypothesized that PMEPA1 functions as a biologically significant candidate biomarker for monitoring prostate cancer aggressiveness including metastases and CRPC, as well as for the evaluation of metastasis-free survival.

Additionally, it had been shown that PMEPA1 inhibited prostate cancer cells’ growth through blocking androgen signaling [10,19]. On the other hand, it was also reported that PMEPA1 promoted the proliferation of AR negative prostate cancer cells by suppressing p21 expression through a negative feedback loop with TGF-β, and PMEPA1 expression was enhanced in prostate cancer tissue [20]. These observations may stem from the likely use of PMEPA1 or related transcripts, e.g., STAG1, TMEPAI, and others, which were described as oncogenetic in other cancer types, especially in non-androgenic contexts [7,11,21,22]. Cumulatively, these findings suggested that expression and the biological functions of the PMEPA1 gene were dependent on AR or TGF-β signaling pathways in a given cellular context. However, it was still unclear how PMEPA1 simultaneously regulated these two signaling pathways during prostate cancer development and progression. Therefore, a more detailed isoform specific study was warranted to clarify the conflicting reports regarding the biological functions of the PMEPA1 gene in prostate and other cancers.

The goal of this study is to investigate the roles of dominant PMEPA1 isoforms in prostate cancer progressions and the clinical relevance of them by highlighting the distinct biological functions of PMEPA1 isoforms in the context of AR and TGF-β signaling pathways. Here, we characterized two prototypical isoforms of the PMEPA1 gene: PMEPA1-a (coding 287 amino acid, also known as STAG1/TMEPA1) and PMEPA1-b (coding 252 amino acid, also known as PMEPA1) in the context of androgen/TGF-β signaling in prostate cancer cells, and further explored the clinical relevance and biomarker features of PMEPA1 isoforms with prostate cancer late-stage progression by conducting a molecular-epidemiology investigation among prostate cancer patients in a health professional follow-up study. Our results revealed that the isoform specific functions of PMEPA1 and aberrant expressions of PMEPA1-a and -b correlated with biochemical recurrence and metastasis, respectively, serving as a potential biomarker for prostate cancer progression.

2. Results

2.1. Structures, Expressions and Distinct Regulations of PMEPA1 Isoforms in Prostate Cancer Cells

The transcription levels of PMEPA1 isoforms were first examined with RNA-Seq analysis of prostate cancer patient specimens from the TCGA dataset (https://portal.gdc.cancer.gov/projects/TCGA-PRADv10.0). PMEPA1 isoforms a and b were identified as the most abundant isoforms in prostate cancer. The mean Log2 transcripts per million reads mapped (TPM) of PMEPA1-a (NM_020182.4), comprising of 287 amino acids, was 6.337, and PMEPA1-b (NM_199169.2), comprising of 252 amino acids, was 5.624 (Figure 1A). PMEPA1-a and b proteins shared homology in C-terminal cytoplasmic and trans-membrane domains. A striking difference was noted regarding the length of the N-terminal luminal domain of isoforms PMEPA1-a (with 40 amino acid) and PMEPA1-b (with five amino acid) (Figure 1B). The predicted structure of PMEPA1 protein contains three functional domains: N-terminal luminal (in blue), transmembrane (in red) and C-terminal cytoplasmic domain (Figure 1C).

Figure 1

(A) Prostate Transmembrane Protein Androgen Induced (PMEPA1) isoforms related mRNA expression levels from the RNA-Seq dataset of TCGA-PRAD v10.0. (B) The alignment of the predicted amino acid sequences of the two dominant isoforms PMEPA1-a and b. (C) Structure of the PMEPA1-a and b protein: N-terminal, extracellular/luminal, transmembrane and C-terminal cytoplasmic domain. (D) Assessment of transcription levels of PMEPA1-a and PMEPA1-b in prostate cancer cells. (E) Relative fold changes of transcription levels of PMEPA1 isoforms (a and b) responding to (a) R1881, (b) ectopic expression of wild-type, mutant (T877A) AR, (c) AR siRNA, (d) TGF-β, (e) over-expressing TGF-β receptor I (TGFBR1) and (f) TGFBR1 siRNA; (F) Relative fold changes of the transcript levels of PMEPA1-a in response to TGF-β in LNCaP cells.

To assess the mRNA levels of PMEPA1 isoforms (a and b) in androgen and TGF-β responsive prostate cancer cells, specific primer pairs were designed to differentiate the unique 5′ sequences of PMEPA1 isoforms. PMEPA1-a transcription was present at varying levels in both AR positive and negative cells. In contrast, PMEPA1-b was detected only in AR positive cells (Figure 1D). Previous studies had described the regulation of PMEPA1 transcripts and proteins by TGF-β [11] or androgens [7] in different biological contexts. Here, we demonstrated the selective responsiveness to androgen and TGF-β of PMEPA1 isoforms (a and b) in prostate cancer cells. In androgen sensitive LNCaP cells, only expression of PMEPA1-b was induced by androgens (Figure 1E-a). In TGF-β responsive PC3 cells, PMEPA1-a was up-regulated by TGF-β, whereas PMEPA1-b was non-responsive to TGF-β (Figure 1E-d). Of note, PMEPA1-a did not respond to TGF-β in LNCaP cells (Figure 1F). Moreover, ectopic wild-type and mutant AR (T877A) in LNCaP cells led to the induction of only PMEPA1-b at transcript level (Figure 1 E-b). Conversely, the depletion of endogenous AR in LNCaP cells resulted in a decreased level of expression of only isoform b (Figure 1E-c). Ectopic TGFBR1 in PC3 cells selectively enhanced the expression of PMEPA1-a (Figure 1E-e). Similarly, the silencing of TGFBR1 (Figure 1E-f) led to the downregulation of PMEPA1-a. The transcription level of PMEPA1-b was not affected by TGFRI over-expression (Figure 1E-e,f), whereas heterologous expression of AR had no impact on the transcription level of PMEPA1-a (Figure 1E-b,c). Additionally, both PMEPA1-a and -b isoforms were not responsive to TGF-β in LNCaP cells (Figure 1F). Together, these findings showed that PMEPA1-a and -b are specifically modulated by TGF-β and androgen, respectively.

2.2. PMEPA1-a and -b Isoform mRNA Levels as a Biomarker for Prostate Cancer Aggressiveness

To address the correlation between PMEPA1 isoforms (a and b) and disease progression, we utilized the military cohort of 120 primary prostate cancer samples from Walter Reed National Military Medical Center (WRNMMC) at the Center for Prostate Disease Research (CPDR) biospecimen bank. The distribution of major clinico-pathological features including race, pathological stages, Gleason score, margin status, incidence rates of biochemical reoccurrence (BCR) and metastasis were listed in Figure 2A. Consistent with our previous report [12], the lower mRNA level of PMEPA1-b was detected in 58.3% of prostate tumor samples. In contrast, no significant difference of PMEPA1-a expression within tumor and matched normal tissues was detected (Figure 2A). The increased transcription of PMEPA1-b was correlated to higher pathological stages (pT3–4 versus pT2) (p = 0.0156) (Figure 2B). Furthermore, higher expression of TGF-β responsive PMEPA1-a was found to be an independent BCR predictor with either a univariable (p = 0.0183) or multivariable Cox proportional hazard model (p = 0.0015) (Figure 2C,D). The lower expression of androgen responsive PMEPA1-b isoforms was shown to be strongly associated with metastasis (p = 0.0173) (Figure 2E). All these findings highly suggested a differential role played by PMEPA1 isoforms (a and b) in prostate cancer progression via distinct signaling pathways as well as that the interplay of these two isoforms might contribute to cancer progression collectively.

Figure 2

(A) Selected clinical characteristics among men with prostate cancer with biochemical reoccurrence (BCR) and metastasis. (B) The association of PMEPA1-b with Path T (p = 0.0156). (C) The association of PMEPA1-a with BCR. (D) PMEPA1-a isoform was an independent predictor of BCR with multi-variable model (p = 0.0015). (E) The association of PMEPA1-b and metastasis of prostate cancer. The red number highlighted the p value with statistics significance.

2.3. The Increased Ratio between Transcripts of PMEPA1-a and PMEPA1-b Indicated a Higher Gleason Score and More Aggressive Prostate Cancer

To validate the findings from 120 frozen prostate samples, we further analyzed the TCGA RNA-seq data of unmatched 499 malignant and 50 benign prostate samples. Our analysis showed that a decreased transcript level of PMEPA1-b in prostate cancer patients is associated with higher Gleason scores (Figure 3A), especially between groups with a Gleason score of 7 and 9 (p = 0.016). Moreover, lower expression of PMEPA1-b indicated prostate cancer aggressiveness, including lower progression free survival (PFS) rates (p = 0.014) and overall survival (OS) rates (p < 0.01) (Figure 3B,C). On the other hand, significant differences in PMEPA1-a expression within different Gleason score groups were not observed (Figure 3D). Unexpectedly, a direct correlation between the expression level of PMEPA1-a and prostate cancer progressions was also not detected (Figure 3E,F). However, it was observed that an increased ratio of PMEPA1-a versus PMEPA-b correlated with worse disease outcomes, including increased Gleason scores, lower PFS rates (p = 0.0063) and decreased OS rates (p < 0.01) (Figure 3G–I). Our data from CPDR laser captured micro-dissected (LCM) samples had already revealed that higher PMEPA1-a and lower PMEPA1-b individually indicated the early onset of BCR and metastasis, respectively. Here, TCGA data analysis further confirmed that PMEPA1-a and PMEPA1-b isoforms collectively indicate prostate cancer aggressiveness.

Figure 3

Higher ratio of mRNA levels of PMEPA1-a versus PMEPA1-b indicated a higher Gleason score and more aggressive subtypes of prostate cancer with TCGA data analysis of 499 prostate cancer patients. (A–C) The association of PMEPA1-b with Gleason scores, progression free survival rate (PFS) and overall survival rate (OS). (D–F) The correlation of PMEPA1-a to Gleason scores, progression free survival rate (PFS) and overall survival rate (OS). (G–I) The relationship of the ratio of mRNA levels of TGF-β responsive PMEPA1-a versus androgen responsive PMEPA-b isoforms with prostate cancer disease progression.

2.4. PMEPA1-a Promoted the Growth of AR Negative Prostate Cancer Cells and Inhibited TGF-β Signaling

To elucidate the potential mechanisms of the involvement of PMEPA1-a and PMEPA1-b in aggressive disease progression, we conducted a comparative study to assess the effects of PMEPA1 isoforms (a and b) on prostate cancer cell growth and signaling pathways of AR and TGF-β. In PC3 cells (TGF-β signaling positive but AR negative), PMEPA1-a promoted cell growth, whereas silencing of PMEPA1-a resulted in cell growth inhibition (Figure 4A,D). Interestingly, ectopic PMEPA1-b resulted in decreased proliferation of PC3 cells. These observations were supported by the results of cell plating efficiency (Figure 4B,E) and soft agar colony formation assays (Figure 4C,F). Further, depletion of TGFBR1 resulted in increased cell growth and colony formation of PC3 cells, and there was no enhancement of cell growth in response to PMEPA1-a expression in TGFBR1 depleted PC3 cells (Figure 4G,H). In contrast, PMEPA1-b mediated cell growth inhibition was not affected by TGFRI depletion. These findings underscored that the selective effect of PMEPA1-a on the cell growth was TGF-β signaling dependent.

Figure 4

The PMEPA1-a isoform promoted the cell growth of PC3 cells. (A–C) PC3 cell growth in response to the over-expression of PMEPA1 isoforms (a and b) measured by cell counting (A), cell plating efficiency (B) and colony formation soft agar assay (scale bar = 25 µm) (C). (D–F) PC3 cell growth responding to PMEPA1-a siRNA assessed by cell counting (D), cell plating efficiency (E) and colony formation soft agar assay (scale bar = 25 µm) (F). (G,H) PC3 cell growth measured by cell counting (G) and cell plating efficiency (H) following the over-expression of PMEPA1 isoforms (a or b) in the presence of TGFBR1 siRNA. (I,J) Relative fold changes of transcription levels of TGF-β responsive genes COL1A1, NEDD9 and THBS1 in response to PMEPA1-a (I) or PMEPA1-a siRNA (J) in PC3 cells. (K) Dual luciferase SMAD reporter activity responding to PMEPA1-a in PC3 cells. (L) Association of PMEPA1-a with TGF-β responsive genes in prostate tumor samples.

PMEPA1 had been shown to inhibit TGF-β signaling by sequestering R-SMAD [9,10,11]. The SMAD binding domain was localized within the cytoplasmic domains of the PMEPA1 protein. Along these lines, ectopic PMEPA1-a in PC-3 cells resulted in reduced transcription levels of R-SMAD/TGF-β responsive genes including COL1A1, NEDD9 and THBS1. Consistently, the knockdown of PMEPA1-a resulted in increased transcription levels of TGF-β/SMAD downstream regulated genes in PC3 cells (Figure 4I,J). Due to the known role of PMEPA1-a in sequestering R-SMADs, we measured the transcriptional activation function of SMADs by co-transfecting PC3 cells with PMEPA1 isoform expression vectors and a luciferase reporter vector under the control of a SMAD-inducible promoter-enhancer cassette. The luciferase reporter assay revealed robust PMEPA1-a mediated inhibition of SMAD mediated transcription in PC3 cells (Figure 4K). In contrast, PMEPA1-b had no effect on SMAD transcriptional activation in PC3 cells. As anticipated, the transcription level of PMEPA1-a did not show any correlation with expressions of AR and androgen responsive genes, including PMEPA1-b and PSA (KLK3) in frozen prostate tumor samples, consistent with our findings that the regulation of PMEPA1-a is AR independent (Figure 4I). Moreover, the significant reverse correlations between PMEPA1-a and TGF-β responsive genes such as THBS1 (p = 0.0001, R = −0.37837) and NEDD9 (p = 0.0275, R = −0.22506) in tumor tissue were detected, further substantiating the inhibition effects of PMEPA1-a on TGF-β signaling in prostate cancer cells (Figure 4I).

2.5. PMEPA1-b Inhibited the Growth of Hormone Dependent Prostate Cancer Cells through Facilitating AR Protein Degradation and Blocking Androgen Signaling

The effects of PMEPA1 isoforms (a and b) on AR signaling were examined in androgen positive LNCaP cells. Our data revealed that only ectopic PMEPA1-b resulted in the inhibition of cell growth (Figure 5A). As expected, knockdown of PMEPA1-b resulted in accelerated cell growth (Figure 5D). Consistently, knockdown of endogenous isoform b increased the cell plating efficiency and anchorage-independent tumor growth of LNCaP cells (Figure 5B,C,E,F). Finally, the modulation of PMEPA1-a by TGF-β stimuli had no impact on the proliferation of LNCaP cells in our experiments. Taken together, these data established that PMEPA1-b suppressed cell proliferation in the context of hormone responsiveness. The transcription level of the androgen responsive gene PSA (KLK3) was also shown to be down-regulated by the over-expression of isoform b. Similarly, knock-down of PMEPA1-b isoform resulted in the up-regulation of PSA (KLK3) mRNA in LNCaP cells (Figure 5G,H). PMEPA1-a had no impact on the protein or mRNA levels of AR or PSA (KLK3) in LNCaP cells. It has been established that PMEPA1, as a NEDD4 E3 ligase binding protein, mediates AR protein degradation via the proteasome-ubiquitination pathway [14,22]. PMEPA1 isoform proteins are identical within their membrane spanning (23 amino acid) and cytoplasmic domains (224 amino acid), including PY1 and PY2 motifs essential for binding to the NEDD4. However, there are differences at the N-terminus, as PMEPA1-a and PMEPA1-b contain 40 and five amino acids upstream of the membrane spanning domain, respectively. In accordance with the earlier observations, ectopic PMEPA1-b selectively decreased the protein level of endogenous AR in LNCaP cells (Figure 5I). Further, only the PMEPA1-b isoform degraded the ectopic AR (wild-type) protein in a NEDD4 dependent manner (Figure 5J). The correlations between PMEPA1-b and the androgen and TGF-β signaling were further evaluated in 120 tumor samples. As expected, a strong positive correlation between the transcription levels of PMEPA1-b and PSA (KLK3) was noted, indicating shared regulations of these two genes by androgen signaling (p = 0.0004, R = 0.36) (Figure 5K). Additionally, a reverse correlation of the transcripts of AR and PMEAP1-b was also detected (p = 0.0529, R = −0.19) (Figure 5K). Consistent with our observations that PMEPA1-b was neither TGF-β responsive nor involved in the regulation of TGF-β signaling, a direct correlation between PMEPA1-b and TGF-β responsive genes, such as PMEPA1-a, THBS1 and NEDD9, was not found (Figure 5K).

Figure 5

PMEPA1-b inhibited the cell growth, cell plating efficiency and colony formation capacity of LNCaP cells. (A–C) LNCaP cell growth in response to the over-expression of PMEPA1 isoforms (a and b) measured by cell counting (A), cell plating efficiency (B) and colony formation soft agar assay (scale bar = 25 µm) (C). (D–F) LNCaP cell growth responding to siRNA targeting PMEPA1 isoforms (a and b) assessed by cell counting (D), cell plating efficiency (E) and colony formation soft agar assay (scale bar = 25 µm) (F). (G,H) Relative fold changes of the transcription level of PSA (KLK3) in LNCaP cells with PMEPA1-b over-expression (G) and PMEPA1-b depletion (H). (I) Protein levels of AR and PSA in LNCaP cells over-expressing PMEPA1 isoforms (a and b). (J) AR protein level in PMEPA1-b over-expressing HEK293 cells. (K) Association of PMEPA1-b with AR and PSA/KLK3 in prostate cancer tumor samples. The red number highlighted the p value with statistics significance.

3. Discussion

Most advanced prostate cancers will eventually develop metastases and castration resistance. Together with the overtreatment of prostate cancer patients with low-risk, the current challenge is to discriminate aggressive from indolent prostate cancer. Therefore, it is critical to identify the biomarkers and their therapeutic targets in order to develop an efficient treatment strategy. In this study, we provided expressions and functional evidence to support that PMEPA1 isoforms (a and b) could be used as potential biomarkers to monitor disease progression by understanding the mechanism of prostate cancer susceptibility.

Two major PMEPA1-a and PMEPA1-b isoforms were identified with significantly higher expressions in prostate tissues. The protein sequence homology showed that these two isoforms share identical C-terminus intracellular and transmembrane domains, suggesting these isoforms carry out similar functions in terms of ligand and receptor binding. Interestingly, the only difference noted between the isoforms was at the N-terminus extracellular domain. Our data indicated that PMEPA1-b was only detected in AR positive LNCaP, VCaP and LAPC4 prostate cancer cells. On the contrary, PMEPA1-a was detected in both AR positive and AR negative PC3 and DU145 cells. Such isoform specific expression disparities in the given cellular context highly implied different regulation mechanisms of expression of PMEPA1 isoforms a and b. Previous reports showed that both androgen and TGF-β regulated the expression of the PMEPA1 gene [6,7,8,11,23]. Our data distinctly classified PMEPA1-a as TGF-β responsive and PMEPA1-b as androgen responsive. Such a specificity may likely result from transcription due to the binding sites of AR and TGF-β receptors on the same promoter region or multiple promoters.

Earlier data from several laboratories indicated both pro-oncogenic and tumor growth inhibitory functions of the PMEPA1 gene in various solid tumors, including cancers of the breast, lung, colon and prostate [11,14,16,19,20,24,25,26,27,28,29,30,31,32,33,34]. Our data on distinct expressions and regulations of PMEPA1 gene isoforms (a and b) have underscored the rationale for evaluating isoform specific functions in prostate tumorigenesis and progression. To determine the correlations between transcriptional levels of PMEPA1 isoforms (a and b) and prostate cancer progression, two cohorts were included in our study. The first discovery cohort was matched frozen prostate tissue from the Walter Reed National Military Medical Center (WRNMMC) CPDR biospecimen bank, which is composed of military and veteran prostate cancer patients with an over-representation of African American patients (29.2%). The median follow-up period of this cohort was ten years. Therefore, the higher incidence rates were also recorded for both biochemical reoccurrence (BCR) (29.3%) and metastasis (5.9%). All of these features underlined the advantages of the cohort for a prostate cancer aggressiveness study. The isolation and characterization of specific tumor and normal cells from a heterogeneous cell population is important for the differentiation analysis of gene expression. Therefore, the laser capture microdissection (LCM) technology was used for distinguishing the malignant and non-adjacent benign tissue in order to assure the purity of the collected tissue.

The QRT-PCR data showed that the expression level of PMEPA1-b was higher than PMEPA1-a in normal prostate tissue, consistent with the findings of RNA-seq data analysis of the TCGA dataset (50 benign prostate tissues). In addition, the transcription level of PMEPA1-b tended to decrease in prostate tumors compared to normal tissue (70 out of 120 cases with reduced PMEPA1-b expression). In contrast, the expression of PMEPA1-a was not detected with a significant change in tumor tissue in comparison to benign prostate tissue. Such observations implied the remarkable role of the PMEPA1-b isoform in maintaining the physical homeostasis of the prostate. The analysis further revealed that the reduced or lost expression of PMEPA1-b was more significant in the lower pathological stage of the tumor. The trend of lower expression of PMEPA1-b and higher expression of PMEPA1-a was perspicuous in the subgroup with the highest Gleason score (Gleason 8 to 10), suggesting the divergent roles played by PMEPA1-a and b via different signaling pathways in late-stage prostate cancer. Further, our data showed the significant association between the higher expression of PMEPA1-a with earlier occurrence of BCR with univariable and multivariate models including age, race, PSA, pathological stage, Gleason score and marginal status, highlighting PMEPA1-a as an independent predicator of the occurrence of BCR, and further suggesting the pro-oncogenic function of PMEPA1-a in the development of aggressive prostate cancer. The QRT-PCR data indicated a strong correlation between reduced PMEPA1-b mRNA levels and metastasis, and a decreased transcription level of PMEPA1-b was detected in all metastasis cases in the cohort. The initial findings were further validated with a larger cohort (499 cases) from the TCGA dataset. Unexpectedly, the RNA-seq data analysis did not represent a significant correlation between a higher expression of PMEPA1-a and disease aggressiveness. Such a difference might result from the disparity of the cohort selection, sample heterogenicity, frozen vs. FFPE (Formalin-Fixed Paraffin-Embedded) tissue and benign control exclusion of the TCGA dataset. The TCGA dataset primarily consisted of FFPE non-military Caucasian American prostate cancer patients, whereas our WRNMMC CPDR cohort was frozen tissues of military/veteran patients with an over-representation of African Americans. The major limitation of the TCGA is the lack of matched non-malignant control prostate tissue. However, lower expression of PMEPA1-b was also perceived in prostate cancer cases with a higher Gleason score (8 to 10) in the TCGA dataset. Moreover, the reduced transcription level of PMEPA1-b was strongly correlated with more aggressive prostate cancer, reflecting as lower PFS and OS rates. Taken together, our study identified PMEPA1 gene isoforms (a and b) as individual candidate biomarkers indicating the progression of prostate cancer into late stage.

The presence of two major PMEPA1 isoforms (a and b) in prostate cancer prompted us to hypothesize that the cumulative actions of different PMEPA1 isoforms may impact prostate cancer development/progression. We noted a significant correlation between an increased ratio of PMEPA1-a/PMEPA1-b and decreased PFS and OS rates (p = 0.001). Due to the contrasting alterations of PMEPA1-a and PMEPA1-b in tumors compared to normal prostate tissue, a higher expression ratio of PMEPA1-a versus PMEPA1-b was detected. More importantly, such an enhanced ratio strongly indicated worse clinical outcomes, including a higher Gleason score (Gleason 7 and 8 to 10 versus Gleason 6) and decreased PFS and OS rates. These findings underscored the cumulative roles of PMEPA1 isoforms (a and b) in predisposing disease aggressiveness, further implicating the interplay of discrete signaling pathways mediating PMEPA1 isoform specific functions.

The significant association of PMEPA1 isoforms (a and b) with prostate cancer aggressiveness prompted us to further dissect the underlying mechanisms navigating the biological functions of PMEPA1 isoforms in disease progression. Previously, we defined PMEPA1 as a tumor growth inhibitor through mediating AR protein degradation and subsequent AR signaling inhibition in hormone responsive prostate cancer cells. In addition, PMEPA1 was also reported to promote the growth of AR negative prostate cancer cells. This study defined PMEPA1-b rather than PMEPA1-a as the growth inhibitor of androgen responsive prostate cancer cells through degradation of the AR protein and subsequent AR signaling inhibition. PMEPA1-b was also found to inhibit the cell growth of androgen independent PC3 cells, and such a cell growth inhibitory effect was not rescued by blocking of TGF-β signaling. All these findings suggested that PMEPA1-b inhibited prostate tumor growth in AR signaling dependent and independent way, well-matched with the findings that reduced or loss of expression of PMEPA1-b strongly indicated adverse clinical outcomes. Together with the strong correlation between the reduced expression of PMEPA1-b and metastatic prostate cancer, our findings evince the importance of the dysfunction of PMEPA1-b in late-stage prostate tumors, especially metastasis.

As opposed to PMEP1-b, PMEPA1-a exhibited pro-oncogenic functions in that it promoted the growth of AR negative prostate cancer cells by inhibiting TGF-β signaling. Although the transcription levels of both PEMAP1-a and PMEPA1-b were detected in LNCaP cells, PMEPA-a was not found to regulate AR signaling and PMEPA1-b had no impacts on TGF-β signaling. Our study clarified the expression of PMEPA1-a in TGF-β responsive PC-3 cells. These findings support the earlier report that loss of the PMEPA1 gene in PC3 cells leads to the activation of TGF-β signaling and the consequential upregulation of TGF-β responsive pre-metastasis genes including CTGF, IL11 and PTHRP which drives the bone metastasis of prostate cancer [6]. However, the model of PMEPA1-a promoting prostate cancer metastasis via perturbing TGF-β signaling was not validated in either the frozen tissue cohort or the TCGA dataset. In contrast, higher expression of PMEPA1-a was identified as an independent indicator of BCR in our matched 120 frozen prostate cancer and non-adjacent normal tissue cohort. In light of the negative feedback regulation between PMEPA1-a and TGF-β signaling, and the gain of TGF-β signaling in hormone treatment resistance, our study highlighted the potential biomarker features of PMEPA1-a reflecting the TGF-β signaling status and successive castration resistance in prostate cancer patients. Moreover, the recent discovery that small molecules inhibiting the expression of PMEPA1 provided new insights into anti prostate cancer therapeutics strategies by suppressing the pro-oncogenic function of the PMEPA1 gene [35].

Our study for the first time clarified the tight associations of PMEPA1-a with TGF-β signaling and the PMEPA1-b isoform with androgen signaling in prostate cancer cells. In this regard, we hypothesized that the isoform specific function may be mediated by distinct protein–protein interactions. Given the high homology in C-terminus intra-cellular domains of PMEPA1 isoform proteins, the N-terminus extra-cellular and transmembrane domains might account for the distinct signaling navigation. QRT-PCR data further confirmed that the expression of PMEPA1-b is inversely associated with AR. As expected, the transcription level of PMEPA1-a was not found to be associated to either AR or PSA (KLK3), but inversely correlated to the TGF-β responsive genes THBS1 and NEDD9, consistent with the inhibitory effects of PMEPA1-a on TGF-β signaling.

4. Materials and Methods

4.1. Prostate Cancer Specimens and Clinico-Pathological Data

Radical prostatectomy (RP) specimens and clinico-pathological data were obtained from patients without prior androgen deprivation therapy enrolled at the Center for Prostate Disease Research (CPDR) from 1997 to 2010 under an institutional review board-approved protocol of the Walter Reed National Military Medical Center (WRNMMC, ethical code: 20405) and Uniformed Services University of the Health Sciences (USUHS, ethical code: 911403). The biochemical recurrence (BCR) was defined as two consecutive post-operative PSA values (≥0.2 ng/mL) measured at ≥8 weeks post-operatively. Benign and malignant cells were isolated by laser capture micro-dissection (LCM) from optimum cutting temperature (OCT) embedded 6 micron frozen tissue sections.

4.2. RNA Isolation and Quantitative RT-PCR

The total RNA from the cultured cells and the LCM human prostate specimens was isolated by an RNeasy Mini Kit (Qiagen, Hilden, Germany). The integrity of the RNA samples was determined by a Bioanalyzer 2100 (Agilent Technologies, Foster City, CA, USA) as well as by detection of the housekeeping gene GAPDH. Complementary DNA (cDNA) was synthesized using the total RNA (2 µg per reaction) with OmniScript reverse transcriptase and oligo (dT)-12 primers (Qiagen). Each cDNA sample was amplified using TaqMan and SYBR™ Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) on the Stratagene M×3000P Real-Time PCR system (Agilent Technologies). The GAPDH gene (GeneID:2597) transcript was used to normalize each sample for assessing the transcripts of the PMEPA1-a (GeneID:56937, transcript: NM_020182.4), PMEPA1-b (GeneID:56937, transcript: NM_199169.2), KLK3/(PSA) (GeneID: 354), AR (GeneID: 367), COL1A1 (GeneID:1277), NEDD9 (GeneID:4739) and THBS1 (GeneID:7057) genes. The gene transcription levels were analyzed for each sample in triplicates. Amplification plots were evaluated and a threshold cycle (CT) was set for each gene. The ΔCT value was yielded by the subtraction of averaged GAPDH CT values from averaged target gene CT values. The expression differences of target genes between normal and tumor tissues, as well as experiment and control groups, was assessed by comparing ΔCT values of genes in matched normal and tumor samples (ΔΔCt method). The primer probe used for the QRT-PCR analysis is listed in Table 1. GAPDH primers and the probe mix were obtained from Life Technologies.

Table 1

PMEPA1 isoform specific and TGF-β responsive gene primers.

PMEPA1-a	Forward	5′-GCAACTG CAAACGCTCTTTGT-3′
PMEPA1-a	Reverse	5′-GGACCGTGCAGACAGCTTGTA-3′
PMEPA1-a	probe	6FAM-CATGGAGAT CACGGAGC-TAMRA
PMEPA1-b	Forward	5′-CATCATCCCCGAGCTGCT-3′
PMEPA1-b	Reverse	5′- TGATCTGAACAAACTCCAGCTCC-3′
PMEPA1-b	probe	6FAM-AGGCGGACAGTCTCCTGCGAAA-TAMRA
KLK3/(PSA)	Forward	5′-CCC ACT GCA TCA GGA ACA AA-3′
KLK3/(PSA)	Reverse	5′- GAG CGG GTG TGG GAA GCT-3′
KLK3/(PSA)	probe	6FAM- ACA CAG GCC AGG TAT TTC AGG TCA GCC -TAMRA
AR	Forward	5′- GGTGTCACTATGGAGCTCTCACAT -3′
AR	Reverse	5′- GCAATCATTTCTGCTGGCG -3′
AR	probe	FAM- CTTCAAAAGAGCCGCTGAAGGGAAACAG –TAMRA
NEDD9	Forward	5′-ATCAGCTGAGCCAGTTCCAG-3′
NEDD9	Reverse	5′-TGGGTCTCACATTGGTCAT-3′
NEDD9	probe	6FAM-AAGCCCTCTCAGAGCCTACC–TAMRA
COLA1	Forward	5′-CAGGTCTCGGTCATGGTACCT-3′
COLA1	Reverse	5′-GTCGAGGGCCAAGACGAA-3′
COLA1	probe	6FAM-CATCCCACCAATCACCTGCGTACAGA-TAMRA
THBS1	Forward	5′-TTGTCTTTGGAACCACACCA-3′
THBS1	Reverse	5′-TTGTCAAGGGTGAGGAGGAC-3′
THBS1	probe	6FAM-TGCAGCTATCAACAGTCCATTCCTCG -TAMRA

4.3. The TCGA RNA Sequencing (RNA Seq) Data Acquisition

The TCGA database (v10.0) contains RNA-Seq data from 499 prostate cancer cases and 50 normal prostate tissues. The FASTQ reads were analyzed for the PMEPA1 isoform transcribed from the region Chr20: 56286592-56234606. Kallisto was used to estimate the expressions of known PMEPA1 gene isoforms. Further, we used the HISAT2 (alignment), StringTie (assembler of RNA-Seq alignments into potential transcripts), and Ballgown (annotation) workflows to discover new isoforms and estimate their expressions. Exon-based quantification was done by fragments per kilobase of exon per million reads mapped (FPKM). The expression values of the target genes were shown as Log2 transcripts per million reads mapped (TPM).

4.4. Analyses of the Correlation between PMEPA1 Isoform Expression Levels and Clinical Outcome Including Gleason Scores in Prostate Cancer Patients from the TCGA Dataset

The correlations between clinical outcomes including Gleason scores and transcriptomic profiling of PMEPA1 isoforms (a and b) in prostate cancer patients from the TCGA dataset were analyzed. The distribution of Gleason scores by the number of patients was 6 (N = 45), 7 (N = 250), 8 (N = 64), 9 (N = 136) and 10 (N = 4). The associations of transcription levels of PMEPA1 isoforms (a and b) and BCR, metastasis, overall survival (OS) and progression free survival (PFS) rates were analyzed by an unadjusted Kaplan–Meier survival curve and the Multivariable Cox proportional hazard model. The significance was calculated using an unpaired t-test or ANOVA-test. A two-tailed Student’s t-test was used to compare between specific groups within a dataset. A p < 0.05 was considered statistically significant.

4.5. Cell Culture

LNCaP, VCaP, PC3 and DU-145 cells were purchased from ATCC and were maintained in cell culture medium and conditions recommended by the supplier. The LAPC4 cell was a generous gift from Dr. Charles Sawyers (University of California at Los Angeles, Memorial Sloan Kettering Cancer Center, New York, NY, USA), grown in Iscove’s Modified Dulbecco’s Medium with 15% FBS. All the cell lines were routinely tested for mycoplasma contamination with a short tandem repeat (STR) profiling kit (ATCC, catalog no. 135-XV) and a Universal Mycoplasma Detection Kit (ATCC, catalog no. 30-1012K). For androgen and TGF-β treatment, the cells were pre-treated with medium supplemented with 10% charcoal-stripped serum (Gemini Bio-Products, West Sacramento, CA, USA) for 5 days. Then, the synthetic androgen R1881 (PerkinElmer, Waltham, MA, USA) (at 0, 0.1 and 1.0 nM) or TGF-β (R&D Systems, Minneapolis, MN, USA) (0, 5.0 and 25.0 ng/mL) was added for 24 h. The cells were transfected with expression plasmids or siRNAs based on the merchant manual of Lipofectinamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA). Cell counting, cell plating efficiency and colony formation assay were performed as described previously [14]. The Cignal SMAD Dual Luciferase Reporter (luc) Kit (SA Biosciences, Qiagen, catalog No. CCS-017L) was used for the dual luciferase assay according to the supplier’s manual. Promoter activity values were expressed as relative units using a Renilla reporter as the internal normalization.

4.6. Immunoblotting

Whole-cell lysates were collected from cells seeded at 2 × 105 cells per 6 cm dish (Becton, Dickinson and Company, Franklin Lakes, NJ, USA) with ice-cold M-PER mammalian protein extraction reagent (Thermo Fisher Scientific) containing a protease inhibitor cocktail and phosphatase inhibitor cocktails II and III (Sigma-Aldrich, St. Louis, MO, USA). The protein was quantified by BCA Assay (Thermo Fisher Scientific). A total of 30 µg of the protein for each sample was loaded for protein electrophoresis, separated by 4% to 12% Bis–Tris Gel (Invitrogen, Carlsbad, CA, USA) and transferred to a PVDF membrane (Invitrogen). The membrane was incubated for 1 h in a blocking buffer (Tris-buffered saline, 0.1% Tween (TBS-T), 5% nonfat dry milk) followed by incubation overnight at 4 °C with the primary antibody. Following a wash with the TBS-T solution, the blot was incubated with horseradish peroxidase-conjugated secondary antibody, and signals were visualized by an enhanced chemiluminescence system as per the manufacturer’s protocol (GE Healthcare, Chicago, IL, USA). The primary antibodies included anti-AR (Santa Cruz Biotechnology, Dallas, TX USA, catalog. no. sc-816), anti-PMEPA1 (Abnova, Taipei, Taiwan, catalog. no. H00056937-M01), anti-NEDD4 (Millipore, Burlington, MA, USA, catalog. no. 07-049), anti-PSA (Dako, Glostrup Denmark, catalog. no. A05662) and anti-GAPDH-FL335 (Santa Cruz Biotechnology, catalog. no. sc-25778) antibodies. All antibodies were employed at the dilutions suggested by the manufacturers. The whole blot figures can be accessed in the Supplementary Materials.

4.7. Plasmids and siRNAs

The PMEPA1 expression vectors (PMEPA1 isoform a and b) were generated in pcDNA3.1-HA by GenScript. In addition, pCMV-XL5, pCMV-XL5-NEDD4 (GeneID:4737) or pCMV-XL5-AR wild-type and mutant constructs were described previously (14). The pcDNA3.1-TGFBR1 plasmid was purchased from Genescript. Specific siRNA targeting of PMEPA1 isoform a and b and the non-targeted (NT) control (catalog. no. D-001810-10-05) were designed with the IDT Custom Dicer-Substrate siRNA Designer and synthesized by Dharmacon/Fisher Scientific. The siRNA sequences were PMEPA1-a: 5′-CCTTGGACTTGAATGAGGAGGGAG-3′; PMEPA1-b: 5′-CAGTCTCCTGCGAAACCAGGCAA-3′; AR (GeneID:367): 1:1 mixture of 5′-GCAAAGGTTCTCTGCTAGA-3′ and 5′-TCGAGGCCCTGTAACTTG-3′; TGFBR1 (GeneID:7046): 1:1:1 mixture of 5′-GACAUCUAUGCAAUGGGCUUAGUAU-3′, 5′-GCAUCUCACUCAUGUUGAUGGUCUA-3′ and 5′-AGUAAGACAUGAUUCAGCCACAGAU-3′ (19).

5. Conclusions

In summary, this report provides a new paradigm for exploring biomarkers of prostate cancer progression via insights into the differential regulation of AR or TGF-β signaling by PMEPA1-a and PMEPA1-b isoforms, respectively. The results highlight both the cellular context and isoforms as well as how the signaling of specific interactions between signaling pathways contributes to specific isoform functions (Figure 6), revealing a potentially new mechanism of prostate cancer cell adaptation from androgen dependent to androgen independent, TGF-β controlled cell growth. Our data suggest that the PMEPA1 gene utilized the specific isoforms in order to navigate and drive cancer progression. Here, we propose PMEPA1 isoforms (a and b) as candidate biomarkers in order to monitor prostate cancer progression in castration resistance and metastasis via a mechanistic model in which increased PMEPA1-a/PMEPA1-b expression, along with reduced PMEPA1-b expression, drives the progression of prostate cancer.

Figure 6

Evaluation of PMEPA1 isoforms revealed a potentially new mechanism of prostate cancer cell adaptation from androgen dependent to hormone independent, TGF-β controlled cell growth. PMEPA1-b is androgen responsive whereas PMEPA1-a is TGF-β responsive and interferes with TGF-β signaling.