Literature DB >> 31746362

Suppression of HDAC2 by sodium butyrate alleviates apoptosis of kidney cells in db/db mice and HG‑induced NRK‑52E cells.

Yi Du1, Gang Tang1, Weijie Yuan1.   

Abstract

Butyrate is short‑chain fatty acid, which is produced by intestinal microbiota metabolizing dietary fibers. Butyrate participates in various physiological processes predominantly by activating G‑coupled‑receptors, inhibiting histone deacetylases (HDACs) and serving as an energy substrate. Previous studies have shown that butyrate plays a protective role in diabetic nephropathy (DN); however, the exact mechanism remains unclear. The present study identified that providing sodium butyrate (NaBu) by gavage relieved renal damage and apoptosis in db/db mice, which is a widely used type 2 DN model. In vitro, NaBu suppressed high glucose (HG)‑induced apoptosis in normal rat kidney tubular epithelial (NRK‑52E) cells. Of the eleven HDACs (HDAC1‑11) studied, only the mRNA expression of HDAC2 was attenuated by NaBu in NRK‑52E cells under the HG condition. Overexpression of HDAC2 offset the anti‑apoptotic effect of NaBu. NaBu also suppressed HG‑induced oxidative stress. Additionally, H2O2 induced an upregulation of HDAC2 in NRK‑52E cells, while NaBu inhibited this process. Mechanistically, NaBu acted as an antioxidant in HG‑induced NRK‑52E cells and suppressed HG‑induced apoptosis of NRK‑52E cells through inhibiting HDAC2 by virtue of its anti‑oxidative property.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31746362      PMCID: PMC6889930          DOI: 10.3892/ijmm.2019.4397

Source DB:  PubMed          Journal:  Int J Mol Med        ISSN: 1107-3756            Impact factor:   4.101


Introduction

Diabetes is a devastating disease and is one of the main causes of chronic kidney disease. Lack of effective treatments results in a number of patients developing diabetic nephropathy (DN) (1). Recent studies have demonstrated a close relationship between intestinal microbiota and the occurrence and development of diabetes (2,3) A study by Koh and Rowling (4) indicated that a high fiber diet serves a protective role in the progression of diabetes and DN. Short-chain fatty acids (SCFAs) are one of the major metabolites of the microbiota-mediated fiber fermentation process in the gut (5). Butyrate is a SCFA and has been demonstrated to play a protective role in kidney disease (6,7). Administration of sodium butyrate (NaBu) rescues kidney function in acute kidney injury by reducing apoptosis, increasing autophagy and inhibiting reactive oxygen species (ROS) production (6). NaBu also attenuates the increase in creatinine, decreases mediators of inflammation and decreases tubular damage in contrast-induced nephropathy in vivo (7). The function of butyrate in diabetes has also been studied. Xu et al (8) found that oral NaBu administration significantly alleviates inflammation in db/db mice by correcting intestinal microecological disorder and protecting intestinal barrier integrity. Additionally, intraperitoneal injection of NaBu alleviates streptozotocin (STZ)-induced mice pancreatic injury and inflammatory responses by downregulating the NF-κB pathway (9). Protective effects of butyrate on DN have also been reported. Administration of NaBu (500 mg/kg/day) by intra-peritoneal injection ameliorates fibrosis and inflammation in the kidneys of STZ-induced diabetic rats (10). Dong et al (11) also reported that a diet containing NaBu (5 g/kg/day) alleviates renal dysfunction and mesangial matrix expansion in STZ-induced diabetic mice. The apoptosis of renal cells, particularly renal tubular epithelial cells, is an important factor in the progression of DN (12). To the best of our knowledge, whether butyrate can protect renal tubular epithelial cells from high glucose (HG)-induced apoptosis has not been studied. Therefore, the aims of the present study were to evaluate the function of NaBu in the apoptosis of renal cells in db/db mice, to investigate the function of NaBu in HG-induced apoptosis of NRK-52E cells, and to discuss the specific mechanisms.

Materials and methods

Animals

In total, 20 male db/db mice and 10 male db/m non-diabetic control mice (age, 4 weeks; weight, ~20 g) were purchased from the Nanjing Institute of Model Animals. All mice were kept in the animal center of Shanghai General Hospital at 24°C, 40-70% humidity, with a 12/12 h light/dark cycle and air exchange. Mice had access to food and water ad libitum. At 8 weeks old, db/m mice were randomly divided into control (n=5) and control + NaBu (n=5) groups, and db/db mice were randomly divided into diabetic (DM; n=8), and diabetic + NaBu (DM + NaBu; n=12) groups. Mice in the control + NaBu and DM + NaBu groups were administered 1 g/kg NaBu by oral gavage once a day from Monday to Friday. Mice in the other two groups were given the same volume of distilled water. The mice were euthanized by intraperitoneal injection of sodium pentobarbital (100 mg/kg) after 12 weeks of treatment. No mouse died prior to euthanasia. Death of the mice was verified by confirmation of cardiac arrest. During the experiments, the health and behavior of mice were monitored daily. Blood glucose levels were recorded on Mondays at weeks 6, 8, 12, 16 and 20 after birth. Urine was collected on Monday morning of week 20. Urinary albumin and creatinine were detected on a fully automatic biochemical analyzer (Rayto Life and Analytical Sciences Co., Ltd.). The ratio of urinary albumin to creatinine (UACR) was calculated using Excel 2016 (Microsoft Corporation). All animal-related experiments were approved by the Institutional Animal Care and Use Committee of Shanghai General Hospital and were in compliance with the Guide for the Care and Use of Laboratory Animals and the U.S. National Institutes of Health. The project number is 2019DW001.

Cell culture

NRK52E cells were purchased from the China Center for Type Culture Collection, and were cultured in Dulbecco's modified Eagle's medium (DMEM; HyClone; GE Healthcare; 5.6 mmol/l glucose) with 5% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) and 100 U/ml penicillin/streptomycin (NCM Biotech) at 37°C with 5% CO2. Prior to treatment, cells were cultured in serum-free media for 10-12 h. Then, cells were divided into the following experimental groups: i) Normal glucose group, DMEM with 5.6 mM glucose for 48 h; ii) HG group, DMEM with 25 mM glucose for 48 h; iii) NaBu or TSA intervention groups (HG + NaBu or HG + TSA), high glucose DMEM with additional NaBu (0.1, 0.5 or 1.0 mmol) or TSA (cat. no. Hy-15144; MedChemExpress; 0.1 µmol) for 48 h. Cells were treated at 37°C.

Transfection with pEGFP-C1-HDAC2 plasmid

pEGFP-C1-HDAC2 plasmid and the corresponding empty vector pEGFP-C1 were purchased from Shanghai Gene Pharma Co., Ltd. The NRK-52E cells were seeded into 6-well plates in Opti-MEMR medium (Gibco; Thermo Fisher Scientific, Inc.) and transfected with plasmids using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The final concentration of plasmids was 1.25 ng/µl. Treatments were applied to cells after 6 h.

Immunohistochemistry

Kidneys were harvested post-mortem and fixed in 4% paraformaldehyde at 4°C overnight, embedded in paraffin and cut into 5-µm thick sections. Following heat treatment at 96°C with citrate solution for antigen retrieval and blocking with 3% bovine serum albumin (cat. no. A8020; Solarbio Science & Technology Co., Ltd.) at room temperature for 30 min, sections were incubated with primary antibody against HDAC2 (1:500; cat. no. GB11371; Wuhan Servicebio Technology Co., Ltd.) at 4°C overnight. Following incubation with goat anti-rabbit secondary antibody (1:200; cat. no. GB23303; Wuhan Servicebio Technology Co., Ltd.) at room temperature for 50 min, slides were treated with a 3,3′-diaminobenzidine kit (cat. no. K5007; Dako; Agilent Technologies, Inc.). Images were captured using a light microscope (magnification, ×40).

Western blot analysis

Proteins of the mice kidneys and NRK-52E cells were isolated using RIPA lysis buffer (Beyotime Institute of Biotechnology) containing PMSF (Beyotime Institute of Biotechnology) and phosphatase inhibitors (NCM Biotech). The quality and concentration of protein were detected using NanoDrop (Thermo Fisher Scientific, Inc.). Protein samples mixed with loading buffer were denatured by boiling for 10 min and then 40 µg protein was added to each lane and separated by 10% SDS-PAGE for HDAC2 or 12.5% SDS-PAGE for Bcl-2 and Bax. Subsequently, the proteins were transferred onto a polyvinylidene difluoride membrane. Membranes were incubated with primary antibodies against the following at 4°C overnight: HDAC2 (1:1,000; cat. no. 2540S; Cell Signally Technology, Inc.), Bcl-2 (1:1,000; cat. no. abs131701; Absin Bioscience Inc.), Bax (1:1,000; cat. no. 14796S; Cell Signaling Technology, Inc.) and β-actin (1:1,000; cat. no. abs119600; Absin Bioscience Inc.). Subsequently, the membranes were incubated with goat anti-rabbit secondary antibody (1:10,000; cat. no. abs20002; Absin Bioscience Inc.) at room temperature for 2 h. Protein bands were visualized using ECL reagents (NCM Biotech), and blots were quantified with Image-pro Plus 6.0 (Media Cybernetics, Inc.).

RNA extraction and reverse transcription-quantitative PCR (RT-qPCR)

TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was used to isolate total RNA from NRK-52E cells. Samples that contained 500 ng total RNA were reverse transcribed with Prime Script™ RT Master mix kit (Takara Bio, Inc.) and qPCR was performed with the TB Green™ Premix Ex Taq™ kit (Takara Bio, Inc.), according to the manufacturers' protocols. The thermocycling conditions were as follows: 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec and 60°C for 30 sec. The primers are listed in Table I. GADPH was used as the reference gene. The data were quantified using the 2−ΔΔCq method (13).
Table I

Primer sequences for reverse transcription-quantitative PCR.

GenePrimer sequence (5′-3′)
ForwardReverse
HDAC1ATGAAGCCTCACCGAATCCGAATGCTTGGTCATCTCCTCAGCGTTGG
HDAC2CGAGCATCAGACAAGCGGATAGCAGCGACATTCCTACGACCTCCTTC
HDAC3CCAAGACCGTGGCGTATTTCCTCAGAATGGAAGCGGCACA
HDAC4GGCTTCCTTGTGGTGGTGTTGGTGTACTCTCCTCGGCATGGTGTC
HDAC5GCAGCAGCACCAGCAGTTCCCCGTCAGCTCCTCCTCTGTCTC
HDAC6AGAAGCACCGCATTCAGAGGATTCGCCAGAACCGACCATGCTCATAG
HDAC7AGGAGGTGCGGTGGTGTTGGGAGCGGATGGCATTGAGGTTGG
HDAC8GTATGTCCTTCAGTGGCAGTTGGCCGGTCAAGTATGTCCAGCAACGAG
HDAC9CTGGAGAAACCTGCCAAGTATGGGTGGAAGAATGGGAGTTGCT
HDAC10TTCCAGCCTGACATGGTGTTGATGTCCGAAGCATTGCAGCCAAGAG
HDAC11GGCACGAGCGAGACTTCATGGCAACTCCACCTTCCGCCTGATG
GADPHCTGGAGAAACCTGCCAAGTATGGGTGGAAGAATGGGAGTTGCT

HDAC, histone deacetylase.

Quantification of apoptosis by flow cytometry

Following trypsinization, cells were collected and washed with PBS twice. The cells were then resuspended and stained with Annexin V-FITC for 15 min and propidium iodide for 5 min (BestBio Company). Apoptosis was quantified using a BD LSR flow cytometer (BD Biosciences). The BD Accuri™ C6 software (version 1.0.264.21; BD Biosciences) was used for analysis. The apoptosis of NRK-25E cells was also detected by flow cytometry at 12, 24 and 48 h after treatment.

Assay of caspase-3 activity

A caspase-3 activity assay kit (cat. no. BB-4106; BestBio Company) was used to detect the activity of caspase-3 in different groups, according to the manufacturer's protocol. A multimode reader (Thermo Fisher Scientific, Inc.) was used to measure the absorbance at 405 nm of different samples.

HDAC activity

NE-PER nuclear and cytoplasmic extraction reagents (cat. no. 78833; Pierce; Thermo Fisher Scientific, Inc.) were used to separate the nuclear and cytoplasmic components. The cytoplasmic extraction reagents I and II and nuclear extraction reagent were added to the cells sequentially. Following oscillation and centrifugation, the supernatant (nuclear extract) was collected. Diluted nuclear extract was mixed with HDAC assay buffer and HDAC colorimetric substrate (cat. no. K331; BioVision). Following incubation at 37°C for 1 h, lysine developer was used to terminate the reaction. Activities of HDAC in different samples were reflected by the optical density values at 405 nm, which were detected by a multimode reader (Thermo Fisher Scientific, Inc.).

HDAC2 activity

A colorimetric assay kit (cat. no. GMS50082; Genmed Scientifics, Inc.) was used to assess HDAC2 activity. Nuclear extract was mixed with colorimetric substrate. The substrate is deacetylated and produces a fluorophore following treatment with aminopeptidase. The absorbance at 405 nm of each group was measured by a multimode reader (Thermo Fisher Scientific, Inc.).

TUNEL assay

A POD kit (cat. no. 11684817910; Roche Diagnostics) was used to measure TUNEL-positive apoptotic cells in tissue sections. Kidneys were harvested post-mortem and fixed in 4% paraformaldehyde at 4°C overnight, embedded in paraffin and cut into 5-µm thick sections. Renal paraffin sections (5-µm) were de-waxed and incubated with protease K. Subsequently, the sections were treated with the TUNEL reaction mixture and incubated for 60 min in a water bath at 37°C. DAPI (Beyotime Institute of Biotechnology) was used to stain nuclei. Images were obtained using a fluorescence microscope (magnification, ×20). Five fields of vision were randomly selected for each slice.

ROS assay

A ROS detection kit (cat. no. BB-47053; BestBio Company), which detects ROS by the DCFH-DA method, was used. DCFH-DA crosses cell membranes freely. When DCFH-DA enters cells, it is hydrolyzed by intracellular enzymes to non-fluorescent DCFH, which can't cross the cell membrane. In the presence of ROS, DCFH can be oxidized to highly fluorescent DCF (14). The level of ROS in cells was determined by detecting the fluorescence of DCF with a confocal microscope (magnification, ×63) and flow cytometer. The BD Accuri™ C6 software (version 1.0.264.21; BD Biosciences.) was used for analysis.

Superoxide dismutase (SOD) and lactate dehydrogenase (LDH) assays

The activities of SOD and LDH were detected using SOD (cat. no. A001-3-2; Nanjing Jiancheng Bio-engineering Institute Co., Ltd.) and LDH assay kits (cat. no. A020-2; Nanjing Jiancheng Bio-engineering Institute Co., Ltd.). The protein extracts were incubated with working solutions according to the manufacturer's protocols and then the absorbance was measured with a multimode reader at 405 nm.

CCK-8 assay

Cell viability was detected using a CCK-8 assay kit (cat. no. CK04; Dojindo Molecular Technologies, Inc.). NRK-52E cells were seeded in 96-well plates at a density of 2,000/well. Following treatment with different concentrations of NaBu (0.1, 0.5 and 1 mM) at 37°C for 48 h, 10 µl CCK-8 solution was added to each well and incubated at 37°C for 1 h. The absorbance at 450 nm of each group was measured by a multimode reader (Thermo Fisher Scientific, Inc.).

Treatment with hydrogen peroxide (H2O2) and N-acetylcysteine (NAC)

H2O2 (200 µmol) or NAC (5 mM) were added to NRK-52E cells with or without NaBu (0.5 mM) at 37°C for 48 h.

Statistical analysis

Statistical analysis was conducted using SPSS version 22.0 (IBM Corp.). Data are expressed as the mean ± standard deviation. Comparisons between two groups were analyzed with an independent Student's t-test. One-way ANOVA followed by the Student-Newman-Keuls post-hoc test was used to analyze the differences between multiple groups. P<0.05 was considered to indicate a statistically significant difference.

Results

NaBu protects against renal cells apoptosis in db/db mice

Due to the onset of diabetes, the mice in the DM and DM + NaBu groups developed significantly higher blood glucose levels from week 8 onwards compared with the control groups. NaBu had no effect on the blood glucose levels of diabetic mice (Fig. 1A). The ratio of urinary albumin/creatinine in the DM group was significantly higher compared with the ratio of the control group, as well as the DM + NaBu group (Fig. 1B). Western blot analysis indicated that HG significantly upregulated Bax and downregulated Bcl-2 in the kidney of mice, while NaBu reversed these effects (Fig. 1C). NaBu also significantly inhibited the activity of caspase-3 in diabetic kidneys (Fig. 1D). A significantly higher number of TUNEL-positive cells were observed in the DM group compared with the control group, while the DM + NaBu group had significantly fewer TUNEL-positive cells compared with the DM group (Fig. 1E). The control + NaBu group exhibited no significant difference with the control group in the aforementioned indicators.
Figure 1

NaBu protects against renal cells apoptosis in db/db mice. (A) Blood glucose levels in mice were monitored at 6, 8, 12, 16 and 20 weeks after birth. (B) Urinary albumin to serum creatinine ratio at week 20. (C) Expression of Bax and Bcl-2 in the kidney of mice measured by western blot analysis. (D) Caspase-3 activity in the kidney of mice. Data are presented as the means ± standard deviation (control group, n=5; control + NaBu group, n=5; DM group, n=8; DM + NaBu group, n=12). **P<0.01 vs. control group; ##P<0.01 vs. DM group. NaBu, sodium butyrate; DM, diabetic mellitus. (E) Representative TUNEL staining image of renal sections in mice. (F) Numbers of TUNEL positive cells/cm2 in different groups compared with the control. Scale bars, 200 µm. Data are presented as the means ± standard deviation (control group, n=5; control + NaBu group, n=5; DM group, n=8; DM + NaBu group, n=12). **P<0.01 vs. control group; ##P<0.01 vs. DM group. NaBu, sodium butyrate; DM, diabetic mellitus.

NaBu suppresses HG-induced NRK-52E cells apoptosis

Cell viability was detected by CCK-8 assay. The results demonstrated that NaBu relieved the HG-induced decrease in the viability of NRK-52E cells (Fig. 2A). In HG conditions, the activity of caspase-3 and expression of Bax in NRK-52E cells was significantly upregulated, while the expression of Bcl-2 was significantly downregulated (Fig. 2B and C). NaBu reversed the changes in apoptosis-related proteins induced by HG (Fig. 2B and C). The results of flow cytometry analysis further demonstrated that NaBu inhibited HG-induced apoptosis of NRK-52E cells (Fig. 2D). The results of flow cytometry analysis also showed that with an increase of treatment time, the pattern of apoptosis of NRK-52E cells gradually changed from early apoptosis to late apoptosis (Fig. S1).
Figure 2

NaBu suppresses HG-induced NRK-52E cells apoptosis. (A) The influence of different concentrations of NaBu (0.1, 0.5 and 1.0 mmol/l) on cell viability was detected by CCK8 assay. (B) Caspase-3 activity in different experimental groups. (C) Expression of Bax and Bcl-2 was analyzed by western blotting. (D) Flow cytometry analysis of apoptosis in NRK-52E cells. Cells in right upper quadrant were defined as late apoptotic cells, and cells in lower right quadrant were defined as early apoptotic cells. Cells in the above two quadrants were considered apoptotic cells. Data are presented as the mean ± standard deviation (n=3). **P<0.01 vs. NG group; #P<0.05, ##P<0.01 vs. HG group. NaBu, sodium butyrate; HG, high glucose; NG, normal glucose.

NaBu suppresses HG-induced NRK-52E cell apoptosis by inhibiting HDAC2

The present study found that additional NaBu significantly suppressed the increased activity of HDACs in HG-induced NRK-52E cells (Fig. S2A). TSA, a nonselective inhibitor of HDAC, inhibited the activity of caspase-3 and the expression of Bax, while it induced an upregulation of Bcl-2 compared with HG group (Fig. S2B and C). Flow cytometry analysis also demonstrated that TSA exhibited a similar anti-apoptotic function in HG-induced NRK-52E cells with NaBu (Fig. S2D). It was assumed that the anti-apoptotic functions of NaBu in HG-stimulated NRK-52E cells were mediated by inhibition of HDACs. Using RT-qPCR analysis it was identified that out of the eleven HDACs (HDAC1-11) studied, only the mRNA expression of HDAC2 was significantly attenuated by NaBu in NRK-52E cells with HG (Fig. 3A). Western blot analysis revealed that NaBu significantly suppressed the expression of HDCA2 in the kidneys of db/db mice and HG-induced NRK-52E cells (Fig. 3C and D). In addition, NaBu significantly inhibited the activity of HDAC2 in HG-induced NRK-52E cells (Fig. 3B). The expression of HDAC2 was mainly concentrated in the nucleus. Through the immunohistochemical analysis, it was revealed that the staining of HDAC2 in the nuclei of DM group appeared more brown compared with the control and DM + NaBu groups (Fig. 3E). These results indicated that NaBu inhibited the expression of HDAC2 in the kidney of db/db mice as well as HG-induced NRK-52E cells.
Figure 3

NaBu inhibits HG-induced upregulation of HDAC2 in vivo and in vitro. (A) NRK-52E cells were cultured under HG with or without NaBu (1 mM), and the mRNA expression of each subtype of HDACs was measured by RT-qPCR. (B) The activity of HDAC2 in NRK-52E cells. Western blot analysis of the expression of HDAC2 in (C) NRK-52E cells and (D) the kidney of db/db mice. (E) Representative images of immunohistochemistry analysis of HDAC2 in the kidney of db/db mice (scale bar, 100 µm). Data are presented as the mean ± standard deviation (n=3). **P<0.01 vs. NG group; ##P<0.01 vs. HG group. NaBu, sodium butyrate; HG, high glucose; NG, normal glucose; HDAC, histone deacetylase; RT-qPCR, reverse transcription-quantitative PCR; DM, diabetic mellitus.

To further understand the function of HDAC2 in the apoptosis of HG-induced NRK-52E cells, HDAC2 was overexpressed by transfecting NRK-52E cells with pEGFP-C1-HDAC2 (Fig. 4A). Over-expression of HDAC2 significantly suppressed the anti-apoptotic function of NaBu or TSA in HG-induced NRK-52E cells; caspase-3 activity and Bax expression were upregulated, while the expression of Bcl-2 was downregulated compared with the cells transfected with a control plasmid (Fig. 4B and C). Similar results were observed by the flow cytometric analysis of apoptosis in different groups (Figs. 4D and S3).
Figure 4

NaBu suppresses HG-induced apoptosis of NRK-52E cells by inhibiting HDAC2. (A) Effects of pEGFP-C1-HDAC2 on the expression of HDAC2 in NRK-52E cells cultured in DMEM with 5.5 mM glucose. Effects of overexpression of HDAC2 on (B) the activity of caspase-3 and (C) the expression of Bax and Bcl-2. (D) Effects of overexpression of HDAC2 on the apoptosis of NRK-52E cells, as analyzed by flow cytometry. Data are presented as the mean ± standard deviation (n=3). **P<0.01 vs. NG group; ##P<0.01; &&P<0.01. NaBu, sodium butyrate; HG, high glucose; NG, normal glucose; HDAC, histone deacetylase; TSA, trichostatin A.

NaBu suppresses the activity and the expression of HDAC2 by alleviating oxidative stress in HG-induced NRK-52E cells

Previous studies have suggested that oxidative stress is associated with the activity of HDACs (15,16). Oxidative stress has an important role in HG-induced apoptosis and the development of DN (17). The images of confocal microscopy revealed that compared with cells in the HG group, cells in the HG + NaBu group exhibited darker DCF fluorescence (Fig. 5A), indicating that NaBu suppressed HG-induced production of ROS in NRK-52E cells. Similar results were observed by flow cytometry analysis (Fig. 5B). It was also identified that NaBu significantly suppressed the level of LDH but increased the level of SOD in HG-induced NRK-52E cells, which further demonstrated the antioxidant effect of NaBu (Fig. 5C and D). To study the relationship between ROS and HDAC2, normal NRK-52E cells were treated with H2O2 (200 µM), which resulted in a significant increase in the activity and expression of HDAC2 (Fig. 6A and B). Administering NAC (5 mM) to the cells under HG-treatment significantly inhibited the expression of HDAC2 but did not have a significant effect on the activity of HDAC2 (Fig. 6A and C). Additionally, H2O2 offset the inhibitory effect of NaBu on HDAC2 expression in NRK-52E cells (Fig. 6D). In conclusion, NaBu acted as an antioxidant in HG-induced NRK-52E cells and suppressed HG-induced apoptosis of NRK-52E cells via inhibiting HDAC2 by virtue of its anti-oxidative property (Fig. 7).
Figure 5

NaBu suppresses oxidative stress induced by HG in NRK-52E cells. (A) ROS in NRK-52E cells were detected by fluorescence signals using the DCFH-DA assay kit and imaged by confocal microscope. (B) ROS level was determined by flow cytometry. (C) SOD and (D) LDH level in NRK-52E cells. Scale bars, 25 µm. Data are presented as the mean ± standard deviation (n=3). **P<0.01 vs. NG group; ##P<0.01 vs. HG group. NaBu, sodium butyrate; HG, high glucose; NG, normal glucose; ROS, reactive oxygen species; SOD, superoxide dismutase; LDH, lactate dehydrogenase.

Figure 6

NaBu inhibits the expression of HDAC2 by alleviating oxidative stress. The effect of H2O2 (200 µM) on the (A) activity and (B) expression of HDAC2. The effect of NAC (5 mM) on the (A) activity and (C) expression of HDAC2. (D) Effect of NaBu (1 mM), H2O2 (200 µM) or NaBu (1 mM) + H2O2 (200 µM) on the expression of HDAC2 in HG-induced NRK-52E cells was determined by western blotting. Data are presented as the mean ± standard deviation (n=3). **P<0.01 vs. NG group; ##P<0.01 vs. HG group; &&P<0.01 vs. HG + NaBu group. NaBu, sodium butyrate; HDAC2, histone deacetylase 2; H2O2, hydrogen peroxide; NAC, N-acetylcysteine; HG, high glucose; NG, normal glucose.

Figure 7

Anti-apoptotic mechanism of NaBu in HG-induced NRK-52E cells. The arrows indicate positive action and the other lines indicate negative action. NaBu, sodium butyrate; HG, high glucose; H2O2, hydrogen peroxide; NAC, N-acetylcysteine; TSA, trichostatin A; HDAC, histone deacetylase.

Discussion

Butyrate serves a protective role in diabetes and DN; however, the underlying mechanisms remain unclear. The present study focused on the effects and mechanisms of NaBu on the apoptosis of kidney cells in db/db mice and HG-induced NRK-52E cells. The findings revealed that NaBu relieved renal damage and apoptosis of kidney cells in db/db mice. In vitro studies demonstrated that NaBu inhibited HG-induced apoptosis in NRK-52E cells by suppressing the activity and expression of HDAC2. In further experiments, it was revealed that NaBu inhibited the activity and expression of HDAC2 by alleviating oxidative stress. NRK-52E cells were selected for in vitro evaluation of tubular injury in DN, as the extent of interstitial tubular injuries is closely related to the progression of DN (17). It has been reported that HG can activate the intrinsic apoptotic pathways in renal tubular epithelial cells, and the apoptosis-related proteins Bax, Bcl-2 and caspase-3 play crucial roles in this process (18,19). Consistent with previous studies, the present study demonstrated that HG induced upregulation of the pro-apoptosis proteins Bax and caspase-3, and a downregulation of the anti-apoptosis proteins Bcl-2 in NRK-52E cells, which finally led to the apoptosis of cells. Additional use of NaBu alleviated this process. Butyrate, propionate and acetate are major members of SCFAs. All have been reported to act as HDAC inhibitors, and butyrate has been investigated most extensively (20). Histone acetylation can promote gene transcription by increasing accessibility of the transcriptional system. HDAC inhibitors have been used for cancer therapy and suppressing inflammatory responses (21). Chang et al (22) reported that inhibiting HDAC6 attenuated intestinal apoptosis in a rodent model of hemorrhagic shock. HDAC inhibitors play an important role in diabetes treatment. Manea et al (23) demonstrated that HG increases the expression of HDAC1 and HDAC2 in human aortic smooth muscle cell in vitro, while HDAC inhibitor attenuates the structural and functional changes in the vascular wall in diabetes by inhibiting the formation of ROS. Another study suggested that HDAC inhibitor could cooperate with low-dose CD3 antibody to improve the survival and metabolic functions of pancreatic β cells by inhibiting in situ inflammation, leading to alleviation of diabetes (24). Previous studies have indicated that HDAC2 has a close relationship with kidney disease. Noh et al (25) reported that the kidneys of STZ-induced diabetic rats and db/db mice have significantly increased activity of HDAC2. Furthermore, treatment with the HDACs inhibitor TSA or HDAC2-knockdown by small interfering RNA alleviates the TGF-β1-induced epithelial-to mesenchymal transition in NRK-52E cells. Ma et al (26) found that the activity of HDAC2 in kidneys is elevated by cisplatin. TSA or valproic acid could alleviate cisplatin-induced kidney injury and epithelial cell apoptosis by inhibiting HDACs. The present study found that the expression of HDAC2 was significantly elevated in db/db mice and HG-induced NRK-52E cells, which indicated that HDAC2 plays an important role in the development of DN. As a common HDACs inhibitor, butyrate can inhibit most subtypes of HDACs, with the exception of class III HDAC and class II HDAC6 and 10 depending upon cell types and other external factors (27,28). HDAC2 belongs to the class I HDAC. Butyrate has been reported to suppress HDAC2 activity in the liver and hippocampus in the brain (29,30). The present study demonstrated that butyrate could inhibit the expression of HDAC2 in db/db mice and HG-induced NRK-52E cells. As a common HDACs inhibitor, TSA exhibited a similar anti-apoptotic function with NaBu in HG-induced NRK-52E cells. Overexpression of HDAC2 neutralized the anti-apoptotic function of NaBu and TSA. These results suggested that the anti-apoptotic function of NaBu in HG-induced NRK-52E cells was achieved by inhibiting HDAC2. Previous studies have shown that butyrate can alleviate oxidative stress in certain situations. Administering NaBu can inhibit oxidative stress induced by high glucose and LPS in glomerular mesangial cells (27). In addition, butyrate can downregulate NADPH oxidase in endothelial cells and consequently decrease the oxidative stress in atherosclerotic lesion sites (31). Oxidative stress in the proximal colon of mice induced by chronic-binge ethanol feeding can also be inhibited by NaBu (32). The present study identified that NaBu suppresses HG-induced oxidative stress, inhibits the level of LDH and elevates the level of SOD in NRK-52E cells. So far, the mechanism of NaBu in the regulation of HADC activity is not clear. Previous studies have indicated that oxidative stress may have a causal relationship with the activity of HDACs. Miura et al (16) reported that oxidative stress induced by hepatitis C virus can increase HDACs activity and suppress hepcidin expression in hepatoma cell lines. Additionally, Niu et al (15) demonstrated that treating bronchial epithelial cells with H2O2 for 3 h lowered the histone acetylation markers H3K9ac and H4K8ac, and increased the activity of class I/II HDAC. The present study found that additional H2O2 increased HDAC2 activity and the expression of HDAC2 in normal NRK-52E cells. While the anti-oxidative stress molecule N-acetylcysteine (NAC) inhibited HDAC2 expression in HG-induced NRK-52E cells. In addition, H2O2 offset the inhibitory effect of NaBu on HDAC2 expression in NRK-52E cells, which indicated that NaBu influences the activity and expression of HDAC2 by regulating oxidative stress. In summary, the present study discussed the anti-apoptotic effect and related mechanisms of NaBu in the kidney of db/db mice and HG-induced NRK-52E cells. It was identified that NaBu acted as an antioxidant in HG-induced NRK-52E cells and the anti-oxidative property of NaBu was the basis of its anti-apoptotic effect. However, the specific mechanism of NaBu in regulating oxidative stress remains unclear and requires further investigation.
  32 in total

1.  High glucose-induced oxidative stress causes apoptosis in proximal tubular epithelial cells and is mediated by multiple caspases.

Authors:  David A Allen; Steven Harwood; Mira Varagunam; Martin J Raftery; Muhammad M Yaqoob
Journal:  FASEB J       Date:  2003-03-28       Impact factor: 5.191

Review 2.  The role of short-chain fatty acids in health and disease.

Authors:  Jian Tan; Craig McKenzie; Maria Potamitis; Alison N Thorburn; Charles R Mackay; Laurence Macia
Journal:  Adv Immunol       Date:  2014       Impact factor: 3.543

3.  Hepatitis C virus-induced oxidative stress suppresses hepcidin expression through increased histone deacetylase activity.

Authors:  Kouichi Miura; Kojiro Taura; Yuzo Kodama; Bernd Schnabl; David A Brenner
Journal:  Hepatology       Date:  2008-11       Impact factor: 17.425

4.  Global estimates of the prevalence of diabetes for 2010 and 2030.

Authors:  J E Shaw; R A Sicree; P Z Zimmet
Journal:  Diabetes Res Clin Pract       Date:  2009-11-06       Impact factor: 5.602

5.  Oral butyrate reduces oxidative stress in atherosclerotic lesion sites by a mechanism involving NADPH oxidase down-regulation in endothelial cells.

Authors:  Edenil C Aguilar; Lana Claudinez Dos Santos; Alda J Leonel; Jamil Silvano de Oliveira; Elândia Aparecida Santos; Juliana M Navia-Pelaez; Josiane Fernandes da Silva; Bárbara Pinheiro Mendes; Luciano S A Capettini; Lilian G Teixeira; Virginia S Lemos; Jacqueline I Alvarez-Leite
Journal:  J Nutr Biochem       Date:  2016-05-16       Impact factor: 6.048

6.  Histone deacetylase-2 is a key regulator of diabetes- and transforming growth factor-beta1-induced renal injury.

Authors:  Hyunjin Noh; Eun Young Oh; Ji Yeon Seo; Mi Ra Yu; Young Ok Kim; Hunjoo Ha; Hi Bahl Lee
Journal:  Am J Physiol Renal Physiol       Date:  2009-06-24

7.  Oxidative stress alters global histone modification and DNA methylation.

Authors:  Yingmei Niu; Thomas L DesMarais; Zhaohui Tong; Yixin Yao; Max Costa
Journal:  Free Radic Biol Med       Date:  2015-02-03       Impact factor: 7.376

8.  Tributyrin Supplementation Protects Immune Responses and Vasculature and Reduces Oxidative Stress in the Proximal Colon of Mice Exposed to Chronic-Binge Ethanol Feeding.

Authors:  B Glueck; Y Han; G A M Cresci
Journal:  J Immunol Res       Date:  2018-08-19       Impact factor: 4.818

Review 9.  Vimentin, colon cancer progression and resistance to butyrate and other HDACis.

Authors:  Darina L Lazarova; Michael Bordonaro
Journal:  J Cell Mol Med       Date:  2016-04-12       Impact factor: 5.310

10.  Attenuation of Rheumatoid Inflammation by Sodium Butyrate Through Reciprocal Targeting of HDAC2 in Osteoclasts and HDAC8 in T Cells.

Authors:  Da Som Kim; Jeong-Eun Kwon; Seung Hoon Lee; Eun Kyung Kim; Jun-Geol Ryu; Kyung-Ah Jung; Jeong-Won Choi; Min-Jung Park; Young-Mee Moon; Sung-Hwan Park; Mi-La Cho; Seung-Ki Kwok
Journal:  Front Immunol       Date:  2018-07-06       Impact factor: 7.561

View more
  13 in total

1.  Changes of gut microbiota in diabetic nephropathy and its effect on the progression of kidney injury.

Authors:  Kedan Cai; Yanhong Ma; Fanghao Cai; Xiaohan Huang; Liang Xiao; Chenyu Zhong; Pingping Ren; Qun Luo; Jianghua Chen; Fei Han
Journal:  Endocrine       Date:  2022-03-04       Impact factor: 3.633

2.  Renal Sensing of Bacterial Metabolites in the Gut-kidney Axis.

Authors:  Orestes Foresto-Neto; Bruno Ghirotto; Niels Olsen Saraiva Câmara
Journal:  Kidney360       Date:  2021-07-02

3.  Sodium Butyrate Inhibits Neovascularization Partially via TNXIP/VEGFR2 Pathway.

Authors:  Xiaoqiang Xiao; Min Chen; Yanxuan Xu; Shaofen Huang; Jiajian Liang; Yingjie Cao; Haoyu Chen
Journal:  Oxid Med Cell Longev       Date:  2020-11-20       Impact factor: 6.543

4.  Lysine Acetylation in the Proteome of Renal Tubular Epithelial Cells in Diabetic Nephropathy.

Authors:  Jiayi Wan; Mingyang Hu; Ziming Jiang; Dongwei Liu; Shaokang Pan; Sijie Zhou; Zhangsuo Liu
Journal:  Front Genet       Date:  2021-11-25       Impact factor: 4.599

5.  The change of gut microbiota-derived short-chain fatty acids in diabetic kidney disease.

Authors:  Chenyu Zhong; Zhiwei Dai; Lingxiong Chai; Lingping Wu; Jianhui Li; Weiying Guo; Jie Zhang; Qun Zhang; Congping Xue; Haixue Lin; Qun Luo; Kedan Cai
Journal:  J Clin Lab Anal       Date:  2021-10-24       Impact factor: 2.352

Review 6.  Intestinal microbiota dysbiosis in acute kidney injury: novel insights into mechanisms and promising therapeutic strategies.

Authors:  Juan Lei; Yifan Xie; Jingyi Sheng; Jiayu Song
Journal:  Ren Fail       Date:  2022-12       Impact factor: 2.606

Review 7.  Efficacy of probiotics on the modulation of gut microbiota in the treatment of diabetic nephropathy.

Authors:  Nozomi Nagase; Yuka Ikeda; Ai Tsuji; Yasuko Kitagishi; Satoru Matsuda
Journal:  World J Diabetes       Date:  2022-03-15

8.  Gut Microbiota Mediates the Protective Effects of Traditional Chinese Medicine Formula Qiong-Yu-Gao against Cisplatin-Induced Acute Kidney Injury.

Authors:  Ye-Ting Zou; Jing Zhou; Jin-Hao Zhu; Cheng-Ying Wu; Hong Shen; Wei Zhang; Shan-Shan Zhou; Jin-Di Xu; Qian Mao; Ye-Qing Zhang; Fang Long; Song-Lin Li
Journal:  Microbiol Spectr       Date:  2022-04-28

Review 9.  Roles of Gut Microbial Metabolites in Diabetic Kidney Disease.

Authors:  Qing Fang; Na Liu; Binjie Zheng; Fei Guo; Xiangchang Zeng; Xinyi Huang; Dongsheng Ouyang
Journal:  Front Endocrinol (Lausanne)       Date:  2021-05-20       Impact factor: 5.555

Review 10.  The Emerging Role of HDACs: Pathology and Therapeutic Targets in Diabetes Mellitus.

Authors:  Saikat Dewanjee; Jayalakshmi Vallamkondu; Rajkumar Singh Kalra; Pratik Chakraborty; Moumita Gangopadhyay; Ranabir Sahu; Vijaykrishna Medala; Albin John; P Hemachandra Reddy; Vincenzo De Feo; Ramesh Kandimalla
Journal:  Cells       Date:  2021-05-28       Impact factor: 6.600

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.