Comparison of an in-house 'home-brew' and commercial ViroSeq integrase genotyping assays on HIV-1 subtype C samples.

BACKGROUND: Roll-out of Integrase Strand Transfer Inhibitors (INSTIs) such as dolutegravir for HIV combination antiretroviral therapy (cART) in sub-Saharan Africa necessitates the development of affordable HIV drug resistance (HIVDR) assays targeting the Integrase gene. We optimised and evaluated an in-house integrase HIV-1 drug resistance assay (IH-Int) and compared it to a commercially available assay, ViroSeq™ Integrase Genotyping kit (VS-Int) amongst HIV-1 clade C infected individuals.
METHODS: We used 54 plasma samples from treatment naïve participants and one plasma sample from a patient failing INSTI based cART. Specimens were genotyped using both the VS-Int and IH-Int assays. Stanford HIV drug resistance database were used for integrase resistance interpretation. We compared the major and minor resistance mutations, pairwise nucleotide and amino-acid identity, costs and assay time.
RESULTS: Among 55 specimens tested with IH-Int, 53 (96.4%) successfully amplified compared to 45/55 (81.8%) for the VS-Int assay. The mean nucleotide and amino acid similarity from 33 paired sequences was 99.8% (SD ± 0.30) and 99.8% (SD ± 0.39) for the IH-Int and VS-Int assay respectively. The reagent cost/sample were 32 USD and 147 USD for IH-Int and VS-Int assay, respectively. All sequenced samples were confirmed as HIV-1 subtype C.
CONCLUSIONS: The IH-Int assay had a high amplification success rate and high concordance with the commercial assay. It is significantly cheaper compared to the commercial assay. Our assay has the needed specifications for routine monitoring of participants on Dolutegravir based regimens in Botswana.

Introduction

The global number of people living with HIV (PLWH) has substantially increased over the past two decades; from 16.9 million by the end of 1994 to 36.9 million PLWH by the end of 2017 [1, 2]. Global access to combination antiretroviral therapy (cART) has also increased resulting in a pronounced decline in morbidity and mortality amongst PLWH compared to those who are not on cART [2-4]. This trend is being seen and replicated globally especially with the global scale-up of universal access to cART [2, 5].

Over 20 antiretrovirals drugs (ARVs) spanning 7 drug classes are available in the armament of anti-HIV medicines available to PLWH [6]. They are available either as single tablet or a combination of two or more ARVs in single tablet regimens (STR) [6].

Dolutegravir (DTG) is a newer, potent, second generation integrase strand transfer inhibitor (INSTI) that is available as a STR combination with tenofovir disoproxil fumarate (TDF) and lamivudine (3TC) [TLD] at an affordable cost to low and middle income countries (LMICs) such as Botswana [7-10]. A majority of countries in sub-Saharan Africa (SSA), a region that is highly burdened by the HIV epidemic will soon have access to TLD [8].

However, there is a rise in pre-treatment and acquired HIV drug resistance (HIVDR) mutations to ‘backbone’ ARVs such TDF, 3TC and non-nucleoside reverse transcriptase inhibitors (NNRTIs) and this is more pronounced in SSA [11, 12]. This could increase the possibility of placing patients on a ‘functional’ DTG monotherapy, which can contribute to development of resistance to DTG. A recent modelling study projects that the impact of HIVDR on AIDS deaths, new infections and ART costs will increase in SSA between year 2016–2030 if pre-treatment HIVDR rates are over 10% [13]. The scale-up of TLD will increase the demand for INSTI drug resistance testing. This will be pronounced amongst PLWH previously exposed to first generation INSTIs such as raltegravir (RAL) as is the case in Botswana and other SSA countries.

DTG has a better safety profile, higher genetic barrier to resistance and better clinical efficacy compared to other ARVs such as efavirenz [9, 10, 14, 15]. However, PLWH with prior exposure to RAL that developed a ‘Q148 mutant virus’ might have reduced susceptibility to DTG reducing its effectiveness [16, 17]. This has also been demonstrated in case reports from resource limited settings (RLS) in-which individuals with prior RAL exposure who were commenced on DTG combination antiretroviral therapy (cART) developed treatment failure with the selection of the Q148 resistance pathway [18, 19].

Resource rich settings recommend HIV genotypic drug resistance testing (GRT) of the reverse transcriptase (RT) and protease (PR) regions prior to ART initiation and at other time points to guide optimal ARV selections [20, 21]. Due to the low rates of INSTI transmitted drug resistance (TDR) mutations, GRT at the integrase region is not routinely recommended unless clinically indicated such as when patients are experiencing virological failure (VF) while on INSTI cART or if there is a high risk of INSTI TDR mutations [20]. In contrast, the World Health Organisation recommends a surveillance and monitoring approach to tackling HIV drug resistance [22]. INSTI TDR have been previously reported [23-25] as well as development of INSTI resistance associated mutations (RAMs) with subsequent virological failure amongst ARV treatment experienced individuals in RLS [18, 26].

There are limited options for GRT and most of these are traditionally prohibitively expensive and have been optimised for HIV-1 clade B strain which is not the predominant clade found in SSA. The ViroSeq™ HIV-1 Integrase RUO Genotyping kit (Celera Corporation, USA) (VS-Int) is a commercial assay that detects for HIVDR mutations in the integrase region of pol gene. Due to the high cost associated with HIVDR commercial assays, many laboratories have developed less expensive optimised in-house Sanger based [27] GRT assays (“home brews”) specific for their most common circulating HIV strains [28-31].

Botswana, with a predominantly HIV-1C epidemic, introduced DTG into its ART treatment programme in June 2016 and currently relies on commercial assays to test for INSTI HIVDR. Genotypic HIVDR testing typically costs between 140–380 USD/ test hindering their use in resource limited settings (RLS) such as in Botswana [32, 33,34].

Increased access to newer classes of ARVs like DTG in resource limited settings (RLS) where often access to HIVDR testing is limited raises the possibility of an increase in INSTI RAM rates. There is an urgent need for more frequent VL monitoring and cost effective in-house INSTI HIVDR testing to ensure effectiveness of DTG based ART.

We therefore sought to optimise and evaluate an in-house “home-brew” integrase drug resistance assay (IH-Int) against a commercial assay, VS-Int, for routine use in Botswana and other countries with a background of HIV-1C infection.

Materials and methods

Study population, specimen panel and preparations

A total of fifty-five (55) stored plasma samples were used in our assessment. We randomly selected fifty four (54) -80°C stored plasma samples from a previously completed study (BHP063) [35]. This study enrolled ART naïve HIV-1 recently infected individuals between January 2012 and December 2015 and it’s described elsewhere [35]. The median plasma HIV-1 RNA load (viral loads [VL]) was 4.3 [Q1, Q3 (3.7, 4.9)] log10 copies/mL quantified by Abbott m2000sp/Abbott m2000rt (Wiesbaden, Germany).

One (1) well characterized plasma sample collected in 2017 from a highly treatment experienced patient who was enrolled in the Botswana Epidemiological ART Treatment Cohort Study (BEAT) and described elsewhere was included in the analysis as it had many INSTI RAMs determined before by the VS-Int assay [18]; The VL was 2.7 log10 copies/ml quantified by Cobas TaqMan/Cobas Ampliprep 48 and 96 systems (Roche Diagnostics, Branchburg, USA).

The Abbott and Cobas TaqMan/Cobas Ampliprep assays for VL quantification and HIV drug resistance testing were all performed at the Botswana Harvard HIV Reference Laboratory (BHHRL) in Gaborone, Botswana. BHHRL is a SADCAS ISO 15189 accredited laboratory and maintains certification of the virology assays through Rush University’s virology quality assurance programme.

Ethical considerations

Ethical clearance for BHP063 and BEAT studies was obtained from the Human Resource Development Committee in Gaborone, Botswana; protocol # HRDC 0638 and HPDME-13/18/1 XI (150) respectively. In addition, BHP063 protocol was approved by the human subjects committee of Harvard T.H Chan School of Public Health (protocol # 20770).

RNA extractions, PCR amplifications and sequencing

VS-Int assay

Genotyping using the VS-Int commercial assay was performed as per the manufacturer’s instructions. Briefly, HIV-1 viral RNA was manually isolated from 500μL of participant’s plasma by cold pelleting under high-speed centrifugation followed by cell lysis, isopropranolol precipitation and cold ethanol-based re-suspension with elution of 30 μL of HIV RNA. A subsequent one step RT-PCR reaction was performed utilising 10μL of the re-suspended viral RNA. The VS-Int sample preparation and genotyping kits contained all the reagents needed for extraction, reverse transcription polymerase chain reaction (RT-PCR) and sequencing steps that utilise four sequencing primers.

IH-Int assay

Briefly, HIV-1 RNA was automatically extracted from 400μL of plasma by using EZ1 Virus Mini Kit v2.0 (Qiagen, Valencia, CA, USA) cartridges that were loaded on an automated EZ1 Advanced XL (Qiagen) machine. A one step RT-PCR reaction mix was prepared comprising; 0.5μL of Transcriptase Enzyme Roche One Step (Roche, Indianapolis, IN, USA), 7 μL of deionised water (dH20), 5 μL of Buffer 5X, 2.5 μL primer mix of 2 μM INFORI (5' GGA ATC ATT CAA GCA CAA CCA GA 3' nucleotide positions relative to HXB2 4059–4081) and INREV-1 (5’-TCT CCT GTA TGC AGA CCC CAA TAT-3’ 3' nucleotide positions relative to HXB2 5244–5267) and 10 μL of the extracted viral RNA template for one reaction mix volume totalling 25 μL.

RT-PCR thermal cycling conditions were; one cycle of 50°C for 30 mins, one cycle of 94 °C for 7 minutes, 10 cycles of 94 °C for 10 seconds, 52.5 °C for 30 seconds, 68 °C for 2 minutes, 35 cycles of 94 °C for 10 seconds, 53 °C for 30 seconds, 68 °C for 2 minutes that increased by 10 seconds with each additional cycle with a final extension step of 68 °C for 5 minutes and a hold at 4 °C. A PCR product of about 1300bp was generated that covered the complete HIV-1 integrase region of pol. For both assays, only one attempt to obtain PCR or sequencing result was used, no repeat testing of samples using both assays was allowed.

The primers and reaction mixes components were adapted and modified from experiments conducted on a population largely infected with a clade C virus [28]. The PCR thermal cycling conditions were adapted and modified from experiments described elsewhere [35, 36]. The RT-PCR products where run on 1% Agarose gel immersed in 1X TBE buffer stained with 3 μL of Ethidium bromide for about 30 mins at 100 volts to verify amplification and correct size of amplicons.

Sequencing

Four sequence mixes (forward primers A and B, reverse primers C and D) that came with the VS-Int genotyping kits were each combined with 8μL of the purified, diluted (where necessary) RT-PCR product. Cycle sequencing parameters (25 cycles) were 96 °C for 10 seconds, 50 °C for 5 seconds, 60 °C for 4 minutes and a hold at 4 °C.

Sanger sequencing for VS-Int and IH-Int was performed using an Applied Biosystems 3130xL Genetic Analyser (Applied Biosystems, California, CA, USA).

IH-Int

Column purification of amplicons was performed with QIAquick PCR purification kits (Qiagen, Hilden, Germany). BigDye terminator cycle sequencing ready reaction kit version 3.1 (Applied Biosystems, Carlsbad CA, USA) was used for Sanger sequencing utilising four primers; HIV+4141 (5' TCT ACC TGG CAT GGG TAC CA 3' nucleotide positions relative to HXB2 4141–4160), INFORI (5' GGA ATC ATT CAA GCA CAA CCA GA 3' nucleotide positions relative to HXB2 4059–4081), INREVII (5' CCT AGT GGG ATG TGT ACT TCT GA 3' nucleotide positions relative to HXB2 5197–5219 and IN4764AS (5' CCATTTGTACTGCTGTCTTAA 3’ nucleotide positions relative to HXB2 4764–4744).

The cycle sequencing reaction mix contained 3.8 μL of dH20, 3 μL of Big Dye 5X sequencing buffer, 1 μL Big Dye terminator, 0.2 μL of 10 μM of each sequencing primer and 2 μL of the purified DNA template to make a total reaction volume of 10 μL. Cycle sequencing parameters were the same as for those used for the VS-Int assay.

Purification of cycle sequencing products was done using ZR-96 DNA sequencing clean-up kit (Zymo research, Irvine, CA, USA) according to manufactures instructions.

Sequence, phylogenetic and mutational analysis

Electropherograms obtained were manually assembled and edited using Sequencher® version 5.0 DNA sequence analysis software (Gene Codes Corporation, Ann Arbor, MI, USA) [37] for both the IH-Int and VS-Int assays respectively. The assembly parameters used were a minimum match percentage of 85% and a minimum overlap of 20 base-pairs for sequences derived by both the IH-Int and VS-Int assays. The generated FASTA files were exported to BioEdit version 7.2.0 software for further analysis [38]. Multiple sequences were aligned using ClustalW Multiple alignment programme [39] embedded in BioEdit [38] using the HXB2 (accession number K03455.1) as reference. The 88 integrase sequences generated by the VS-Int and IH-Int methods were then compared for quality assurance and clustering using molecular phylogenetic analysis by maximum likelihood method in MEGA 7 software [40]. A Phylogenetic tree was constructed using Tamura-Nei substitution model with gamma distribution rates among sites and inferred from 1000 bootstrap replicates [41].

Mutational analysis of sequences was performed using the Stanford HIV drug resistance database algorithm version 8.7 (https://hivdb.stanford.edu/hivdb/by-sequences/) [42]. HIV-1 subtype was determined using REGA HIV-1 subtyping tool version 3.0 (http://dbpartners.stanford.edu:8080/RegaSubtyping/stanford-hiv/typingtool/) [43].

Accession numbers

The 33 pairs of nucleotide sequences obtained in our study were submitted to national center for biotechnology information (NCBI) GenBank and their accession numbers are MN037428 to MN037493. Additional nucleotide sequences from our study are available in Genbank under accession numbers MN462669 to MN462690.

Cost comparison

We calculated the reagents costs by analysing a batch of 12 samples used for the IH-Int and VS-Int assay. Estimated costs involved in the IH-Int and VS-Int assay included all stages from extraction, RT-PCR and sequencing.

Statistical analysis

Statistical analysis was performed using STATA version 14 (Stata Corp, College Station, TX, USA. Major and minor HIVDR mutations obtained from both assays were compared as obtained from the Stanford HIV drug resistance database.

Results

Comparison of PCR and sequencing success rates between the VS-Int and IH-Int assay

From the 55 samples, 44 (80%) and 11 (20%) were from female and male participants respectively. Other baseline characteristics are shown in Table 1. 45 (81.8%) of the samples amplified with the VS-Int assay and 53 (96.4%) amplified with the IH-Int assay, Table 2. Of the 10/55 (18.2%) samples that failed amplification with the VS-Int assay, 9/10 (90%) were able to be amplified by the IH-Int assay, Table 3.

Table 1

Baseline demographics and viral load characteristics of 55 HIV-1C infected individuals.

Characteristic	n (%)
Male	11 (20)
Female	44 (80)
Age in years Median, (Q1, Q3)	29, (25, 34)
VL >1,000 cps/ml; median log10 VL (Q1, Q3) copies/ml	48 (87.3); 4.5 (3.9,4.9)
VL <1,000 cps/ml; median log10 VL (Q1, Q3) copies/ml	7 (12.7); 2.7 (2.2,2.7)

All the study participants were from Botswana. VL, viral load; cps/ml, copies/mL

Table 2

RT-PCR amplification and sequencing success rates of IH-Int and VS-Int assays with further stratification according to viral loads.

		IH-Int	VS-Int
Amplification status of participant samples(n, %) n = 55; median log10 VL (Q1, Q3) cps/ml	Yes;	53 (96.4);4.4 (3.7, 4.8)	45(81.8);4.5 (3.9, 4.8)
	No,	2 (3.6);2.1 & 2.7 log10cps/ml	10 (18.2);3.5 (2.8, 4.5)
Amplification success rate of samples with VL>1,000 cps/ml, n = 48, (%); median log10 VL (Q1, Q3) cps/ml		48 (100);4.5 (3.9, 4.9)	41 (85.4);4.5 (4.1, 4.9)
Amplification success rate of samples with VL<1,000 cps/ml, n = 7, (%); median log10 VL (Q1, Q3) cps/ml		5, (71.4);2.7 (2.6, 2.7)	4, (57.1);2.7 (2.7, 2.8)
Sequencing success rate		50/55 (90.9)	38/55(69.1)

The table shows the two assays RT-PCR performance stratified according to viral loads (VL) less than and greater than 1,000 copies/m. VL, viral load; cps/ml, copies/mL; IH-Int, in-house integrase drug resistance assay; VS-Int, ViroSeq™ HIV-1 Integrase sample preparation and Genotyping kit (Celera Corporation, USA); RT-PCR, reverse transcribed polymerase chain reaction.

Table 3

Samples that failed amplification with each assay, VS-Int (table A) and IH-Int (table B) and how they faired when run with a different assay, IH-Int (table A) and VS-Int (table B) and associated viral loads.

A	PID	VL log10 copies/mL	Amplifica-tion with VS-Int	Amplifica-tion with IH-Int	B	PID	VL log10 copies/mL	Amplifica-tion with IH-Int	Amplifica-tion with VS-Int
1	KKSG41	2.1	N	N		KKSG41	2.1	N	N
2	KKSG42	2.2	N	Y		KKSG51	2.7	N	Y
3	KKSG43	2.7	N	Y
4	KKSG44	3.2	N	Y
5	KKSG45	3.4	N	Y
6	KKSG46	3.5	N	Y
7	KKSG47	3.7	N	Y
8	KKSG48	4.8	N	Y
9	KKSG49	5.4	N	Y
10	KKSG50	5.7	N	Y

Table 3A and B shows the amplification successes of samples that failed amplification with either the VS-Int or IH-Int assay when they were tested with a different assay. PID, participant identification number; N, No; Y, Yes; VL, viral load; IH-Int, in-house integrase drug resistance assay; VS-Int, ViroSeq™ HIV-1 Integrase sample preparation and Genotyping kit (Celera Corporation, USA).

The VS-Int and IH-Int were both a one-step RT-PCR and utilised 4 sequencing primers that covered all of integrase region. Both assays had a similar hands-on and protocol required times, (Fig 1). The VS-Int and IH-Int assays had a sequencing success rate of 38/45 (84.4%) and 50/53 (94.3%), respectively, (Fig 2).

Fig 1

HIV drug resistance testing workflow using an IH-Int and VS-Int assay (panel B).

*estimated hands-on time, ** fixed machinery times, #Thermocycler times, + using Zymogen purification kit;*** on 8 capillary ABI PRISM 3130 xl Genetic Analyser for 12 samples, ±ViroSeq HIV-1 Integrase Sample Prep Kit 4J94-72, ‡ purification (Exonuclease 1). RT-PCR, reverse transcriptase-polymerase chain reaction; IH-Int, in-house “home-brew” integrase drug resistance assay; VS-Int, ViroSeq™ HIV-1 Integrase sample preparation and Genotyping kit (Celera Corporation, USA).

Fig 2

Differences between amplification and sequencing success rates and cost per test run of two assays.

Viral loads for samples successfully amplified by IH-Int, mean (Q1, Q3); 4.4 (3.7, 4.8), 2.2 copies/ml. Viral loads for samples successfully amplified by VS-Int, mean (Q1,Q3),minimum; 4.4 (3.9, 4.8), 2.6 copies/ml. *S.D = ± 0.30; **S.D = ± 0.39. IH-Int, in-house integrase drug resistance assay; VS-Int, ViroSeq™ HIV-1 Integrase sample preparation and Genotyping kit (Celera Corporation, USA).

Further analysis of both assays on samples with VL greater than 1,000 copies/ml revealed an amplification success rate of 41/48 (85.4%) for the VS-Int and 48/48 (100%) for the IH-Int assay, Table 2. A total of three INSTI mutations were identified by the IH-Int assay and two INSTI mutations were identified by the VS-Int assay, Table 4.

Table 4

Comparison of HIV-1 Integrase drug resistance mutations from three patients detected by sanger sequencing using the IH-Int and VS-Int assay and associated viral loads.

PID	Source	Viral Load cps/ml	Genotyped region	IH-Intdetected mutations	VS-Intdetected mutations
				Integrase region positions	Integrase region positions
KKSG19	Plasma	93,154	Integrase	T97A	T97TA
P1	Plasma	4,745	Integrase	E157Q	N/A*
KKSG06	Plasma	515	Integrase	E138K, G140A, S147G, Q148R, T97A	E138K, G140A, S147G, Q148R, T97A

PID, participant identification number; IH-Int, in-house integrase drug resistance assay; VS-Int, ViroSeq™ HIV-1 Integrase sample preparation and Genotyping kit (Celera Corporation, USA); cps/ml, copies/ml;

* failed to amplify.

From the 50 sequences obtained by the IH-Int assay and 38 sequences obtained by the VS-Int assay, 33 paired sequences were identified. The low number of paired sequences was due to failures in amplification and sequencing by the VS-Int assay. A total of 33 paired sequences revealed a mean amino acid and nucleotide similarity of 99.8% (SD = 0.39) and 99.8% (SD = 0.30) amongst the two assays. All sequenced samples were shown to be of a clade C virus by REGA HIV-1 and 2 subtyping tool [43].

The cost of IH-Int were estimated at 32 USD per sample and the VS-Int estimated at 147 USD to run one sample (reagent costs only) and both have similar run times Table 5, Figs 1–3.

Table 5

Comparison between IH-Int assay and commercial VS-Int resistance assays.

	IH-Int assay	VS-Int assay
Description of assay	One step using 4 sequencing primersHas option of utilising a nested RT-PCR step but this wasn’t used in our comparison	One step RT-PCR using 4 sequencing primersNo option of performing a nested PCR step
Region targeted and positions covered	HIV-1 Integrase region from codons 1–288	HIV-1 Integrase region from codons 1–288
Input sample type	Plasma	Plasma
Volume (μL)	200–400	500
Sample preparation and RNA extraction	Automated EZ1 or manual Qiagen	Manual
Sequencing type	Sanger sequencing using Big Dye chemistry on an ABI PRISM capillary based system	Sanger sequencing using Big Dye chemistry on an ABI PRISM capillary based system
Time to results	17–18 hrs	17–18 hrs
Estimated Costs+	32 USD	147 USD *+
Technical skills	High	High
Laboratory set-up	BSL Level 2 or above	BSL Level 2 or above
Weaknesses	Requires costly infrastructure, high technical skillsNot yet commercially available	Requires costly infrastructure, high technical skills, prohibitively expensive
Strength’s	Very affordable	Commercially available, closed, standardized system from extraction, PCR, sequencing and sequence analysis

+reagent cost only, *For comparison, HIV-1 PR and RT by ViroSeq® assay is about 155–380 USD cost/test (excluding labour) [33], + HIV DNA GRT RT is 286 USD and GRT DNA/RNA is 143 USD [32].

This table is modified and adapted from table 1, supplementary data of [33] and table 5 of [34].

IH-Int, in-house integrase drug resistance assay; VS-Int, ViroSeq™ HIV-1 Integrase sample preparation and Genotyping kit (Celera Corporation, USA);GRT, genotypic resistance test; RT-PCR, reverse transcribed polymerase chain reaction; USD, united states dollars; VL, viral load; PR, protease; RT, reverse transcriptase; BSL, Biosafety level.

Fig 3

Molecular phylogenetic analysis by maximum likelihood method of 88 integrase sequences derived by the ViroSeq™ HIV-1 integrase RUO genotyping kit (VS-Int) and in-house “home-brew” integrase drug resistance assay (IH-Int).

The numbers next to the nodes represent Bootstrap values (1000 replicates) >90.

Discussion

Scale-up of dolutegravir based regimens (DBR) in resource limited settings where HIV-1 clade C is prevalent warrants an urgent need for affordable genotyping HIVDR testing technologies for monitoring INSTI RAMs for patient care and drug resistance surveillance [8, 44]. In this study, we optimised an in-house HIV integrase drug resistance assay and compared it against a commercial ViroSeq™ HIV-1 Integrase sample preparation and genotyping assay for routine monitoring of drug resistance in Botswana.

Our in-house integrase drug resistance assay was able to amplify 100% (n = 48) of patient plasma samples with viral loads greater than 1,000 copies/ml compared to 85.4% (n = 48) amplification success rate with the ViroSeq™ HIV-1 Integrase sample preparation and genotyping assay. Similar VS-Int amplification success rates have also been reported by others [15, 30].

In addition, our IH-Int assay was able to amplify 9/10 (90%) of samples that failed amplification with the ViroSeq™ HIV-1 integrase genotyping assay. The IH-Int assay was able to perform this at approximately a quarter of the cost of the commercial assay.

The higher success rate of the IH-Int could be due to the IH-Int assay having primers that are specific for HIV-1C, while the VS-Int assay primers were designed to cover various HIV-1 subtypes. There is limited published data on the performance of the ViroSeq™ HIV-1 Integrase sample preparation and genotyping assay in HIV-1 non subtype B strains.

Previous studies have shown that the ViroSeq™ Protease-RT assay is less successful with non B HIV-1 subtypes [45, 46]. It is most likely that the VS-Int assay has the same limitations as the ViroSeq™ Protease-RT assay.

At 99.8% and 99.8% nucleotide and amino acid identity respectively between the IH-Int and the VS-Int assays, this demonstrates that the sequences generated by the two assays are similar. The results of the sequences of the patient with multiple INSTI resistance mutations attest to this good concordance with all the INSTI resistance mutations identified by the VS-Int assay being identified with the IH-Int assay.

The profound cost differences associated with our IH-Int assay in the era of DBR scale-up are encouraging. This high level of RT-PCR success rates and cost savings is similar to what has been traditionally observed with other in-house HIV drug resistance assays [30, 31, 47, 48].

We did not evaluate our assay amongst non-clade C panel of HIV viruses, as most countries in sub-Saharan Africa have a predominantly clade-C epidemic which may makes our assay applicable to these settings. Our sample size and volumes did not permit an evaluation of reproducibility and specificity hence they were not assessed but are in the future directions. A better in-house HIVDR assay for patient care would be one that quantifies viral loads, measures ARV drug levels and detects for drug resistance mutations in the integrase, reverse transcriptase and protease region of HIV-1 pol gene in one step which could ideally be packaged into a point of care test.

In conclusion, our in-house assay had a high amplification success rate and high concordance with the commercial assay and it is significantly less expensive than the commercial assay.

Our In-house integrase assay has the required specifications to be used in HIV-1 clade C infected individuals for routine monitoring of integrase RAMs in Botswana.

23 Jul 2019

PONE-D-19-15741

Validation of an affordable and sensitive in-house HIV-1 subtype C integrase genotyping assay

PLOS ONE

Dear 65Dr Gaseitsiwe,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

There are some very helpful comments from the two reviewers. I would encourage you to address these in your revision. Please note there are some additional comments from reviewer #2 in the attached file - let me know if you are unable to access the file/comments.

==============================

We would appreciate receiving your revised manuscript by Sep 06 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Richard John Lessells, BSc, MBChB, MRCP, DTM&H, DipHIVMed, PhD

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1) Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2) We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: N/A

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: PONE-D-19-15741

Validation of an affordable and sensitive in-house HIV-1 subtype C integrase genotyping assay

This manuscript describes the technical validation of an HIV-1 integrase in-house genotyping assay and compares the cost with its commercial counterpart. Given the recent introduction of integrase inhibitors in many countries, this is a valuable contribution to the scientific community, however there are some limitations to the work.

Major comments:

1. When processing the samples, were repeat testing for PCR and/or sequencing allowed or was only 1 attempt to obtain a result allowed. This should be included in the materials and methods. Especially the poor sequencing success rate is unexpected for samples with a suitable PCR product

2. At what level was mixed based calling performed? 20%, 25%, were the same rule applied for VS-Int and IH-Int since different sequence analysis software was used.

3. Why were there only 33 paired sequences available, is this caused by the inability to obtain good sequence quality for a number of specimens using VS-Int

4. Table 4, I don’t think it is correct to say that VS-Int did not pick up the mutation (nil) because there was no PCR product available for this specimen. I would rather change nil to N/A or even remove it from the table

5. I think the statement on line 359 regarding the IH assay’s ability to detect more mutations is incorrect. If sample P1 failed to amplify using VS, one cannot make a statement regarding the inability to detect that mutation. For KKSG19 the mutation T97A was detected by both assays, albeit it being a mix for VS. In addition, based on the limited number of specimens with DRMs, no strong statement should be made regarding the ability to detect mutations.

6. Clarify statement on line 371-372: “there is also a lower… by the VS Int assay.

7. Table 5 includes the option of utilising a nested RT-PCR step for IH-Int. Was nested PCR performed for any of the samples, if yes, for how many? And how did this impact the success rate of the IH assay?

8. Were reproducibility and specificity assessed for the IH assay. I think it is important to show that the same results (for PCR and sequencing) can be obtained when the same sample is repeated. If not yet done, reproducibility should be assessed and results should be included in the manuscript.

9. I understand that samples with InSTI mutations are difficult to find, but there have been reports from more than 1 patient from Botswana with InSTI mutations, are those samples available? If not, do you have access to EQA material with InSTI mutations? The inclusion of more samples with InSTI mutations would significantly improve the value of the manuscript

Minor comments:

1. Line 41-42: “…and for IH-int and VS-Int assay respectively” seems to be out of place in this sentence

2. Table 1: second last line looks like an error

3. Table 2 on page 13 seems to be a repeat from table 2 on page 10

4. I don’t see the value of figure 1 as primers seem to cover the same target of interest (both aa 1-288), however the position of the primers seems to be different between the assays.

5. Figure 2 is illegible

Reviewer #2: Thank you for the opportunity to review this very important manuscript.

Major comments:

1. The validation appears to be incomplete as a number of experiments which are usually part of a start validation exercise are missing. The following experiments would have added more value to the validation:

i) Validation should ideally include a set of sample on know genotypes - preferably EQA samples or samples genotyped by another method other than the methods being compared.

ii) Serially diluting a high viral load sample 3-5 samples (each dilution having at least 3 replicates) to determine the dynamic range of amplification of the method being validated (and that of the comparator) - this is ideal done using EQA samples/panel of samples.

iii). Testing the replicates on different days or in different runs (The report does not indicated over how many runs and days the experiments were done).

Otherwise, this is just a head to head comparison of two methods.

2. The performance of the two assays should be measure with the percentage of genotypes obtained from the initial samples tested. The percentage of samples amplified is an interim result. So the main results in terms of the performances of the two assays should be 50/55 (91%) vs 38/55 (69%).

Minor comments

1. Since the primers and the method used for the in-house method were adopted and modified from a previously published paper, the authors should provide details of the new primers including sequences and HXB2 position.

2. The phylogenetic tree, figure 4, should contain all 88 sequences generated from sequencing using the two methods (50 from the In-house method and 38 from VS.

3. Figure 3 is not clear

4.All the sequences above should also be submitted to Genbank instead of just the 33 pairs.

5. Please the comments on the attached file for the rest of the comments.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Justen Manasa

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

Submitted filename: PONE-D-19-15741_reviewer_13072019.pdf

Click here for additional data file.

9 Sep 2019

Reviewer #1: PONE-D-19-15741

Validation of an affordable and sensitive in-house HIV-1 subtype C integrase genotyping assay

This manuscript describes the technical validation of an HIV-1 integrase in-house genotyping assay and compares the cost with its commercial counterpart. Given the recent introduction of integrase inhibitors in many countries, this is a valuable contribution to the scientific community; however there are some limitations to the work.

Major comments:

1. When processing the samples, were repeat testing for PCR and/or sequencing allowed or was only 1 attempt to obtain a result allowed. This should be included in the materials and methods. Especially the poor sequencing success rate is unexpected for samples with a suitable PCR product

Response:

Thank you for pointing this out. Only one attempt to obtain results was allowed, there was no multiple testing on the same sample. We have included in the material and methods section, line 182 the following; “For both assays, only one attempt to obtain PCR or sequencing result was used, no repeat testing of samples using both assays were allowed.”

2. At what level was mixed based calling performed? 20%, 25%, were the same rule applied for VS-Int and IH-Int since different sequence analysis software was used.

Response:

Thank you for pointing this out. We had attempted to keep the VS-INT manufacturer’s instruction. In the revised manuscript, in order to avoid bias we have reanalysed sequences using Sequencher 5.0 for both assays-the VS-Int and IH int. This re-analysis did not have any impact in the results. We have modified and included in the materials and methods section, under sub-heading Sequence, phylogenetic and mutational analysis from line 215 the following; “Electropherograms obtained were manually assembled and edited using Sequencher® version 5.0 DNA sequence analysis software (Gene Codes Corporation, Ann Arbor, MI, USA) (36) for both the IH-Int and VS-Int assays respectively. The Sequencher assembly parameters used were a minimum match percentage of 85% and a minimum overlap of 20 base pairs for sequences derived by both the IH-Int and VS-Int assays”.

3. Why were there only 33 paired sequences available, is this caused by the inability to obtain good sequence quality for a number of specimens using VS-Int

Response:

We have included the following in line 307; “From the 50 sequences obtained by the IH-Int assay and 38 sequences obtained by the VS-Int assay, 33 paired sequences were identified. The low number of paired sequences was due to failures in amplification and sequencing by the VS-Int assay”.

As shown in Table 2 the amplification success rate for VS-Int was 82% as compared to 96% for the IH-Int, and for samples with viral load > 1000 copies/mL, the amplification success rate for VS-Int was 85% and 100% for the IH-Int assay.

4. Table 4, I don’t think it is correct to say that VS-Int did not pick up the mutation (nil) because there was no PCR product available for this specimen. I would rather change nil to N/A or even remove it from the table

Response:

Thank you for pointing this out, in line 305 table 4 row 3, we have changed ‘nil’ to “N/A”.

5. I think the statement on line 359 regarding the IH assay’s ability to detect more mutations is incorrect. If sample P1 failed to amplify using VS, one cannot make a statement regarding the inability to detect that mutation. For KKSG19 the mutation T97A was detected by both assays, albeit it being a mix for VS. In addition, based on the limited number of specimens with DRMs, no strong statement should be made regarding the ability to detect mutations.

Response:

Thank you for the comment. In line 353, we have modified the first sentence to reflect this clearly, we have deleted “…and was able to detect more INSTI RAMs…”. The sentence in line 353 now reads; “In addition, our IH-Int assay was able to amplify 9/10 (90%) of samples that failed amplification with the ViroSeq™ HIV-1 integrase genotyping assay”.

6. Clarify statement on line 371-372: “there is also a lower… by the VS Int assay.

Response:

In line 365, we have deleted the sentence “There is also a lower likelihood that a mutation could be missed by the IH-Int assay that would otherwise be identified by the VS-Int assay”.

7. Table 5 includes the option of utilising a nested RT-PCR step for IH-Int. Was nested PCR performed for any of the samples, if yes, for how many? And how did this impact the success rate of the IH assay?

Response:

Thank you for highlighting this point. Table 5, line 316, second column under heading “IH-Int assay”, we have modified as follows; “Has option of utilising a nested RT-PCR step available but this wasn’t used in our comparison”.

8. Were reproducibility and specificity assessed for the IH assay. I think it is important to show that the same results (for PCR and sequencing) can be obtained when the same sample is repeated. If not yet done, reproducibility should be assessed and results should be included in the manuscript.

Response:

The tittle of our manuscript has been changed from “Validation of an affordable and sensitive in-house HIV-1 subtype C integrase genotyping assay” to “Comparison of an in-house ‘home-brew’ and commercial ViroSeq integrase genotyping assays on HIV-1 subtype C samples”.

In addition, we have added into the limitations under the discussion line 374 the following; “Our sample size and volumes did not permit an evaluation of reproducibility and specificity hence they were not assessed but are in the future directions.”

9. I understand that samples with InSTI mutations are difficult to find, but there have been reports from more than 1 patient from Botswana with InSTI mutations, are those samples available? If not, do you have access to EQA material with InSTI mutations? The inclusion of more samples with InSTI mutations would significantly improve the value of the manuscript

Response:

Yes the reports of patients with InSTI mutations are correct. There are a few numbers of patients with InSTI mutations in Botswana but were not all part of this sample at the time of this study. We have 1 case of multi-class HIV DR mutations already included in this study. We plan further evaluations beyond subtype C and your suggestions are appreciated. We have since modified the title to reflect this as a comparison study as opposed to a validation.

Minor comments:

1. Line 41-42: “…and for IH-int and VS-Int assay respectively” seems to be out of place in this sentence

Response:

We have modified the sentence and deleted the “…and…”. Line 45 now reads thus; “The mean nucleotide and amino acid similarity from 33 paired sequences was 99.8% (SD ± 0.30) and 99.8 % (SD ± 0.39) for the IH-Int and VS-Int assay respectively.”

2. Table 1: second last line looks like an error

Response:

In table 1,line 263, we have deleted the second last line.

3. Table 2 on page 13 seems to be a repeat from table 2 on page 10

Response:

This is correct, we have deleted table 2 on page 13.

4. I don’t see the value of figure 1 as primers seem to cover the same target of interest (both aa 1-288), however the position of the primers seems to be different between the assays.

Response:

We have removed fig 1 from the manuscript

5. Figure 2 is illegible

Response:

We have included the same fig 2 but with better resolution to improve illegibility. Figure 2 has now been renamed to figure1. In the former fig 2,now fig 1, we have deleted “Including nested PCR total time 21 hours 46 mins 35 sec”in panel A and “Total (excluding nested step)” caption in panel last right column.

Reviewer #2: Thank you for the opportunity to review this very important manuscript.

Major comments:

1. The validation appears to be incomplete as a number of experiments which are usually part of a start validation exercise are missing. The following experiments would have added more value to the validation:

i) Validation should ideally include a set of sample on know genotypes - preferably EQA samples or samples genotyped by another method other than the methods being compared.

Response:

Thank you for pointing this out. The tittle of our manuscript has been changed from “Validation of an affordable and sensitive in-house HIV-1 subtype C integrase genotyping assay” to “Comparison of an in-house ‘home-brew’ and commercial ViroSeq integrase genotyping assays on HIV-1 subtype C samples”.

In addition, we have added into the limitations under the discussion line 374 the following; “Our sample size and volumes did not permit an evaluation of reproducibility and specificity hence they were not assessed but are in the future directions.”

ii) Serially diluting a high viral load sample 3-5 samples (each dilution having at least 3 replicates) to determine the dynamic range of amplification of the method being validated (and that of the comparator) - this is ideal done using EQA samples/panel of samples.

Response:

The tittle of our manuscript has been changed from “Validation of an affordable and sensitive in-house HIV-1 subtype C integrase genotyping assay” to “Comparison of an in-house ‘home-brew’ and commercial ViroSeq integrase genotyping assays on HIV-1 subtype C samples”.

In addition, we have added into the limitations under the discussion line 374 the following; “Our sample size and volumes did not permit an evaluation of reproducibility and specificity hence they were not assessed but are in the future directions.”

iii). Testing the replicates on different days or in different runs (The report does not indicated over how many runs and days the experiments were done).

Otherwise, this is just a head to head comparison of two methods.

Response:

Thank you for highlighting this. This is correct, indeed the tittle of our manuscript has been changed from “Validation of an affordable and sensitive in-house HIV-1 subtype C integrase genotyping assay” to “Comparison of an in-house ‘home-brew’ and commercial ViroSeq integrase genotyping assays on HIV-1 subtype C samples”.

We have added into the limitations under the discussion section about our sample size and volume of samples that did not permit an evaluation of reproducibility and specificity were not assed but are in the future directions.

2. The performance of the two assays should be measure with the percentage of genotypes obtained from the initial samples tested. The percentage of samples amplified is an interim result. So the main results in terms of the performances of the two assays should be 50/55 (91%) vs 38/55 (69%).

Response:

Thank you for pointing this out. This has been corrected in Table 2 line 264. The sequencing success rate has been changed to 50/55 (90.9) for the IH-Int and 38/55 (69.1) for the VS-Int

Minor comments

1. Since the primers and the method used for the in-house method were adopted and modified from a previously published paper, the authors should provide details of the new primers including sequences and HXB2 position.

Response:

Under materials and methods, sub heading RNA extractions, PCR amplifications and sequencing, from line 170, we have modified to include the following; “A one step RT-PCR reaction mix was prepared comprising; 0.5µL of Transcriptase Enzyme Roche One Step (Roche, Indianapolis, IN, USA), 7 µL of deionised water (dH20), 5 µL of Buffer 5X, 2.5 µL primer mix of 2 µM INFORI (5' GGA ATC ATT CAA GCA CAA CCA GA 3' nucleotide positions relative to HXB2 4059-4081) and INREV-1 ( 5’-TCT CCT GTA TGC AGA CCC CAA TAT-3’ 3' nucleotides positions relative to HXB2 5244-5267) and 10 µL of the extracted viral RNA template for one reaction mix volume totalling 25 µL.”

In addition, the sequencing primers used for the IH-Int assay have been included in line 199 and reads thus; “IH-Int. Column purification of amplicons was performed with QIAquick PCR purification kits (Qiagen, Hilden, Germany). BigDye terminator cycle sequencing ready reaction kit version 3.1 (Applied Biosystems, Carlsbad CA, USA) was used for Sanger sequencing utilising four primers; HIV+4141 ( 5' TCT ACC TGG CAT GGG TAC CA 3' nucleotide positions relative to HXB2 4141-4160), INFORI ( 5' GGA ATC ATT CAA GCA CAA CCA GA 3' nucleotide positions relative to HXB2 4059 -4081), INREVII (5' CCT AGT GGG ATG TGT ACT TCT GA 3' nucleotide positions relative to HXB2 5197-5219 and IN4764AS (5' CCATTTGTACTGCTGTCTTAA 3’ 4764-4744)”.

2. The phylogenetic tree, figure 4, should contain all 88 sequences generated from sequencing using the two methods (50 from the In-house method and 38 from VS.

Response:

Thank you for highlighting this. The phylogenetic tree figure 4, is now figure 3. We have included a phylogenetic tree including all the sequences and a reference strain.

In addition, this has been included in the manuscript from line 222; “The 88 integrase sequences generated by the VS-Int and IH-Int methods were then compared for quality assurance and clustering using molecular phylogenetic analysis by maximum likelihood method in MEGA 7 software (39). The Phylogenetic tree was constructed using Tamura-Nei substitution model with gamma distribution rates among sites and inferred from 1000 bootstrap replicates (fig3) (40)”.

3. Figure 3 is not clear

Response:

Fig 3 has been renamed fig 2. The figure has been reattached with a better resolution.

4.All the sequences above should also be submitted to Genbank instead of just the 33 pairs.

Response:

The 33 paired sequences have been submitted to Genbank and the accession numbers are available and are included in line 247 under materials and methods and subheading accession numbers; “The 33 pairs of nucleotide sequences obtained in our study were submitted to national center for biotechnology information (NCBI) GenBank and their accession numbers are MN037428 to MN037493”.

We are in process of submitting to GenBank the remaining sequences.

5. Please the comments on the attached file for the rest of the comments.

Response:

In addition, during revision of table 2 with our data set, we identified some minor corrections; under the IH-Int column, row 3, Q3 is 4.8 not 4.9. Row 4, percentage is 3.6% not 3.8%, and row 5 Q1;Q3 are 2.6 and 2.7 instead of 2.4,2.8.

Under the VS-Int column, row 2 Q3 is 4.8 not 4.9, row 3 Q1;Q2 is 2.8,4.5 not 2.6,5.0 and row 5 Q1,Q3 is 2.7,2.8 not 2.6,2.9.

Submitted filename: PLOS ONE - PONE-D-19-15741_response letter_final.docx

Click here for additional data file.

10 Oct 2019

Comparison of an in-house ‘home-brew’ and commercial ViroSeq integrase genotyping assays on HIV-1 subtype C samples

PONE-D-19-15741R1

Dear Dr. Gaseitsiwe,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements. Please note the two comments from reviewer #2 - it would be appreciated if you could make those minor edits to the manuscript.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Richard John Lessells, BSc, MBChB, MRCP, DTM&H, DipHIVMed, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: I have reviewed all responses provided by the authors. All comments have been adequately addressed and met my expectations.

Reviewer #2: Thank you for sufficiently addressing the comments by the reviewers.

Minor comments:

1. When citing the HIVDB algorithm used for the interpretation of of HIVDR data from sequence data please use the recommended citation (Liu TF, Shafer RW(2006). Web Resources for HIV type 1 Genotypic-Resistance Test Interpretation. Clin Infect Dis 42(11):1608-18. Epub 2006 Apr 28). PLEASE see the following link on how to cite, "" ext-link-type="uri" xlink:type="simple">https://hivdb.stanford.edu/pages/citation.html"

2. Since you analyzing sequence data not mutations, for the HIVDB weblink you should use "" ext-link-type="uri" xlink:type="simple">https://hivdb.stanford.edu/hivdb/by-sequences/" INSTEAD of "" ext-link-type="uri" xlink:type="simple">https://hivdb.stanford.edu/hivdb/by-mutations/"

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: Yes: Justen Manasa

30 Oct 2019

PONE-D-19-15741R1

Comparison of an in-house ‘home-brew’ and commercial ViroSeq integrase genotyping assays on HIV-1 subtype C samples

Dear Dr. Gaseitsiwe:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Richard John Lessells

Academic Editor

PLOS ONE