Maya Glover1,2, Stefano A P Colombo1,2, David J Thornton1,2, Richard K Grencis1,2. 1. Lydia Becker Institute of Immunology and Inflammation, University of Manchester, Manchester, United Kingdom. 2. Wellcome Centre for Cell Matrix Research, University of Manchester, Manchester, United Kingdom.
Abstract
The majority of experiments investigating the immune response to gastrointestinal helminth infection use a single bolus infection. However, in situ individuals are repeatedly infected with low doses. Therefore, to model natural infection, mice were repeatedly infected (trickle infection) with low doses of Trichuris muris. Trickle infection resulted in the slow acquisition of immunity reflected by a gradual increase in worm burden followed by partial expulsion. Flow cytometry revealed that the CD4+ T cell response shifted from Th1 dominated to Th2 dominated, which coincided with an increase in Type 2 cytokines. The development of resistance following trickle infection was associated with increased worm expulsion effector mechanisms including goblet cell hyperplasia, Muc5ac production and increased epithelial cell turn over. Depletion of CD4+ T cells reversed resistance confirming their importance in protective immunity following trickle infection. In contrast, depletion of group 2 innate lymphoid cells did not alter protective immunity. T. muris trickle infection resulted in a dysbiotic mircrobiota which began to recover alpha diversity following the development of resistance. These data establish trickle infection as a robust and informative model for analysis of immunity to chronic intestinal helminth infection more akin to that observed under natural infection conditions and confirms the importance of CD4+ T cell adaptive immunity in host protection.
The majority of experiments investigating the immune response to gastrointestinal helminth infection use a single bolus infection. However, in situ individuals are repeatedly infected with low doses. Therefore, to model natural infection, mice were repeatedly infected (trickle infection) with low doses of Trichuris muris. Trickle infection resulted in the slow acquisition of immunity reflected by a gradual increase in worm burden followed by partial expulsion. Flow cytometry revealed that the CD4+ T cell response shifted from Th1 dominated to Th2 dominated, which coincided with an increase in Type 2 cytokines. The development of resistance following trickle infection was associated with increased worm expulsion effector mechanisms including goblet cell hyperplasia, Muc5ac production and increased epithelial cell turn over. Depletion of CD4+ T cells reversed resistance confirming their importance in protective immunity following trickle infection. In contrast, depletion of group 2 innate lymphoid cells did not alter protective immunity. T. muristrickle infection resulted in a dysbiotic mircrobiota which began to recover alpha diversity following the development of resistance. These data establish trickle infection as a robust and informative model for analysis of immunity to chronic intestinal helminth infection more akin to that observed under natural infection conditions and confirms the importance of CD4+ T cell adaptive immunity in host protection.
Gastrointestinal (GI) dwelling nematodes infect approximately 1 billion people worldwide causing significant ill health[1]. Prevalence is high in endemic areas although intensity of infection varies with age, suggesting acquired immunity develops, although sterile immunity is rare and individuals are repeatedly challenged with low numbers of infectious stages throughout their lives [2]. Thus, identifying mechanisms of acquired immunity in human populations is extremely challenging, however, data is supportive of acquired immunity driven by Type 2 immunity for at least some if not all the major soil transmitted helminths (STH) Ascaris lumbricoides, Necator americanus, Ancylostoma duodenale and Trichuris trichiura [3]. Despite this, immunity appears to be only partial at best and takes considerable time to develop [2,4].Animal models of intestinal nematode infection have been widely used to help define mechanisms of immunity to these types of pathogen [5]. Typically, rodents are given a single, and sometimes a second, infection composed of an unnaturally large dose of infectious stages. This approach has been extremely informative and established that such a robust parasite challenge stimulates the host to generate host protective responses, dominated by Type 2 immunity. A clear role for CD4+ Th2 cells is well documented but in addition, recent data indicates that innate immunity plays a major role in host protection through tuft cell induced Type 2 innate lymphoid cell (ILC2) production of IL-13 [6-8]. Whilst single bolus infections in the laboratory have been central to defining paradigms of resistance and susceptibility, one major discrepancy between these models and natural infection in man, and indeed rodents, is that individuals are infected repeatedly with low dose infections throughout their lifetime and STH are chronic, non-resolving infections. Studies of repeated low dose nematode infections of rodents are indeed rare [9,10].The mouse whipworm, Trichuris muris, is uniquely placed as a model of the human STH Trichuris trichiura, in that it exists as a natural chronic infection of wild rodents. The antigenic cross-reactivity of the two species, similar morphology and same niche of intestinal infection establishes T. muris as a suitable parasite to model humaninfection and has been consolidated by the recent description of the T. trichiura and T. muris genomes [11,12]. Moreover, the immune responses required for resistance and susceptibility to T. muris are well established and influenced by both infective dose and strain of laboratory mouse. C57BL/6 mice that receive a single high dose infection develop resistance, dependent on CD4+ Th2 cells [13] and IL-13 production [14]. IL-13 induces a number of effector mechanisms that mediate worm expulsion including accelerated epithelial cell turnover [14-16]. Trichuris embed in the epithelium of the caecum and with increased epithelial cell turnover the worm is physically carried out of the epithelium into the lumen and is expelled. In resistant mice, IL-13 also induces goblet cell hyperplasia and elevated Muc2 and Muc5ac mucins, with deficiency of these mucins causing susceptibility to infection [17].C57BL/6 mice that receive a single low dose infection of T. muris are, in contrast, susceptible and develop a chronic infection associated with CD4+ Th1 cells, IFN-γ production [18] and subsequent regulation via IL-10 [19,20]. Chronic low level Trichuris infection is associated with a dysbiosis of the intestinal microbiota with a reduction in microbial diversity [21,22] that has a survival benefit for the parasite [23].Here, we have established a natural trickle infection with T. muris in the mouse using repeated low doses of eggs to mimic more closely exposure in the field. Following comprehensive immune phenotyping, we now show that repeated low doses of T. muris infection results in the slow development of partial resistance with the modification of a Type 1 dominated response to a functionally protective Type 2 immune response. Resistance after this infection regime is dependent on CD4+ T cells and associated with Muc5ac production and an increase in intestinal epithelial cell turnover, confirming their importance even after this multi-infection regime. ILC2s, however, did not appear to play an important role in the development of resistance following T. muristrickle infection or indeed after a single high dose infection, which induces complete Type 2 cytokine mediated parasite clearance.We propose that this infection regime presents a powerful approach to further dissect the host/parasite relationship of a major neglected tropic disease, trichuriasis, using a highly relevant mouse model under conditions where the host is challenged by parasite infection in a manner more akin to that seen under natural infecting conditions. Going forward, this provides a more representative platform for analysis of potential vaccine candidates and novel anti-helminthics.
Results
Development of resistance and Type 2 immune responses following T. muris trickle infection
To replicate a more natural infection regime of T. muris, mice were infected weekly with low doses of eggs (20 eggs) for 3, 5, 7 or 9 weeks (S1 Fig). Two weeks after the final infection worm burden and immune responses were analyzed. Total worm burden revealed Trichuris worm numbers increased through weeks 5 to 9 post infection (p.i.) followed by a significant decrease by week 11 (Fig 1A). Faecal egg counts at week 11 followed a similar pattern and suggested a significant reduction in worm burden occurs after week 9 (Fig 1B). When Trichuris eggs hatch in the caecum, L1 larvae are released and undergo a series of moults, L2-L4, before developing into adult worms. Larval stages were counted and revealed an absence of early larval stages at week 11 (Fig 1C). Analysis of CD4+ T helper cell subsets from large intestinal lamina propria revealed a shift from a Th1 dominated response during susceptibility at week 9, to a Th2 dominated immune response, associated with resistance at week 11 (Fig 1D). The peak in Th2 cells coincided with an increased capacity to produce IL-13 and no significant change in IFN-γ production (Fig 1E). Analysis of CD4+ T cell subpopulations from MLNs did not show any significant changes following T. muristrickle infection during the period of resistance (S2 Fig).
Fig 1
Development of resistance following T. muris trickle infection.
C57BL/6 mice were infected repeatedly with low doses of T. muris. A) Total worm burdens measured by eye under dissecting microscope. B) Faecal egg counts of mice trickled for 9 weeks were tracked from 6 weeks post the primary infection until eggs could no longer be detected in the faeces. Egg burden was quantified using a McMaster count chamber. Points represent the mean of 5 individual mice. C) Adult and larval Trichuris worm burdens, n = 5. D) CD4+ T cell percentage from large intestinal lamina propria, Th1 (Tbet+), Th2 (GATA3+), Th17 (RORγt+), Tregs (FOXP3+), n = 10, from two independent experiments. CD4+ T cell percentage calculated as percentage of all live cells. T cell subset percentage calculated as percentage of all CD4+ cells. E) Cytokine production from MLN cells collected at 11 weeks p.i. and re-stimulated ex vivo. Levels of secreted cytokine in the supernatant were quantified by cytometric bead array, n = 5. Statistical analysis completed by one way- ANOVA or unpaired t test. Data presented as mean +/- SEM. * = p<0.05, ** = p<0.01, **** = p< 0.0001. Representative data from 2 independent experiments.
Development of resistance following T. muris trickle infection.
C57BL/6 mice were infected repeatedly with low doses of T. muris. A) Total worm burdens measured by eye under dissecting microscope. B) Faecal egg counts of mice trickled for 9 weeks were tracked from 6 weeks post the primary infection until eggs could no longer be detected in the faeces. Egg burden was quantified using a McMaster count chamber. Points represent the mean of 5 individual mice. C) Adult and larval Trichuris worm burdens, n = 5. D) CD4+ T cell percentage from large intestinal lamina propria, Th1 (Tbet+), Th2 (GATA3+), Th17 (RORγt+), Tregs (FOXP3+), n = 10, from two independent experiments. CD4+ T cell percentage calculated as percentage of all live cells. T cell subset percentage calculated as percentage of all CD4+ cells. E) Cytokine production from MLN cells collected at 11 weeks p.i. and re-stimulated ex vivo. Levels of secreted cytokine in the supernatant were quantified by cytometric bead array, n = 5. Statistical analysis completed by one way- ANOVA or unpaired t test. Data presented as mean +/- SEM. * = p<0.05, ** = p<0.01, **** = p< 0.0001. Representative data from 2 independent experiments.Previous work has demonstrated that antibody responses are not required for resistance to single T. muris infections [18,19]. Antibody responses specific for T. muris adult and larval antigens were analysed following trickle infection. Type 1 IgG2a/c antibody and Type 2 IgG1 antibody steadily increased throughout the complete infection time course (S3 Fig). No distinct difference in antibody responses against each stage was apparent (excluding responses against L1 antigens which remained low throughout trickle infection). Additionally, total IgE levels did not significantly increase throughout trickle infection (S3 Fig).Goblet cell number and goblet cell size increased consistently throughout the course of the trickle regime peaking at week 11 when resistance had been established (Fig 2A–2C). Crypt length, an indicator of gutinflammation, increased during trickle infection (Fig 2D). Sections were stained with HID-AB to visualize changes in mucin glycosylation in the caecum (Fig 2E). Following low dose T. muris infection mucins become sialylated and are more vulnerable to degradation by T. muris products [17,24]. However, following high dose T. muris infection mucins stay sulphated [20]. During T. muristrickle infection mucins appeared sulphated throughout.
Fig 2
Goblet cell responses in T. muris trickle infected mice.
Paraffin embedded caecal sections from trickle infected mice were PAS stained and goblet cells and crypt length were analyzed using ImageJ. (A) Representative imagines of PAS stained caecal sections. (B-D) Individual quantification for each mouse was achieved by measuring at least 10 individual crypts and determining the mean number of (B) goblet cells per crypt, (C) goblet cell diameter, and (D) Crypt length. Bars represent the mean across 5 mice. (E) Representative imagines of HID-AB caecal sections to visualize sulphated (black) and sialylated (blue) mucins. Statistical analysis completed by a one way-ANOVA. Data presented as mean +/- SEM. * = p<0.05, ** = p<0.01, *** = p<0.001, **** = p< 0.0001.
Goblet cell responses in T. muris trickle infected mice.
Paraffin embedded caecal sections from trickle infectedmice were PAS stained and goblet cells and crypt length were analyzed using ImageJ. (A) Representative imagines of PAS stained caecal sections. (B-D) Individual quantification for each mouse was achieved by measuring at least 10 individual crypts and determining the mean number of (B) goblet cells per crypt, (C) goblet cell diameter, and (D) Crypt length. Bars represent the mean across 5 mice. (E) Representative imagines of HID-AB caecal sections to visualize sulphated (black) and sialylated (blue) mucins. Statistical analysis completed by a one way-ANOVA. Data presented as mean +/- SEM. * = p<0.05, ** = p<0.01, *** = p<0.001, **** = p< 0.0001.Goblet cells produce a number of protective mucins and secreted proteins during resistance to T. muris [17]. To determine which goblet cell proteins were correlated with resistance during trickle infection, the expression of a number of goblet cell associated genes was assessed. There was a specific increase in Muc5ac expression at week 11 after trickle infection when resistance developed (Fig 3A). The increase in Muc5ac was confirmed by western blot on secreted mucus. The majority of trickle infectedmice showed an increase in secreted Muc5ac (Fig 3B). Muc2 is also associated with resistance in T. muris models of infection [25]. Despite no significant increase in gene expression, staining of caecal sections revealed an increase in Muc2 positive cells during the development of resistance in trickle infection (Fig 3C). Relm-β (and to a lesser extent TFF3) have also been associated with resistance in T. muris infection [26]; despite no increase in TFF3, Relm-β expression significantly increased during the generation of resistance in trickle infection (Fig 3A).
Fig 3
Mucin production in T. muris trickle infection.
(A) Relative expression of goblet cell-associated genes measured by qPCR. Relative quantification was achieved using the 2^-ΔΔCT method with β-actin used as the housekeeping reference gene. (B) Western blot to visualize Muc5ac protein from extracted mucus from naïve or T. muris infected C57BL/6 mice at 11 weeks p.i.. (C) Quantification of the mean number of Muc2+ goblet cells per crypt, given as the mean number of Muc2+ cells from a minimum of 10 crypts per mouse. Representative immunostained sections during trickle infection. Muc2 in green. DAPI stain in blue. n = 5, statistical analysis completed by a one way-ANOVA comparing each time point to week 0. Data presented as mean +/- SEM, * = p<0.05.
Mucin production in T. muris trickle infection.
(A) Relative expression of goblet cell-associated genes measured by qPCR. Relative quantification was achieved using the 2^-ΔΔCT method with β-actin used as the housekeeping reference gene. (B) Western blot to visualize Muc5ac protein from extracted mucus from naïve or T. murisinfected C57BL/6 mice at 11 weeks p.i.. (C) Quantification of the mean number of Muc2+ goblet cells per crypt, given as the mean number of Muc2+ cells from a minimum of 10 crypts per mouse. Representative immunostained sections during trickle infection. Muc2 in green. DAPI stain in blue. n = 5, statistical analysis completed by a one way-ANOVA comparing each time point to week 0. Data presented as mean +/- SEM, * = p<0.05.An increase in epithelial cell turnover occurs in resistance of T. muris following a high dose infection and is hypothesized to physically move the parasite out of its optimal intestinal niche resulting in expulsion [16]. To determine whether increased turnover was induced during resistance following trickle infection, mice were injected with BrdU to assess cell turnover [27]. A significant increase in epithelial cell turnover was observed during the generation of resistance at week 11 of trickle infection (Fig 4A and 4B) although, no increase in amphiregulin gene expression was observed (Fig 4C) [27].
Fig 4
Epithelial cell turnover following T. muris trickle infection.
At week 11 following either low dose infection (20 eggs) or a 9 week trickle infection (20 eggs/week), 9 hours prior to sacrifice, mice were I.P. injected with BrdU to identify proliferating cells. (A) Caecal sections were stained for anti-BrdU (green) and DAPI (blue) and the distance the furthest BrdU stained cell was measured. (B) Quantification of epithelial turnover was determined by measuring the distance between the base of each crypt and the furthest BrdU+ve cell from that point. A mean value was generated for each mouse from at least 10 separately analyzed crypts. (C) Relative expression of amphiregulin in the caecum measured by qPCR. Relative expression was calculated using the 2^-ΔΔCT method with β-actin used as a housekeeping reference gene. n = 5, statistical analysis completed by a one way-ANOVA or unpaired t test. Data presented as mean +/- SEM, ** = p<0.01.
Epithelial cell turnover following T. muris trickle infection.
At week 11 following either low dose infection (20 eggs) or a 9 week trickle infection (20 eggs/week), 9 hours prior to sacrifice, mice were I.P. injected with BrdU to identify proliferating cells. (A) Caecal sections were stained for anti-BrdU (green) and DAPI (blue) and the distance the furthest BrdU stained cell was measured. (B) Quantification of epithelial turnover was determined by measuring the distance between the base of each crypt and the furthest BrdU+ve cell from that point. A mean value was generated for each mouse from at least 10 separately analyzed crypts. (C) Relative expression of amphiregulin in the caecum measured by qPCR. Relative expression was calculated using the 2^-ΔΔCT method with β-actin used as a housekeeping reference gene. n = 5, statistical analysis completed by a one way-ANOVA or unpaired t test. Data presented as mean +/- SEM, ** = p<0.01.
Resistance developed following T. muris trickle infection is long lasting and protects against subsequent infection
To determine whether the resistance that developed following T. muristrickle infection was maintained even in the absence of active infection, trickle infectedmice were challenged following either the natural eventual loss of worms or following anti-helminthic treatment. Faecal egg counts were assessed to determine when all worms had been expelled and the animals were then challenged at week 30. After a single low dose infection, mice were still susceptible to a challenge low dose infection whereas miceinfected with single high dose were able to expel a challenge low dose infection. Trickle infectedmice were protected against subsequent infection, similar to high dose infectedmice (S4A Fig). Moreover, mice that had already received a short trickle infection (3 low dose infections) were not resistant to a low dose challenge given 10 weeks later, suggesting that the number of low dose infection events is key to generating resistance and not simply the slow development of protective immunity (S4B Fig).
CD4+ T cells are essential for the development of resistance following trickle infection
To determine whether innate or adaptive cells were responsible for the development of resistance following trickle infection, RAG-/- mice were infected with repeated low doses following the week 11 infection regime. Although C57BL/6 mice developed resistance at this time point, RAG-/- mice did not expel worms, steadily building up worm numbers, confirming adaptive immune responses were essential for resistance (Fig 5A). To define a role for CD4+ T cells in the development of trickle infection-induced resistance, C57BL/6 mice were treated with anti-CD4 antibody between week 8 and 11, when we observe resistance developing. Depletion of CD4+ T cells was confirmed by flow cytometry (Fig 5B). This reduction resulted in a significant increase in total worm burden at week 11 which included adult worms and all larval stages (Fig 5C and 5D). Furthermore, depletion of CD4+ T cells resulted in a significant reduction in associated effector mechanisms including goblet cell hyperplasia, Muc5ac and Relm-β expression and epithelial cell turnover (Fig 6). There were small reductions in the T. muris specific antibody response following CD4+ T cell depletion (S5A and S5B Fig).
Fig 5
CD4+ depletion in T. muris trickle infection.
(A) Worm burdens of T. muris trickle infected RAG-/- (black) and C57BL/6 (grey) mice following a 9 week trickle infection and sacrificed at week 11 post infection, n = 5. Adult worms and larval stages 4–2 were counted. (B-D) To determine the importance of CD4+ cells in generating immunity during trickle infection mice were treated with 200μg anti-CD4 antibody or isotype control antibody, 3 times a week for 3 weeks between weeks 8–10 of trickle infection. (B) FACS quantification of CD4+ T cells in the large intestine to confirm depletion, values are given as a percentage of live cells. (C) Total worm burdens of T. muris infected mice determined by dissecting microscopy. (D) Adult worms and larval stage counts following CD4+ depletion, n = 9–10, based on two experiments. Statistical analysis completed using an unpaired t test. Data presented as mean +/- SEM, * = p<0.05, ** = p<0.01, *** = p<0.001, **** = p< 0.0001.
Fig 6
Changes in worm expulsion mechanisms following CD4+ T cell depletion in trickle infection.
Mice were infected weekly for 9 weeks with 20 eggs and sacrificed at week 11 post primary infection. Between week 8 and week 10 CD4+ cells were depleted using neutralizing antibodies given 3 times a week for 3 weeks. Following CD4+ T cell depletion several parameters associated with worm expulsion were analyzed. (A) Caecal tissue was fixed in NBF at sacrifice and stained using PAS. Representative images of stained sections along with quantification of crypt length and goblet cell counts, given as the mean number per mouse quantified from a minimum of 10 crypts per mouse, n = 5. (B) Relative expression of Muc5ac and RELMβ analyzed by qPCR, n = 5. (C) Epithelial cell turnover was measured by I.P. injecting mice 9 hours prior to sacrifice with BrdU and quantifying the furthest BrdU+ve cell from the base of the intestinal crypt via microscopy. Sections stained by anti-BrdU (green) and DAPI (blue), n = 4–5. Statistics measured using an unpaired t test. Data presented as mean +/- SEM, * = p<0.05, ** = p<0.01.
CD4+ depletion in T. muris trickle infection.
(A) Worm burdens of T. muris trickle infected RAG-/- (black) and C57BL/6 (grey) mice following a 9 week trickle infection and sacrificed at week 11 post infection, n = 5. Adult worms and larval stages 4–2 were counted. (B-D) To determine the importance of CD4+ cells in generating immunity during trickle infectionmice were treated with 200μg anti-CD4 antibody or isotype control antibody, 3 times a week for 3 weeks between weeks 8–10 of trickle infection. (B) FACS quantification of CD4+ T cells in the large intestine to confirm depletion, values are given as a percentage of live cells. (C) Total worm burdens of T. murisinfectedmice determined by dissecting microscopy. (D) Adult worms and larval stage counts following CD4+ depletion, n = 9–10, based on two experiments. Statistical analysis completed using an unpaired t test. Data presented as mean +/- SEM, * = p<0.05, ** = p<0.01, *** = p<0.001, **** = p< 0.0001.
Changes in worm expulsion mechanisms following CD4+ T cell depletion in trickle infection.
Mice were infected weekly for 9 weeks with 20 eggs and sacrificed at week 11 post primary infection. Between week 8 and week 10 CD4+ cells were depleted using neutralizing antibodies given 3 times a week for 3 weeks. Following CD4+ T cell depletion several parameters associated with worm expulsion were analyzed. (A) Caecal tissue was fixed in NBF at sacrifice and stained using PAS. Representative images of stained sections along with quantification of crypt length and goblet cell counts, given as the mean number per mouse quantified from a minimum of 10 crypts per mouse, n = 5. (B) Relative expression of Muc5ac and RELMβ analyzed by qPCR, n = 5. (C) Epithelial cell turnover was measured by I.P. injecting mice 9 hours prior to sacrifice with BrdU and quantifying the furthest BrdU+ve cell from the base of the intestinal crypt via microscopy. Sections stained by anti-BrdU (green) and DAPI (blue), n = 4–5. Statistics measured using an unpaired t test. Data presented as mean +/- SEM, * = p<0.05, ** = p<0.01.In order to test whether CD4+ T cells from mice that had developed resistance following trickle infection could induce resistance to low dose infection, CD4+ T cells were purified from week 11 trickle infectedmice and adoptively transferred into C57BL/6 mice and challenged with a low dose infection. Analysis of worm burdens on day 35 post infection showed no difference in worm burdens between cell recipients and control mice (S5C Fig). However, cell recipients did show slightly elevated levels of both parasite-specific IgG1 and IgG2c compared to controls (S5D Fig).
Innate lymphoid cells play little role in resistance following T. muris trickle infection
ILCs have been shown to play indispensable roles during resistance in multiple model helminth infections including N. brasiliensis and H. polygyrus [28,29]. To determine the role of ILCs during T. muristrickle infection, ILCs were analysed by flow cytometry. Total intestinal ILC proportions decreased following the development of resistance at week 11 during trickle infection (Fig 7A). Total ILC numbers decreased over the infection period compared to naïve animals and this was reflected by a reduction in ILC2 and ILC3 proportions relative to ILC1s (Fig 7A). Analysis of ILC populations in the MLN showed no changes during the trickle infection regime, including no changes in ILC2 populations (S6 Fig). Additionally, previous research has demonstrated that tuft cells proliferate following N. brasiliensis and H. polygyrus infection and play a key role in inducing expansion of ILC2s by secreting IL-25 [8]. During T. muristrickle infection there was a small but significant increase tuft cell numbers (identified by Dclk1 expression) in the caecum despite a significant decrease in ILC2s at this time point. No change in tuft cell numbers in the small intestine was observed (Fig 7B). To confirm the role of ILC2s during T. muristrickle infection, ICOS-T mice that can be specifically depleted for ILC2s by DTx treatment were used [29]. Mice were infected repeatedly using the week 11 trickle regime and received DTx or PBS control treatment at week 8–10 when resistance is observed to develop (Fig 8A). DTx treatment resulted in a significant reduction in total ILC2 in the caecum (Fig 8B). This depletion did not alter worm burdens and therefore the development of resistance following T. muristrickle infection (Fig 8C). High dose infections (~200 eggs in a single bolus) are a well-established model of Th2-dependent resistance to T. muris [30]. Using ICOS-T mice, we observed that ILC2 depletion following a single high dose infection did not alter worm expulsion relative to control mice (S7 Fig).
Fig 7
Innate lymphoid cells and tuft cell proliferation in T.muris trickle infection.
(A) Proportion of innate lymphoid cells in the large intestine was quantified by FACS. ILCs were identified as lineage negative, CD90.2+CD127+ cells. Total ILCs are given as a percentage of live cells. Individual ILC subsets (ILC1, ILC2 & ILC3) are given as a percentage of total ILCs. (B) Tuft cells in caecal and small intestine sections of trickle infected mice quantified by microscopy. Tuft cells were identified as Dclk1 positive cells (green). DAPI stain in blue. n = 5, statistical analysis completed by a one way-ANOVA, * = p<0.05.
Fig 8
Depletion of ILC2s in ICOS-T mice during T. muris trickle infection.
ILC2s were inducibly depleted from ICOS-T mice by DTx treatment. (A) Mice received 750ng DTx (red arrow) for 10 days at week 8–10 of trickle infection (purple arrow) where mice were infected weekly for 9 weeks with 20 eggs and culled at week 11 post primary infection. Control mice received PBS control injections at the same time points. Two weeks following the final trickle infection worm burdens and ILC2 depletion were analyzed. (B) Flow cytometry to confirm depletion, ILC2s identified as Lineage-, CD127+, CD90.2+, GATA3+ cells. Data are represented as a percentage of total ILCs and as total cell counts. (C) Total worm burdens of trickle infected mice. (D) Worm burdens of developmental stages during trickle infection. Statistical analysis completed by an unpaired t-test. Data presented as mean +/- SEM, * = p<0.05. n = 6–7 from two pooled experiments.
Innate lymphoid cells and tuft cell proliferation in T.muris trickle infection.
(A) Proportion of innate lymphoid cells in the large intestine was quantified by FACS. ILCs were identified as lineage negative, CD90.2+CD127+ cells. Total ILCs are given as a percentage of live cells. Individual ILC subsets (ILC1, ILC2 & ILC3) are given as a percentage of total ILCs. (B) Tuft cells in caecal and small intestine sections of trickle infectedmice quantified by microscopy. Tuft cells were identified as Dclk1 positive cells (green). DAPI stain in blue. n = 5, statistical analysis completed by a one way-ANOVA, * = p<0.05.
Depletion of ILC2s in ICOS-T mice during T. muris trickle infection.
ILC2s were inducibly depleted from ICOS-T mice by DTx treatment. (A) Mice received 750ng DTx (red arrow) for 10 days at week 8–10 of trickle infection (purple arrow) where mice were infected weekly for 9 weeks with 20 eggs and culled at week 11 post primary infection. Control mice received PBS control injections at the same time points. Two weeks following the final trickle infection worm burdens and ILC2 depletion were analyzed. (B) Flow cytometry to confirm depletion, ILC2s identified as Lineage-, CD127+, CD90.2+, GATA3+ cells. Data are represented as a percentage of total ILCs and as total cell counts. (C) Total worm burdens of trickle infectedmice. (D) Worm burdens of developmental stages during trickle infection. Statistical analysis completed by an unpaired t-test. Data presented as mean +/- SEM, * = p<0.05. n = 6–7 from two pooled experiments.
Immune responses during trickle infection
A number of studies suggest that individuals naturally infected by helminths have altered susceptibility to atopy and asthma when assessed by skin prick testing to common allergens [31-33]. To determine whether T. muristrickle infection can alter the allergic response, T. murisinfectedmice were sensitized with the allergen OVA. Local immediate hypersensitivity in the skin was measured following OVA challenge and revealed that a neither a single low dose nor trickle T. muris infection altered the local immediate hypersensitivity response as compared to uninfected animals (S8 Fig).In helminth endemic countries it is common to observe that individuals are infected with multiple helminth species including multiple GI nematodes such as whipworm and hookworm [34] and a variety of laboratory co-infection studies have shown that infection by one species of GI nematode can affect the response to another [35-37], although always with single high doses of the respective parasites. In order to investigate the effect of a trickle T. muris infection upon another GI nematode infection, mice were additionally challenged with a single high dose of N. brasiliensis a model of humanhookworm infection. Co-infection following trickle (or indeed a single low dose infection by T. muris) did not alter worm expulsion kinetics of T. muris or N. brasiliensis (S9 Fig).
Dysbiosis of the intestinal microbiome begins to resolve following the development of resistance in T. muris trickle infection
It has previously been demonstrated that chronic T. muris infection following a single low dose infection results in a dysbiotic microbiome [21]. Using 16S sequencing we compared changes in the composition of the final stool microbiota between low dose infections and trickle infection (S10 Fig). Both low dose and trickle infection induced shifts in the microbiota composition demonstrated by NMDS analysis (Fig 9A and 9B). Trickle infection promoted a more significant change in the biota at week 11 compared to the low dose infection. For low dose infection this change in the microbiota was largely consistent between week 9 and week 11. However, under a trickle infection, at week 11, a partial shift back towards the naïve groups was observed, coinciding with the development of resistance to infection. To look in more detail where these changes were occurring, alpha diversity of the most abundant bacterial phyla were quantified using Shannon indexes. Both infection regimes showed a significant reduction in overall Shannon diversity at week 9 (Fig 9C and 9D). However, at week 11 when resistance had developed, population diversity began to recover in trickle infectedmice (Fig 10D). This recovery of diversity appeared to predominate in the Bacteriodetes phylum (Fig 9D), and was not seen in low dose infection (Fig 9C). This trend could also be observed at the genus level, where some of the most abundant genera present in the naïve mice at both time points were diminished or could no longer be detected in trickle infectedmice at week 9, but were present at week 11 (Fig 10).
Fig 9
NMDS analysis of fecal microbial communities during low dose and trickle T. muris infection.
(A) NMDS plot of microbial communities during T. muris low dose infection. Naïve mice (blue) were compared to mice trickled with T. muris (purple) at 9 and 11 weeks post infection (◯ & ☐). Infection and time drove significant changes in microbiome composition (p = 0.001 & p = 0.05) assessed by PERMANOVA. (B) NMDS plot of microbial communities during T. muris trickle infection. Naïve mice (blue) were compared to mice trickled with T. muris (red) at 9 and 11 weeks post infection (◯ & ☐). Infection drove a significant change in microbiome composition (p < 0.004) assessed by PERMANOVA. Axes represent a scale of Euclidian distances between samples where the centre is zero. Stress measures quality of fit (< 0.1 indicates a very good fit). (C & D) Alpha diversity of (C) low dose and (D) trickle infected mice given calculated in R by Shannon diversity test using the Vegan package. Significance is calculated by two-way ANOVA. Data presented as mean, * = p<0.05, ** = p<0.01, **** = p<0.0001.
Fig 10
Comparative abundance of bacterial genera in naïve and trickle infected mice.
Bubble plot representing the relative abundance of the top 20 genera determined as those with the highest median abundance across all individuals (as a proportion of total microbial composition). Circle size is representative of the proportion of the microbiota comprised by that genus. Empty spaces indicate that there was no detection of that genus by 16S sequencing.
NMDS analysis of fecal microbial communities during low dose and trickle T. muris infection.
(A) NMDS plot of microbial communities during T. muris low dose infection. Naïve mice (blue) were compared to mice trickled with T. muris (purple) at 9 and 11 weeks post infection (◯ & ☐). Infection and time drove significant changes in microbiome composition (p = 0.001 & p = 0.05) assessed by PERMANOVA. (B) NMDS plot of microbial communities during T. muristrickle infection. Naïve mice (blue) were compared to mice trickled with T. muris (red) at 9 and 11 weeks post infection (◯ & ☐). Infection drove a significant change in microbiome composition (p < 0.004) assessed by PERMANOVA. Axes represent a scale of Euclidian distances between samples where the centre is zero. Stress measures quality of fit (< 0.1 indicates a very good fit). (C & D) Alpha diversity of (C) low dose and (D) trickle infectedmice given calculated in R by Shannon diversity test using the Vegan package. Significance is calculated by two-way ANOVA. Data presented as mean, * = p<0.05, ** = p<0.01, **** = p<0.0001.
Comparative abundance of bacterial genera in naïve and trickle infected mice.
Bubble plot representing the relative abundance of the top 20 genera determined as those with the highest median abundance across all individuals (as a proportion of total microbial composition). Circle size is representative of the proportion of the microbiota comprised by that genus. Empty spaces indicate that there was no detection of that genus by 16S sequencing.
Discussion
Although our knowledge of the immune responses to gastrointestinal nematodes is continuously expanding, the majority of research follows infection after a single high or low dose of eggs. However, in situ individuals experience repeated low doses of infection. As human studies are inherently limited and animal models following single infection often show conflicting results when compared to human studies, it is desirable to ensure we are correctly modeling natural infection. Here we functionally characterized the response to infection following a more representative regime by infecting mice repeatedly with low doses, named trickle infection, of the whipworm T. muris.Following trickle infection, we show resistance developed concurrently with intestinal immune responses shifting from CD4+ Th1 cell dominated to a CD4+ Th2 cell dominated response. The development of Type 2 responses coincided with a significant reduction in both adult and larval worms. Absence of early larval stages suggests that the resistance was targeted/most effective against incoming larval stages. Adult worms, however, persisted until week 30 shown by continued low faecal egg output. Therefore, only partial resistance was induced, which is similar to that seen in naturally infected individuals with human whipworm [2]. Indeed, acquired immunity to most human STHs is slow to develop and incomplete, with ‘resistant’ individuals in endemic regions harboring low numbers of parasites [2]. Previous studies using repeated T. muris low dose infection over a much shorter time frame (six infections over a 11 day infection period) suggested host genetics also influenced the capacity to generate resistance, although association between resistance and immune response type was difficult to define [38]. The acquisition of resistance following trickle infection with T. muris was associated with elevated IL-13 production and IL-13-mediated effector mechanisms including goblet cell hyperplasia, Muc5ac production, mucin sulphation, and increased epithelial cell turnover, as seen in previous studies using a single high dose infection to induce resistance [14,16,17,20]. Although immunity induced by trickle infection reduced worm numbers significantly it was not able to completely clear infection, as a low level of infection with adult worms persisted. The reasons for this are unclear although may be related to worm size and niche occupied by the parasite in combination with ongoing parasite induced immunomodulatory mechanisms [39]. For example, adult parasites are extensively embedded within epithelial tunnels, with the anterior of each worm “sewn” through thousands of epithelial cells [40,41] which physically presents a considerable challenge to remove. Previous work has suggested that the IL-13 controlled epithelial escalator was most successful at expelling worms at approximately day 14 post infection when smaller larval stages reside in the lower/mid region of the crypt where epithelial cells move faster [14]. Furthermore, following anti-helminthic treatment and challenge infection, trickle infectedmice had reduced worm burdens but again were unable to completely expel worms, confirming only partial resistance is induced to even long term challenge. This would suggest that under conditions of repeated low dose infection such as encountered naturally, complete removal of the parasite burden may be difficult to achieve especially once adult worms are present and given that drug-treatment does not alter immune status significantly. It also predicts that infection would be highly prevalent in the population with most individuals infected by low numbers of worms.The data presented here demonstrates a central role for CD4+ T cells in the development of resistance to T. muristrickle infection. When taken together with the adoptive transfer experiments the present data suggests that CD4+ T cells from trickle infectedmice are necessary but may not be sufficient for resistance. However, the reasons for the lack of transfer immunity could be manifold e.g. non-optimum timepoint of harvest or transfer of cells relative to infection, too few cells etc. Also, as only partial immunity is evident following trickle infection, it is very likely that there are mixed populations of Th1/Th2 cells in the transferred population (supported by increases in both parasite-specific IgG1 and IgG2c) which may be less effective upon transfer. Thus, the adoptive transfer approach will require considerable further experimental investigation and dissection going forward. However, a critical role for CD4+ T cells is consistent with other models of resistance to Tirchuris infection [19,42]. Following CD4+ T cell depletion, worm expulsion and associated effector mechanisms were reduced. Robust T. muris specific antibody responses were generated during trickle infection, with high levels apparent prior to induction of resistance by week 11. Depletion of CD4+ T cells resulted in a mild reduction in parasite-specific IgG levels antibody unlikely to be responsible for diminished resistance to infection. Previous data from single high-dose infection studies in T. muris have demonstrated that antibody is not required for resistance [19]. In concert with this, mice deficient in FcγR are resistant to infection [43], as are mice deficient in Aicda, which are unable to class switch or develop high affinity antibody infection (3i consortium). Taken together, the dataset presented here suggests that antibody does not a play a major role in resistance induced by trickle infection, but it does not definitively show this, and further work is required to confirm this conclusion. Interestingly, this is not the case for other models of GI nematode infection such as H. polygyrus where antibody does play a role in host resistance particularly during a secondary infection [44]. This may reflect the different niches occupied by the parasites underpinning the concept of multiple/redundant Type 2 controlled protective responses against these large multicellular pathogens. This is also evident in the present work regarding the role of ILC2 in host protection. IL-13 is key to resistance to multiple GI nematode infections and ILC2 are a potent source of this cytokine [28,29] with these cells sufficient for resistance to N. brasiliensis infection [29]. Here we suggest that ILC2s have little/no role in resistance against T. muris infection following either a trickle infection or a single high dose infection. A major driver of the ILC2 response following intestinal parasite infection has been identified as the tuft cell, which produces IL-25 promoting ILC2 expansion and IL-13 production [7,8,44]. The tuft cell response is muted during T. muris infection compared to other systems such as N.brasiliensis, H. polygyrus and T. spiralis [7,8,45]. Previous work has shown that IL-25 null mice are susceptible to a high single dose T. muris infection although no increase in IL-25 mRNA expression was found following infection in WT mice. Interestingly, resistance and a Th2 response was recovered in IL-25 null mice when IL-12 was blocked, suggesting that resistance did not absolutely require IL-25 [46]. The present data supports a poor IL-25 response following T. muris infection as evidenced by minimal changes in tuft cell numbers. The difference between Trichuris and other model systems studied may be due to both the infection regime/dose used and significant differences in life strategies evolved by the different species of parasite. Certainly, most models have used high dose bolus infections to stimulate strong Type 2 immunity including ILC2 responses. A strong induction of ILC2 and as a consequence, a considerable increase in IL-13, may provide rapid and sufficient induction of appropriate effector mechanisms required to expel the parasites [47]. Also, T. muris is distinct from other GI model systems in that to progress to patency it induces a Th1 response as part of its strategy to survive whereas even in systems where chronic infection occurs (e.g. H. polygyrus infection) it is set against induction and subsequent modulation of a Type2/Th2 response [48].The intestinal region which Trichuris inhabits is also relatively unique when compared to other enteric helminths, with the caecum being its preferred site [16]. It is not surprising therefore that T. muris can induce an intestinal dysbiosis following chronic infection [21,22] that is dependent upon the presence of worms [21,23]. Here we used the final stool microbiota as proxy for the meta-state of the intestinal microbiome. The distal colon and caecum are anatomically distinct environments with variations in histological structure and thickness of the mucus barrier, meaning that there will be some distinction between the composition of the microbiota between sites. However, we have previously shown, using low dose infection, that stool microbiota correlates closely with caecal content during T. muris infection [21]. During trickle infection we now show a dysbiosis in the intestinal microbiome, distinct from single low dose infectedmice, that begins to resolve once partial resistance develops. We found that high abundance genera present in naïve mice that were lost or reduced at 9 weeks p.i. in trickle infectedmice were found to return following the observed development of resistance, as well as an overall increase in alpha diversity. It is tempting to speculate that given sufficient time the microbiota would return to a naïve-like phenotype despite the continued presence of T. muris. Microbiome studies from humans naturally infected with GI nematodes including whipworm have been carried out with varied outcomes regarding the influence of helminth infection [49-51]. This may be explained in part by cofounding factors including co-infection, diet, age and level of worm burden. However, it has been suggested that T. trichiurainfection alone is not sufficient to alter the intestinal microbiome [50]. Our data supports a more dynamic view of the relationship between the microbiota, and infection and immunity with Trichuris species. We suggest that during early recurrent infections, when the host is still susceptible, Trichuris alone is capable of driving dysbiosis. However, at the point where a protective immunity is attained, the microbiota will begin to return to a more homeostatic composition characteristic of un-infected individuals.There is conflicting data as to the influence of chronic helminth/GI nematode infection upon the incidence of allergic responses e.g. skin prick tests in humans [52]. With regards to model systems studies using chronic H. polygyrus infections have shown that allergic lung responses are muted compared to non-infected animals [53,54] and single low dose chronic infections with T. muris also influence lung allergic responsiveness [55]. Low dose chronic T. muris infection also mutes contact hypersensitivity response to Th1 contact sensitizing agents but not Th2 sensitizing agents [16]. Chronic H. polygyrus infection modulated responses to both Th1 and Th2 skin sensitizing agents [16]. Here, we show that trickle T. muris infection does not modulate an immediate (IgE) hypersensitivity response in the skin (nor does a single low dose infection).It is common in endemic regions for individuals to be infected by multiple species of GI nematode, including skin penetrating species e.g. hookworm [56-58]. In order to assess whether such an infection would influence or be influenced by a T. muristrickle infection a single dose of N. brasiliensis was superimposed. Neither parasite appeared to be affected in terms of resistance status at least with regards to the timing and challenge regime used here.Overall, the present work demonstrates that partial Type 2 mediated resistance to whipworm, similar to that seen under natural infection, can be generated under laboratory conditions using repeated low dose infection. Functionally, immunity is dependent upon CD4+ Th2 cells and a role for ILC2s could not be established. This approach will complement and extend those models already used for study of immunity to GI nematodes and importantly highlight key differences allowing a more rational comparison to the field situation.
Materials and methods
Ethics statement
Experiments were performed under the regulation of the Home Office Scientific Procedures Act (1986), and were approved by the University of Manchester Animal Welfare and Ethical Review Body.
Animals
C57BL/6, RAG-/- and iCOS-T (kindly provided by Dr A N McKenzie),[29] mice were maintained in individually ventilated cages in the University of Manchester animal facility in accordance with Home office regulations (1986). Mice were housed for at least 7 days prior to experimentation and were 6–8 weeks old males.
Parasitological techniques
Mice were infected with Trichuris muris embryonated eggs weekly for 3, 5 or 9 weeks. Mice received 20 eggs in 200μl of dH20 by oral gavage. Two weeks following the final infection, worm burdens and immune responses were analysed. Caeca were collected from infectedmice and parasites sorted into L2, L3, L4 larval stages and adult worms for counting. Faecal egg output was analysed by suspending stool pellets in saturated NaCl and counting in a McMaster Chamber, eggs per g of faeces was calculated.Mice were infected with 500 Nippostrongylus brasiliensis stage 3 larvae (L3) by subcutaneous injection. To determine worm burden of N. brasiliensis the lungs and small intestine of infectedmice were collected at autopsy. The lungs were placed onto gauze and chopped into small pieces. The gauze containing lung tissue was suspended in 50ml of PBS and incubated at 37°C for 4 hours to allow parasites to move from the tissue and to be counted. The lung tissue was then digested in 1mg/ml collagenase D (Sigma) 0.5mg/ml Dispase (Sigma) in RPMI 1640 medium and incubated at 37°C on a rotator. Digested lung tissue was centrifuged and re-suspended in PBS and parasites were counted. Small intestine was split longitudinally and place in gauze suspended in PBS. After incubation at 37°C for 4 hours, worms were counted.
Production of T. muris Excretory/ Secretory product
To produce T. muris excretory/secretory products (E/S) for immunological techniques, the parasite was passaged through SCID mice that are susceptible to infection. SCIDs received a high dose of approximately 400 T. muris embryonated eggs and at approximately day 35–42 p.i. the large intestine was collected to produce adult E/S. To produce L4 E/S mice were culled at day 28 p.i. To produce L3 E/S mice were culled at day 20 p.i. Guts were collected and longitudinally split open and washed in warmed 5x penicillin/streptomycin in RMPI 1640 medium. Adult, L4 and L3 worms were carefully pulled from the gut using fine forceps and transferred to a 6 well plate containing 4ml warmed 5x pen/strep in RMPI 1640 medium. Plates were placed into a moist humidity box and incubated for 4 hours a 37°C. Adult worms were then split into 2 wells containing fresh medium and incubated again in a humidity box at 37°C overnight. Supernatant from 4 hour and 24 hour incubation was collected and centrifuged at 2000g for 15 minutes. T. muris eggs from adult worms were resuspended in 40ml deionised water and filtered through a 100μm nylon sieve before transferring to a cell culture flask. To allow embryonation, eggs were stored in darkness for approximately 8 weeks and then stored at 4°C. Susceptible mice were subsequently infected with a high dose infection to determine infectivity of each new batch of eggs.To produce L2 E/S, SCID mice were infected with a high dose of T. muris and at day 14 p.i. guts were collected and placed in 5 x pen/strep in PBS. Guts were cut longitudinally and were washed to remove faecal debris. The guts were cut into small sections and added to 0.9% NaCl in PBS and incubated in a water bath at 37°C for two hours to allow L2 larvae to come free from the epithelium.L2 larvae were removed from the NaCl and placed into 5 x pen/strep RPMI 1640 medium and incubated overnight at 37°C. The following day the larvae and RPMI 1640 medium was centrifuged at 720g and the E/S was recovered.To produce L1 E/S, eggs were hatched in 2ml sodium hypochlorite (Fisher chemical) in 4ml H2O for 2 hours at 37°C. L1 larvae were washed in RPMI 1640 medium, 10% FCS, 100 unit/ml of penicillin, 100μl/ml of streptomycin until media returned to original colour. Larvae were cultured at 37°C for 3 weeks with media being collected and replaced twice a week.All E/S supernatant was collected and filter sterilised through a 0.2 μm syringe filter (Merck). E/S was concentrated using an Amicon Ultra-15 centrifugal filter unit (Millipore) by spinning at 3000g for 15 minutes at 4°C. E/S was dialysed against PBS using Slide-A-Lyzer Dialysis Cassettes, 3.500 MWCO (Thermo Science) at 4°C. The concentration of E/S was measured using the Nanodrop 1000 spectrophotometer (Thermo Fisher Science) and aliquoted before storing at -20°C.
CD4+ T cell depletion, adoptive transfer, and treatment of iCOS-T mice with diphtheria toxin for innate lymphoid cell 2 depletion
In vivo depletion of CD4+ T cells was achieved by administration of ratIgG2b anti-mouseCD4 (GK1.5, BioXCell). Control animals were treated with the matched isotype control antibody (LTF-2, BioXCell). Animals were treated 3 times a week for 3 weeks with 200μg antibody in 200μl by intraperitoneal (IP) injection.ICOS-T mice were treated with diphtheria toxin (DTx, Merck) to induce specific depletion of ILC2s. Mice received 750ng DTX in 200μl by IP injection once a day for 5 days. Control mice received a PBS control injection (20).To isolate CD4+ T cells, single MLN cell suspensions were prepared and purified using (L3T4) MicoBeads (Miltenyi Biotec). Purified CD4+ T cells were counted and resuspended in 0.1% BSA/PBS for injection.
CD4+ T cell and innate lymphoid cell quantification by Flow cytometry
Lymph nodes were pressed through a 100μm nylon cell strainer (Fisher Scientific) and cells were pelleted by centrifugation at 400g for 5 minutes. The supernatant was removed and the pelleted MLN cells were resuspended in 1ml of complete RPMI.The large intestine was opened longitudinally with blunt ended scissors and cut into 0.5cm segments before washing in 2% foetal calf serum (FCS) in Hank’s Balanced Salt Solution (HBSS) (Sigma, Life Sciences). To remove epithelial cells, large intestine segments were added to 2mM Ethylenediaminetetraacetic acid (EDTA)/HBSS and incubated on a rotator for 15 minutes at 37°C. Samples were strained through a metal strainer and were washed in 2% FCS HBSS. Gut segments were incubated in EDTA/HBSS for 30 minutes at 37°C on a rotator. To isolate lamina propria lymphocytes (LPLs), large intestine segments were added to an enzyme cocktail of 0.85mg/ml Collagenase V (Sigma), 1.25mg/ml Collagenase D (Roche), 1mg/ml Dispase (Gibco, Life Technologies) and 30μg/ml DNase (Roche) in 10ml complete RPMI (Sigma, Life Sciences). Samples were incubated on a rotator at 37°C for 45 minutes or until all tissue was digested. Samples were passed through a cell strainer (Fisher Scientific resuspended in complete RPMI.MLN and large intestine cell suspension were stained with 1μl of Fixable Viability Dye (eBioscience) to identify live cells. Samples were fixed and permeabilised using the Foxp3/Transcription Factor Staining Buffer Set (eBioscience) and blocked for non-specific binding by incubating samples in 50μl Anti-MouseCD16/CD32 Fc Block (eBioscience). Samples were stained for cell surface and intracellular markers. Samples were read on a BD LSRFortessa flow cytometer (BD Biosciences) running FACSDiva acquisition and analysed using FlowJo X (Tree Star, Inc).Cell surface markers: primary antibodies anti-CD11b (CR3a); anti-NK1.1 (PK126); anti-Ly6G (Gr-1); anti-CD11c (N418); anti-CD45R (RA3-6B2); anti-CD19 (1D3); anti-TER-119 (TER-119); anti-CD49b (DX5); anti-F4/80 (BM8); anti-FCεR1 (MAR1); anti-CD4 (RM4-5); anti-CD45 (30-F11); anti-CD127 (A7R34); anti-TCR-beta (H57-597) and anti-CD8a (53–6.7) purchased from eBioscience. Primary anti-CD90.2 (30-H12) and secondary streptavidin PE Dazzel purchased from Biolegend. Intracellular markers: anti-GATA3 (16E10A23); anti-Tbet (ebio4BIO); anti-Roryt (B2D); anti-FOXP3 (FJK-16s) purchased from ebioscience. Primary antibodies were used at dilutions 1:50–1:800. Secondary antibodies used at 1:1000 dilution.
Quantification of parasite specific IgG1 and IgG2a/c by ELISA
Blood was collected from mice at autopsy and serum was isolated. ImmunoGrade plates (BrandTech Scientific, Inc) were coated with 5μg/ml T. muris excretory secretory (E/S) product from Adult, L4, L2, L2 or L1 parasites. Plates were washed using a Skatron Scan Washer 500 (Molecular Devices, Norway) 5 times with PBST following each incubation. Plates were blocked with 3% bovineserum albumin (BSA). A double dilution of serum samples was added to plates with a starting dilution of 1:20. Biotinylated rat anti-mouseIgG1 (1:2000, Biorad) or rat anti-mouseIgG2a/c (1:1000, BD Pharmigen) was added to plates followed by Streptavidin peroxidase (Sigma). Plates were developed with ABTS (10% 2,2’azino 3-thyl benzthiazoline) and read at 405nm with 490nm reference on a Dynex MRX11 microplate reader (Dynex Technologies).
Histology and immunofluorescence
Caecal tips were collected and fixed in Carnoy’s solution. Sections were paraffin embedded and 5μm sections were mounted onto slides for staining. To analyse caecal crypts and goblet cell counts sections were stained with periodic acidSchiff’s reagent (PAS) and counterstained with Meyers haematoxylin(Sigma). To analyse mucin sulphation, sections were stained with High- Iron Diamine-Alcian Blue (HID-AB). Images were visualised using an Axioskop upright microscope using the Axiovision software.To stain for Brdu, Muc2 and tuft cells, sections were stained with primary anti-BRDU (BU1/75, BioRad), anti-Muc2 antibody, 1:200 dilution (5501, gift from D. Thornton) or anti-Dclk1 antibody, 1:800 dilution (Abcam) at 1:800 dilution). Sections were washed in PBS and incubated in secondary antibody goat anti-rabbit Af488 (Life techologies) for 1 hour at room temperature. Nuclear structures were stained with DAPI. An Olympus BX51 upright microscope was used to visualise staining using MetaVue software.
Intestinal microbiome analysis
Stool samples were collected from mice and DNA was extracted using the QIAamp DNA stool mini kit (Qiagen) according to manufacturer’s instructions. To charactarise the gut microbiome the 16S rRNA gene was amplified using 16S primers that target the V3/V4 region. Forward primer: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’. Reverse primer: 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’. Samples were amplified using the following conditions: 10–50 ng of template DNA, 12.5 μL of 2x KAPA HiFi HotStart ReadyMix, 5 μL each of 1 μM forward and reverse primers in a 25 μL reaction. The cycle parameters are as follows: 95°C 3 min, then 25 cycles of 95°C 30 s; 55 oC 30: 72 oC s: with a final step of 72 oC for 3 min. The 16S amplicons were purified using AMPure XP magnetic bead purification. Samples were indexed using the Nextera XT index kit and then quantified by Illumina Miseq in the Genomic Technologies Core Facility at the University of Manchester. Sequences were trimmed using Trimmomatic then clustered into OTUs with a sequence similarity of 97% and taxonomy was assigned in QIIME [59] using the SILVA132 database. Statistical analysis and non-metric Multidimensional Scaling (NMDS) were performed using the R-package. OTU counts were normalised using the DESeq2 package [60]. Shannon diversity, PERMANOVA tests, and rarefaction were performed using the Vegan package. NMDS plots represent Euclidian distances plotted in arbitrary two dimensional space centred on zero. Stress is a measure of quality of fit of Bray-Curtis dissimilarities where less than 0.2 indicates good fit on two dimensional plots. NMDS and bubble graphs were produced using the ggplot2 package.
Gene expression of gut associated genes
Caecal tips were collected at autopsy and RNA was extracted using the TRIzol method (Invitrogen). cDNA was generating using the GoScript Reverse Transcriptase kit (Promega). Quantitative-PCR was set up using the SensiFAST SYBR Hi-ROX kit (Bioline) on a StepONE system (Applied Biosytems). Genes of interest were normalised against β-actin and expressed as fold change compared to naïve mRNA expression. Muc2: F:5’GTCCAGGGTCTGGATCACA. R:5’ CAGATGGCAGTGAGCTGAGC. Muc5ac: F:5’ GTGATGCACCCATGATCTATTTTG R:5; ACTCGGAGCTATAACAGGTCATGTC. Relm-β: F:5’ GCTCTTCCCTTTCCTTCTCCAA R:5’ AACACAGTGTAGGCTTCATGCTGTA. TFF3: F:5’ TTATGCTGTTGGTGGTCCTG. R:5’ CAGCCACGGTTGTTACACTG. β-actin: F: 5’ TCTTGGGTATGGAATGTGGCA R:5’ACAGCACTGTGTTGGCATAGAGGT. TSLP: F:5’ AGCAAGCCAGTCTGTCTCGTGAAA R: TGTGCCAATTCCTGAGTACCGTCA Amphiregulin: F:5’ TCTGCCATCATCCTCGCAGCTATT R:5’ CGGTGTGGCTTGGCAATGATTCAA. Bacterial load: F: 5’ TCCTACGGGAGGCAGCAG. R: 5’ GGACTACCAGGGTATCTAATCTT.
Mucus extraction and analysis
Mucus was extracted by flushing large intestines with PBS and shaking in 2M urea. Samples were reduced by dithiothreitol (DTT) and run on a 1% agarose gel in TAE buffer. Mucins were transferred onto a nitrocellulose membrane, blocked with casein and probed using chicken anti-mouseMuc5ac antibody (Rockland) followed by an incubation with the goat anti-chicken IgY AF790 (Abcam). The membrane was imaged using the Odyssey CLx Imaging system (Licor) on Image studio software (15).
MLN re-stimulation and cytokine analysis by Cytometric bead assay (CBA)
Mesenteric lymph nodes (MLNs) were isolated at autopsy and cells were restimulated with 50μg/ml T. muris adult ES. Cells were incubated for 48 hours at 37°C, 5% CO2. Supernatant from cell cultures were incubated with a capture bead cocktail for cytokines of interest (BD Bioscience), containing one for each cytokine. Detection beads (BD Bioscience), diluted in detection reagent (BD Bioscience) was added to each well and incubated. Plates were washed and resuspended in 70μl wash buffer (BD Bioscience). Cytokines were measured on a MACSQuant Analyser (Miltenyi Biotec) and analysed using the FCAP array software in reference to a standard curve.
Measurement of skin immediate hypersensitivity
Mice were sensitised with 50μg ovalbumin (OVA, Sigma) in 2mg Alum (Thermo Scientific) by I.P. injection. Control mice were injected with PBS in Alum. Mice received one dose a week for 3 weeks. Two weeks after the final injection the anaphylaxis assay was performed.Mice were anesthetised by 2% isoflurane. Mice were injected subcutaneously with 5μg OVA in 10μl PBS into one ear and 10μl PBS into the other. The ear was stabilised onto a falcon tube to aid injections. After 3 minutes 200μl of 0.5% Evans Blue dye (Sigma) was injected into the tail vein. After 10 minutes, mice were euthanised and ears were removed and placed into 700μl Formamide (Sigma). The ears were incubated overnight at 63°C to allow dye to leak into the Formamide. 300μl of each sample was transferred into a 96 well plate in duplicate and read on a VersaMax Microplate reader (Molecular Devices) at 620nm.
Statistical analysis
Statistical analysis completed using a one-way ANOVA, followed by post-hoc Tukey’s test or an unpaired t-test using GraphPad Prism 7 software.
T. muris trickle infection regime.
Schematic representing a trickle infection regime. C57BL/6 mice were infected weekly with low doses of T. muris (20 eggs) for 3, 5, 7 or 9 weeks (red arrow). 2 weeks after the final infectious dose at week 5, 7, 9 and 11, worm burdens and immune responses were analysed (black box).(TIF)Click here for additional data file.
CD4+ T cells in MLN following T. muris trickle infection.
C57BL/6 mice were infected weekly with low doses of T. muris and 2 weeks after the final trickle infectionCD4+ T cells in the MLN were analyzed by FACs. CD4+ cell subsets were identified by transcription factor expression; Th1 (Tbet+), Th2 (GATA3+), Th17 (RORγt+), Tregs (FOXP3+). n = 10, from two independent experiments. CD4+ T cell percentage calculated as percentage of all live cells. T cell subset percentage calculated as percentage of all CD4+ cells.(TIF)Click here for additional data file.
T. muris specific antibody responses in trickle infected mice.
Antibody responses measured from sera collected from trickle infectedmice. Antibody levels were measured using indirect ELISA where serially diluted serum from individual mice was incubated in 96-well plates coated with T. muris E/S, then targeted with antibodies against mouseIgG1 or IgG2a/c. Values are given as arbitrary optical density values of the substrate measured at 405 nm. The antibody response specific for adult worms and larval stages 1–4 was measured. (A) IgG1 response. (B) IgG2a/c response. (C) Total IgE response. n = 5, statistical analysis completed by a one way-ANOVA. Data presented as mean +/- SEM, * = p<0.05, ** = p<0.01, **** = p< 0.0001.(TIF)Click here for additional data file.
Challenge infection of T. muris trickled mice.
To determine whether trickle infection could protect against a challenge infection, trickle infectedmice were either left to expel all worms naturally or worms were removed by anti-helminthic treatment. (A) At week 30, following either a single high or low dose infection or trickle of low dose infections, when no worms were present, determined by measuring faecal egg output, mice were challenged with a single low dose infection. Control mice received a low dose challenge at week 30 post infection n = 10 or greater. (B) Following a single low dose infection or a trickle of 3 low dose infections, mice were treated with anti-helminthics to remove final worms at week 11 post infection. Worm expulsion was confirmed by the absence of eggs in the faeces, Mice were then challenged with a low dose infection one week following anti-helminthic treatment. Worm burden was assessed by eye under dissecting microscope. n = 5 representative of two independent experiments, statistical analysis completed by a one way ANOVA or an unpaired t test. Data presented as mean +/- SEM, * = p<0.05, ** = p<0.01, *** = p<0.001, **** = p< 0.0001.(TIF)Click here for additional data file.
T. muris specific antibody responses following CD4+ T cell depletion.
Sera from T. murisinfectedmice depleted of CD4+ T cells was collected and IgG1 and IgG2a responses specific for T. muris larval stages were quantified. Antibody levels were measured using indirect ELISA where serially diluted serum from individual mice was incubated in 96-well plates coated with T. muris E/S, then targeted with antibodies for against mouseIgG1 or IgG2a/c. Values are given as arbitrary optical density values of the substrate measured at 405 nm. A) IgG1 response to adult worms and larval stages 1–4. B) IgG2a response to adult worms and larval stages 1–4. Isotype control in grey. Anti-CD4 treatment mice in black n = 5. (C-D) CD4+ T cells were isolated and purified from week 11 trickled infectedmice. 2x106 CD4+ T cells were injected i.v. into C57BL/6 mice which then received a single low dose infection (20 eggs) the following day. C) Worm burden was counted at day 35 p.i. D) ELISA to quantify T. muris specific IgG1 and IgG2c levels. Data presented as mean +/- SEM, n = 5.(TIF)Click here for additional data file.
ILCs counts in MLN.
Innate lymphoid cell counts and percentage in the MLN following T. muristrickle infection measured by FACS, identified as lineage negative, CD90.2+, CD127+. Total ILC percentage calculated as percentage of all live cells. ILC subset calculated as the percentage of total ILCs. n = 3, statistical analysis completed by a one way-ANOVA. Data presented as mean +/- SEM, * = p<0.05, ** = p<0.01(TIF)Click here for additional data file.
Depletion of ILC2s in ICOS-T mice.
ILC2s were depleted from ICOS-T mice by DTx treatment. (A) Mice received 750ng DTx (red arrow) for 5 days before T. muris high dose (400 eggs) infection (purple arrow) and 1 week after T. muris infection for 5 days. Control mice received PBS control injections at the same time points. Worm burden was analysed at week 5 p.i. (black arrow). (B) Flow cytometry to confirm depletion, ILC2s identified as Lineage-, CD127+, CD90.2+, GATA3+ cells. ILC2% of all ILCs and ILC2 counts. (C) Worm burden of T. muris at day 35 p.i. Statistical analysis completed by an unpaired t-test. Data presented as mean +/- SEM, * = p<0.05. n = 3–5.(TIF)Click here for additional data file.
Immediate hypersensitivity response to OVA antigen during Trichuris muris infection.
C57BL/6 mice were infected with a single low dose or trickled with T. muris over 9 weeks. At week 8 following the first infectionmice were sensitized with 50 μg OVA antigen in 2mg of Alum or PBS control for 3 weeks. 4 weeks following the final sensitization all mice were challenged with 50 μg OVA by intradermal injection in the right ear and a PBS control injection in the left ear. A) Timeline of T. muris infection and sensitisation and challenge of OVA/PBS. B) Immediate hypersensitivity response in mice following PBS and OVA challenge. Hypersensitivity was determined by measuring skin permeability after OVA challenge using an Evans Blue assay. Levels of Evans Blue were quantified by absorbance and data are represented as arbitrary absorbance values at 602 nm. C) Side-by-side comparison of hypersensitivity response following OVA stimulation in naïve mice, low dose infectedmice, and trickle infectedmice from panel B. D) Worm burdens of T. muris trickle infectedmice. Data presented as mean +/- SEM. Statistical test calculated by an unpaired t-test, ** = p<0.01, *** = p<0.001, **** = p< 0.0001, n = 5.(TIF)Click here for additional data file.
Co-infection of Trichuris muris with Nippostrongylus brasiliensis.
C57BL/6 mice were infected with a single T. muris low dose (20 eggs) or trickle infected of 9 weekly low doses by oral gavage. At week 10, T. murisinfectedmice and naive mice were infected with a single high dose (300 larvae) of N. brasiliensis by subcutaneous injection. At day 3 and day 6 following the N. brasiliensis infection, worm burdens of N. brasiliensis from the lung and small intestine and T. muris in the caecum, were counted. A) Timeline of infection regime. B) Worm burdens of N. brasiliensis in the small intestine and lung. C) T. muris worm burdens from low dose infected and trickle infectedmice. Burdens of total worms and well as adult, L4, L3 and L2 were counted for trickle infectedmice. Data presented as mean +/- SEM. Statistical analysis was carried out using a one-way ANOVA followed by post-hoc Tukey’s test. n = 5.(TIF)Click here for additional data file.
Composition of microbial communities during infection.
Following trickle infectionmice were sacrificed at week 9 and week 11 post primary infection and the final stool microbiome was measured using 16S sequencing. (A) Rarefaction curves for individual samples calculated in R using the vegan package. (B) Phylum level comparisons between groups. Data represents the mean from 4 mice. Phyla representing, on average, less than 2% of the population were grouped into “other.”(TIF)Click here for additional data file.26 Jul 2019Dear Prof. Grencis,Thank you very much for submitting your manuscript "Trickle infection and immunity to Trichuris muris" (PPATHOGENS-D-19-01054) for review by PLOS Pathogens. Your manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important problem, but raised some substantial concerns about the manuscript as it currently stands. These issues must be addressed before we would be willing to consider a revised version of your study. We cannot, of course, promise publication at that time.We therefore ask you to modify the manuscript according to the review recommendations before we can consider your manuscript for acceptance. Your revisions should address the specific points made by each reviewer.In addition, when you are ready to resubmit, please be prepared to provide the following:(1) A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.(2) Two versions of the manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.Additionally, to enhance the reproducibility of your results, PLOS recommends that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see http://journals.plos.org/plospathogens/s/submission-guidelines#loc-materials-and-methodsWe hope to receive your revised manuscript within 60 days. If you anticipate any delay in its return, we ask that you let us know the expected resubmission date by replying to this email. Revised manuscripts received beyond 60 days may require evaluation and peer review similar to that applied to newly submitted manuscripts.[LINK]We are sorry that we cannot be more positive about your manuscript at this stage, but if you have any concerns or questions, please do not hesitate to contact us.Sincerely,William C GauseAssociate EditorPLOS PathogensJames KazuraSection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XGrant McFaddenEditor-in-ChiefPLOS Pathogensorcid.org/0000-0002-2556-3526***********************Reviewer's Responses to QuestionsPart I - SummaryPlease use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.Reviewer #1: Animal infection experiments are usually carried out with single bolus inoculations, whereas natural infections often involve repeat exposures to low doses. In this manuscript, the authors examine the outcome of repetitive low dose inoculations by gastrointestinal helminths using trickle infection of mice by Trichuris muris as a model. Their main finding is that the initial response is dominated by Th1, which eventually switches to a Th2 response that leads to worm expulsion. Although the outcome of trickle infection did not reveal any surprising aspect of parasite immunity, this study will be an important resource to the field as it demonstrates that repetitive low doses evokes a response that is distinct from previous findings in which mice receive one low dose that leads to a chronic infection. This study establishes the model and carefully documents the time course of infection. There are a few concerns regarding interpretation of the results that the authors may want to address prior to disseminating the findings to the field.Reviewer #2: In this study presented by Glover et al. the authors seek to investigate how immunity to T. muris changes following repeat exposures to low doses of parasites. This is an extremely important question and one that is not well understood considering that the majority of studies investigating immunity to helminths focus on determining how the host responds to a single large dose of parasites. The model that is being employed in this study is much more indicative of what is occurring in humanpatients and has the potential substantially inform our understanding of how immunity is truly developed.By using this system, the authors show that there is a transition point at week 11 at which point the mice develop immunity and start to clear the worms. They nicely demonstrate that this transition appears to coincide with increase production of IL-13, mucus production and goblet cell responses. Further, they take a loss-of-function approach and show that CD4+ T cells appear to be the main mediators of this acquired protection. Further, they demonstrate that acquired immunity following a trickle infection is maintained and protective following a subsequent challenge. Finally, they show that the composition of microbial communities in the gut is altered in mice that remain susceptible to infection, but begins to return to baseline as immunity it acquired.Reviewer #3: The study by Glover et al presents a very thorough and clear report of how trickle infection with Trichuris impacts on host resistance and immunity. The rationale for the study is that the bulk of the literature utilities bolus infections (one or more applications of large egg/larval numbers to the host) whereas trickle infection represents the nature case (for all animals, including rodents that can be infected with Trichuris) and that it would therefore be important to determine the impact of trickle infection on host responsiveness and worm burdens.It is commendable that the authors took the time to properly address these largely ignored but important issue, and I have little doubt that their efforts will help both inform and alter the work of all scientists interesting in modeling host-helminth interactions.As a whole the work is concisely presented and represents a large and well controlled body of data. The only comments I have for improvement of the manuscript relate to data inclusion and/or presentation and editorial modifications as can be found below.**********Part II – Major Issues: Key Experiments Required for AcceptancePlease use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".Reviewer #1: There are 3 variables that change when the authors compare early time points versus the late time points – age of the mice, number of inoculations, and the amount of time that has passed since the first inoculation. Therefore, it is difficult to know what led to alterations in worm burden and Th responses at the later time points. What happens if they perform repetitive inoculations for the first 3-5 weeks and then examine at week 11?Reviewer #2: As stated above, careful studies of this nature are extremely important and are likely to be very informative. Although the authors have nicely characterized the model and the dramatic changes that are occurring between weeks 9-11, there is no explanation of the mechanisms that drive this transition. In its current state, the study is very observational. There appears to be an important transition in the Th2 cells that occurs after week 9 despite the fact that by week 9 the mice have been challenged 7 times and have 50 worms. Why do 2 more challenges drive this difference, is it just a magnitude issue? What do the authors think is happening, considering that little change in the worm burden is occuring between weeks 7-9 it doesn’t seem like its simply antigen load. It would be great if they authors could determine whether T cells transferred on week 9 and 11 differed in their ability to promote immunity using a gain of function approach. They should them determine what has truly changes in those T cells to give mechanistic insight. Transcriptional profiling would be ideal to accomplish this assuming that its T cell intrinsic. In general, the manuscript needs more mechanistic data to be appropriate for publication.Also, although interesting the microbiome analysis seems out of place and is very observational in its current form. What are the authors trying to say about these findings and how they relate to the development of immunity?Reviewer #3: none**********Part III – Minor Issues: Editorial and Data Presentation ModificationsPlease use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.Reviewer #1: In Fig 5b, have the authors confirmed that the dose of anthelmintic used was effective at clearing worms?For Fig 4, please specify the time points and egg doses in the legendReviewer #2: (No Response)Reviewer #3: Comments related to data and figure legends:1) The experimental design of the work presented Figure 5 was extremely interesting and is given a strong degree of relevance by the authors in that a entire subsection (lines 160--174) is detected to it. However a very limited data set is shown and as such the data stands in stark contrast to the rest of the manuscript. Many questions remain open including the impact on specific larval stages, the association with various cytokines and antibodies, epithelial cell responses and so forth.For these reasons I would recommend one of the following options i) extending the dataset, ii) moving it to the supplementary information, or iii) removing this figure and instead working further to determine whether ILC2 or CD4 T cells were involved in the long-lasting protection observed, and to determine the functional significance of antibodies (perhaps by passive transfer exps) at this time.2) It is not clear whether the data shown in Figure 9 is pooled from two experiments or is one data set that is representative of 2 exps. Given the worm counts are very variable and the possible trend toward increased worm counts in the DTx treated mice it would be useful to either show the second experiment or to increase the total number of mice investigated to increase power.3) The pictures of tuft cells shown in Fig8 are not convincing. Better representative pictures and/or pictures at higher magnification should be shown to convince the readers the authors performed a correct quantification of tuft cells. It might also be useful to show pictures from the SI of Nippo infectedmice for comparison and again to convince the readers correct techniques were employed in enumerating tuft cells.Comments related to editoral changes:1) many of the figure legends do not contain enough information to allow the reader to understand the experiment, this is especially true of the supplementary figures. For instance no information is given as to the length or timing of the Edu pulse (figures 4 and 7 or how antibody levels were quantified (Supplementary)2) It would be useful for the authors to clearly state in the text that the microbiota analyses was performed in stool, and to discuss the drawbacks of using stool versus cecal contents and mucous layers in terms of exploring the true extent of the impact of infection.3) I am not sure I agree with the authors conclusion that antibody levels were unaffected by CD4 T cell depletion (they seem to be decreased)? As no evidence regarding the role of antibodies is provided it would be better to refrain from raising their involvement as being unlikely and instead simply say that this was not determined.**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: NoReviewer #3: No9 Sep 2019Submitted filename: Rebuttal letter Plos pathogens.docxClick here for additional data file.9 Oct 2019Dear Prof. Grencis:Thank you very much for submitting your manuscript "Trickle infection and immunity to Trichuris muris" (PPATHOGENS-D-19-01054R1) for review by PLOS Pathogens. Your manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important topic but identified some aspects of the manuscript that should be improved.We therefore ask you to modify the manuscript according to the review recommendations before we can consider your manuscript for acceptance. Your revisions should address the specific points made by each reviewer.In addition, when you are ready to resubmit, please be prepared to provide the following:(1) A letter containing a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.(2) Two versions of the manuscript: one with either highlights or tracked changes denoting where the text has been changed; the other a clean version (uploaded as the manuscript file).While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.We hope to receive your revised manuscript within 60 days or less. If you anticipate any delay in its return, we ask that you let us know the expected resubmission date by replying to this email.[LINK]If you have any questions or concerns while you make these revisions, please let us know.Sincerely,William C GauseAssociate EditorPLOS PathogensJames KazuraSection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XGrant McFaddenEditor-in-ChiefPLOS Pathogensorcid.org/0000-0002-2556-3526***********************Reviewer's Responses to QuestionsPart I - SummaryPlease use this section to discuss strengths/weaknesses of study, novelty/significance, general execution and scholarship.Reviewer #1: The authors have used the literature to argue that the control conditions for their experiments have been performed extensively by other groups and that their observations cannot be explained by confounding variables such as the age of the mice and elapsed time. I accept these points and also appreciate the responses to the minor issues that were raised. I look forward to seeing the publication of this important study.Reviewer #2: As stated perviously, I believe this study is of great importance and will help advance the field if some more mechanistic data can be presented. The authors addressed some of my concerns with the adoptive transfer studies they presented, but I believe they are very important and should be added to the manuscript. It is entirely possible that the T cells are necessary but not sufficient for the changes in immunity. This suggest that T cells are the main effector cells but their actions are being influenced by increased mediators of activation or decreased suppressive mechanisms. I believe it is entirely within the scope of the study to better define these pathways. At the least, can the authors confirm that T cells are necessary but not sufficient and then postulate why that may be the case. Although I would like to see them take a deeper dive into the mechanisms I am very enthusiastic about this work and believe that level of depth would be very informative for the design of future studies and greatly inform the field.Reviewer #3: The authors have addressed all the authors comments adequately**********Part II – Major Issues: Key Experiments Required for AcceptancePlease use this section to detail the key new experiments or modifications of existing experiments that should be absolutely required to validate study conclusions.Generally, there should be no more than 3 such required experiments or major modifications for a "Major Revision" recommendation. If more than 3 experiments are necessary to validate the study conclusions, then you are encouraged to recommend "Reject".Reviewer #1: (No Response)Reviewer #2: (No Response)Reviewer #3: (No Response)**********Part III – Minor Issues: Editorial and Data Presentation ModificationsPlease use this section for editorial suggestions as well as relatively minor modifications of existing data that would enhance clarity.Reviewer #1: (No Response)Reviewer #2: (No Response)Reviewer #3: (No Response)**********PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose “no”, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #2: NoReviewer #3: No29 Oct 2019Dear Prof. Grencis,We are pleased to inform that your manuscript, "Trickle infection and immunity to Trichuris muris", has been editorially accepted for publication at PLOS Pathogens.Before your manuscript can be formally accepted and sent to production, you will need to complete our formatting changes, which you will receive by email within a week. Please note that your manuscript will not be scheduled for publication until you have made the required changes.IMPORTANT NOTES(1) Please note, once your paper is accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plospathogens@plos.org.(2) Copyediting and Proofreading: The corresponding author will receive a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript.(3) Appropriate Figure Files: Please remove all name and figure # text from your figure files. Please also take this time to check that your figures are of high resolution, which will improve the readbility of your figures and help expedite your manuscript's publication. Please note that figures must have been originally created at 300dpi or higher. Do not manually increase the resolution of your files. For instructions on how to properly obtain high quality images, please review our Figure Guidelines, with examples at: http://journals.plos.org/plospathogens/s/figures.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.(4) Striking Image: Please upload a striking still image to accompany your article if one is available (you can include a new image or an existing one from within your manuscript). Should your paper be accepted, this image will be considered for our monthly issue image and may also appear on our website to feature your article. Please upload this as a separate file, selecting "striking image" as the file type upon upload. Please also include a separate "Other" file with a caption, including credits and any potential copyright information. Please do not include the caption in the main article file. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License at http://journals.plos.org/plospathogens/s/content-license. Please note that PLOS cannot publish copyrighted images.(5) Press Release or Related Media: If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team in advance at plospathogens@plos.org as soon as possible. We ask that you contact us within one week to plan ahead of our fast Production schedule. If you need to know your paper's publication date for related media purposes, you must coordinate with our press team, and your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version.(6) PLOS requires an ORCID iD for all corresponding authors on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager(7) Update your Profile Information: Now that your manuscript has been provisionally accepted, please log into Editorial Manager and update your profile, if needed. Go to https://www.editorialmanager.com/ppathogens, log in, and click on the "Update My Information" link at the top of the page. Please update your user information to ensure an efficient production and billing process.(8) LaTeX users only: Our staff will ask you to upload a TEX file in addition to the PDF before the paper can be sent to typesetting, so please carefully review our Latex Guidelines http://journals.plos.org/plospathogens/s/latex in the meantime.(9) If you have associated protocols in protocols.io, please ensure that you make them public before publication to guarantee immediate access to the methodological details.Thank you again for supporting Open Access publishing; we are looking forward to publishing your work in PLOS Pathogens.Best regards,William C GauseAssociate EditorPLOS PathogensJames KazuraSection EditorPLOS PathogensKasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XGrant McFaddenEditor-in-ChiefPLOS Pathogensorcid.org/0000-0002-2556-3526***********************************************************Reviewer Comments (if any, and for reference):5 Nov 2019Dear Prof. Grencis,We are delighted to inform you that your manuscript, "Trickle infection and immunity to Trichuris muris," has been formally accepted for publication in PLOS Pathogens.We have now passed your article onto the PLOS Production Department who will complete the rest of the pre-publication process. All authors will receive a confirmation email upon publication.The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any scientific or type-setting errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Note: Proofs for Front Matter articles (Pearls, Reviews, Opinions, etc...) are generated on a different schedule and may not be made available as quickly.Soon after your final files are uploaded, the early version of your manuscript, if you opted to have an early version of your article, will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Pathogens.Best regards,Kasturi HaldarEditor-in-ChiefPLOS Pathogensorcid.org/0000-0001-5065-158XGrant McFaddenEditor-in-ChiefPLOS Pathogensorcid.org/0000-0002-2556-3526
Authors: David Artis; Mei Lun Wang; Sue A Keilbaugh; Weimian He; Mario Brenes; Gary P Swain; Pamela A Knight; Deborah D Donaldson; Mitchell A Lazar; Hugh R P Miller; Gerhard A Schad; Phillip Scott; Gary D Wu Journal: Proc Natl Acad Sci U S A Date: 2004-08-30 Impact factor: 11.205
Authors: Alexander M Owyang; Colby Zaph; Emma H Wilson; Katherine J Guild; Terrill McClanahan; Hugh R P Miller; Daniel J Cua; Michael Goldschmidt; Christopher A Hunter; Robert A Kastelein; David Artis Journal: J Exp Med Date: 2006-04-10 Impact factor: 14.307
Authors: Neuza M Alcantara-Neves; Rafael V Veiga; João C M Ponte; Sérgio S da Cunha; Silvia M Simões; Álvaro A Cruz; Maria Yazdanbakhsh; Sheila M Matos; Thiago Magalhães Silva; Camila A Figueiredo; Lain C Pontes-de-Carvalho; Laura C Rodrigues; Rosemeire L Fiaccone; Philip J Cooper; Maurício L Barreto Journal: PLoS One Date: 2017-03-28 Impact factor: 3.240
Authors: Christopher J Oliphant; You Yi Hwang; Jennifer A Walker; Maryam Salimi; See Heng Wong; James M Brewer; Alexandros Englezakis; Jillian L Barlow; Emily Hams; Seth T Scanlon; Graham S Ogg; Padraic G Fallon; Andrew N J McKenzie Journal: Immunity Date: 2014-07-31 Impact factor: 31.745
Authors: Kathryn J Else; Jennifer Keiser; Celia V Holland; Richard K Grencis; David B Sattelle; Ricardo T Fujiwara; Lilian L Bueno; Samuel O Asaolu; Oluyomi A Sowemimo; Philip J Cooper Journal: Nat Rev Dis Primers Date: 2020-05-28 Impact factor: 52.329
Authors: Ling Zhu; Laura J Myhill; Audrey I S Andersen-Civil; Stig M Thamsborg; Alexandra Blanchard; Andrew R Williams Journal: Mol Nutr Food Res Date: 2022-03-07 Impact factor: 6.575