Literature DB >> 31730657

SON protects nascent transcripts from unproductive degradation by counteracting DIP1.

Mandy Li-Ian Tay1, Jun Wei Pek1,2.   

Abstract

Gene expression involves the transcription and splicing of nascent transcripts through the removal of introns. In Drosophila, a double-stranded RNA binding protein Disco-interacting protein 1 (DIP1) targets INE-1 stable intronic sequence RNAs (sisRNAs) for degradation after splicing. How nascent transcripts that also contain INE-1 sequences escape degradation remains unknown. Here we observe that these nascent transcripts can also be bound by DIP1 but the Drosophila homolog of SON (Dsn) protects them from unproductive degradation in ovaries. Dsn localizes to the satellite body where active decay of INE-1 sisRNAs by DIP1 occurs. Dsn is a repressor of DIP1 posttranslational modifications (primarily sumoylation) that are assumed to be required for efficient DIP1 activity. Moreover, the pre-mRNA destabilization caused by Dsn depletion is rescued in DIP1 or Sumo heterozygous mutants, suggesting that Dsn is a negative regulator of DIP1. Our results reveal that under normal circumstances nascent transcripts are susceptible to DIP1-mediated degradation, however intronic sequences are protected by Dsn until intron excision has taken place.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31730657      PMCID: PMC6881055          DOI: 10.1371/journal.pgen.1008498

Source DB:  PubMed          Journal:  PLoS Genet        ISSN: 1553-7390            Impact factor:   5.917


Introduction

The first few steps of gene expression include the production of nascent transcripts and the removal of introns via the splicing reaction. The nucleus contains numerous RNA decay machineries, and thus nascent transcripts need to be protected by various mechanisms to ensure productive gene expression [1]. Certain intronic sequences in the excised introns can target them for degradation. In principle, nascent transcripts that also contain the same intronic sequences can also be subjected to decay. In budding yeast, certain double-stranded RNA (dsRNA) stem-loop structures trigger RNase III-mediated degradation of both the excised introns and unspliced pre-mRNAs [2]. Whereas in fission yeast, decay-promoting introns target unspliced pre-mRNAs for degradation by recruiting the exosome specificity factor Mmi1 [3]. For productive gene expression, decay-promoting introns should only trigger degradation of excised introns and not nascent transcripts. How nascent transcripts avoid such degradation is unknown. Stable intronic sequence RNAs (sisRNAs) are intron-containing transcripts that are relatively more stable than their excised counterparts or those that undergo nonsense-mediated decay [4-9] They have been shown to regulate various biological processes such as germline stem cell (GSC) maintenance and embryonic development [10,11]. The Drosophila chromosome four contains an extremely high abundance of INE-1 sequences in the introns [12]. INE-1 belongs to class of transposable element abundant in Drosophila [12-14]. As a result, the fourth chromosome is a region where a high density of INE-1 sisRNAs is being produced. Here, a double-stranded RNA binding protein Disco-interacting protein 1 (DIP1) binds and degrades INE-1 sisRNAs [15]. This leads to the formation of microscopically visible DIP1-positive nuclear bodies known as satellite bodies around the fourth chromosomes [15]. DIP1 only degrades INE-1 sisRNAs after splicing as pre-mRNAs containing INE-1 sequences were unaffected in DIP1 mutants [15]. It is not understood how such a target specificity is achieved (Fig 1A).
Fig 1

Drosophila Dsn is a satellite body component.

(A) Working model of DIP1 in regulating the expression of INE-1 containing pre-mRNA and INE-1 sisRNAs in Drosophila. (B) Confocal images showing the localization of FLAG-Dsn (green), DIP1 (red) and DAPI (blue) in a MTD-Gal4>FLAG-Dsn nurse cell nucleus. MTD-Gal4/CyO served as a negative control. Arrowheads point to the heterochromatin of the fourth chromosomes in the nurse cell nuclei. Arrows point to the heterochromatin of the fourth chromosomes in the follicle cells. Scale bar: 5 μm. (C) Super-resolution confocal microscopy images of a MTD-Gal4>FLAG-Dsn nurse cell nucleus stained for FLAG-Dsn (green), DIP1 (red) and DAPI (blue). Inset: magnification of area (dotted box) around the 4th chromosome. Intensity plots showing the intensities of FLAG-Dsn and DIP1 signals at different locations. Scale bar: 20 μm.

Drosophila Dsn is a satellite body component.

(A) Working model of DIP1 in regulating the expression of INE-1 containing pre-mRNA and INE-1 sisRNAs in Drosophila. (B) Confocal images showing the localization of FLAG-Dsn (green), DIP1 (red) and DAPI (blue) in a MTD-Gal4>FLAG-Dsn nurse cell nucleus. MTD-Gal4/CyO served as a negative control. Arrowheads point to the heterochromatin of the fourth chromosomes in the nurse cell nuclei. Arrows point to the heterochromatin of the fourth chromosomes in the follicle cells. Scale bar: 5 μm. (C) Super-resolution confocal microscopy images of a MTD-Gal4>FLAG-Dsn nurse cell nucleus stained for FLAG-Dsn (green), DIP1 (red) and DAPI (blue). Inset: magnification of area (dotted box) around the 4th chromosome. Intensity plots showing the intensities of FLAG-Dsn and DIP1 signals at different locations. Scale bar: 20 μm. In this study, we report the conserved protein SON (or Dsn in Drosophila) acts to protect nascent transcripts containing INE-1 from being degraded by DIP1. Our results show that nascent transcripts are bound to DIP1. However, the presence of Dsn inhibits DIP1 at the level of RNA decay activity until intron excision is completed. Thus, Dsn acts as a ‘timer’ to ensure that intronic sequences are only subjected to degradation after splicing in order for productive gene expression to take place.

Results

Dsn is a novel satellite body component

We previously reported that Dsn regulates GSCs by repressing the expression of regena (rga), which encodes for NOT2 (a component of the CCR4-NOT complex) required for the maintenance of GSCs [16-19]. To examine the localization of endogenous Dsn, we attempted to generate antibodies against Dsn using bacteria-expressed GST-tagged Dsn and peptide sequence of Dsn, but were unsuccessful. We therefore generated transgenic flies over-expressing FLAG-Dsn. When driven by a germline driver (MTD-Gal4), FLAG-Dsn rescued the dsn mutant phenotype (S1 Fig, discussed later), verifying that our FLAG-Dsn transgene produced a fully functional protein. We observed that FLAG-Dsn localized around the presumed fourth chromosomes in the ovarian nurse cells, reminiscent of the satellite body. Co-staining with the satellite body marker DIP1 confirmed that FLAG-Dsn is a satellite body component as both proteins co-localized around the presumed fourth chromosomes in the nurse cell nucleus (Fig 1B, arrowheads). Specificity of the staining was verified by the lack of signals in the somatic follicle cells (Fig 1B, arrows), and the non-transgenic control (MTD-Gal4/CyO) (Fig 1B). Although it should be noted that due to over-expression, the localization of FLAG-Dsn may not precisely reflect that of endogenous Dsn, we believe that the protein reflects it endogenous localization due to its ability to rescue the dsn mutant phenotype. To investigate further, we examined the localizations of DIP1 and Dsn more closely by super-resolution deconvolution (STED) microscopy. Under the super-resolution microscope, the localization patterns of DIP1 and FLAG-Dsn were better resolved. Interestingly, DIP1 and FLAG-Dsn did not overlap completely. Fig 1C shows a representative single optical section of the satellite bodies. Four different regions of the satellite bodies are presented. Measurements of signal intensities showed that DIP1 and FLAG-Dsn only partially overlapped, where they appeared associated closely with each other in a network (Fig 1C).

Dsn promotes the stability of INE-1 containing pre-mRNAs

DIP1 acts to repress INE-1 sisRNAs after splicing as DIP1 mutant ovaries exhibited an increase in INE-1 sisRNAs but no change in the INE-1 containing pre-mRNAs [15]. Since Dsn is also a satellite body component, we examined if Dsn performs the same function as DIP1. We used a mutant allele CG8273 that contains a transposon insertion at the 5’ UTR of dsn (or CG8273) leading to a dramatic loss (over 90% reduction) of dsn mRNA expression [16]. In contrast to DIP1 mutants, dsn mutant ovaries had a decrease in INE-1 sisRNAs and mRNAs from genes harboring INE-1 sequences in their introns (CG32000 and CG2316) (Fig 2A and 2B). To examine whether if pre-mRNA levels were affected, we performed RT-qPCR using primers that flank the exon-intron junctions, and found a consistent decrease in CG32000, CG2316 and ANK pre-mRNAs (Fig 2C). In contrast, the pre-mRNAs of genes that do not contain INE-1 sequences (Maverick and Myoglianin) were unaffected in dsn mutant ovaries (Fig 2C). Although there was a decrease in ANK pre-mRNA, we did not observe a similar decrease in ANK mRNA in dsn mutant ovaries, which may suggest a feedback mechanism regulating ANK mRNA. Together, these results indicate that Dsn specifically regulates pre-mRNAs containing INE-1.
Fig 2

Dsn is required for robust expression of 4th chromosome genes containing intronic INE-1 elements.

(A) Gene models of 4th chromosome genes, CG32000, CG2316, ANK, Myoglianin and Maverick. Red bars indicate the locations of INE-1 elements. Arrows depict the primers used for qPCR. (B) RT-qPCR showing the downregulation of INE-1, CG32000 exon and CG2316 exon in dsn mutant versus control ovaries. N = 3 biological replicates. *p < 0.05, two-tailed t test. N.S., not significant p>0.05. (C) RT-qPCR showing the downregulation of 4th chromosome genes containing INE-1 in dsn mutant but not in control ovaries. N = 3 biological replicates. *p < 0.05, two-tailed t test. N.S., not significant p>0.05. (D) Chart showing the levels of CG32000 pre-mRNA in the ovaries of control and dsn mutant flies before and after 0.5h of α-amanitin treatment. Error bars depict SD from three biological replicates. (E) Chart showing the levels of CG32000 pre-mRNA in the ovaries of control and dsn mutant flies before and after 1h, 2h and 3h of actinomycin D treatment. Error bars depict SD from three biological replicates. (F) Working model of Dsn involved in the regulation of INE-1 containing pre-mRNA and INE-1 sisRNA by DIP1.

Dsn is required for robust expression of 4th chromosome genes containing intronic INE-1 elements.

(A) Gene models of 4th chromosome genes, CG32000, CG2316, ANK, Myoglianin and Maverick. Red bars indicate the locations of INE-1 elements. Arrows depict the primers used for qPCR. (B) RT-qPCR showing the downregulation of INE-1, CG32000 exon and CG2316 exon in dsn mutant versus control ovaries. N = 3 biological replicates. *p < 0.05, two-tailed t test. N.S., not significant p>0.05. (C) RT-qPCR showing the downregulation of 4th chromosome genes containing INE-1 in dsn mutant but not in control ovaries. N = 3 biological replicates. *p < 0.05, two-tailed t test. N.S., not significant p>0.05. (D) Chart showing the levels of CG32000 pre-mRNA in the ovaries of control and dsn mutant flies before and after 0.5h of α-amanitin treatment. Error bars depict SD from three biological replicates. (E) Chart showing the levels of CG32000 pre-mRNA in the ovaries of control and dsn mutant flies before and after 1h, 2h and 3h of actinomycin D treatment. Error bars depict SD from three biological replicates. (F) Working model of Dsn involved in the regulation of INE-1 containing pre-mRNA and INE-1 sisRNA by DIP1. In dsn mutant ovaries, both the levels of pre-mRNAs and mRNAs were down-regulated, therefore excluding the possibility that Dsn regulates splicing. Next, we wondered if Dsn regulates the stability of pre-mRNA. We performed transcription inhibition assays and measured the levels of a relatively abundant pre-mRNA from CG32000 over time by RT-qPCR. Ovaries were first treated with alpha-amanitin to inhibit transcription for a period of 0.5 hr. We observed that in dsn mutant ovaries, the CG32000 pre-mRNA had a higher magnitude of decrease than in controls (Fig 2D). As a control, we examined the Marverick pre-mRNA and did not observe any difference between wild-type and dsn mutants (S2 Fig). We repeated the experiment with another transcription inhibitor Actinomycin D under a longer incubation period, and similar results were obtained (Fig 2E), suggesting that pre-mRNA was less stable in dsn mutant ovaries. Together, our results suggest that Dsn is required to ensure robust expression of INE-1 containing pre-mRNA, at least in part, by ensuring their stability (Fig 2F).

DIP1 binds to nascent transcripts in a Dsn-independent manner

It was surprising that although Dsn and DIP1 localize to satellite bodies, dsn and DIP1 mutants displayed contrasting phenotypes suggesting different functions. Since Dsn promotes the expression of INE-1 containing pre-mRNAs, and DIP1 had been found to degrade INE-1 sisRNAs, we explored the possibility that Dsn may inhibit DIP1 from degrading pre-mRNAs. We checked if Dsn regulates the expression of DIP1. RT-qPCR experiment revealed that DIP1 mRNA was unchanged in dsn mutant ovaries as compared to controls (Fig 3A). Therefore, we asked if Dsn is required for the localization of DIP1 to satellite bodies. By staining control and dsn mutant ovaries with an antibody against DIP1, we did not observe any difference in the localization of DIP1 to the satellite bodies (Fig 3B). This result indicates that Dsn is not required for the localization of DIP1 to satellite bodies.
Fig 3

DIP1 binds to nascent transcripts in a Dsn-independent manner.

(A) RT-qPCR showing no change in the expression of DIP1 mRNA in dsn mutant versus control ovaries. N = 3 biological replicates. (B) Confocal images showing the localization of DIP1 (green) in the control and dsn mutant nurse cell nuclei. Scale bar: 7 μm. Arrowheads point to the heterochromatin of the fourth chromosomes. (C) RT-qPCR showing enrichment of CG32000, CG2316 and ANK pre-mRNAs in three independent DIP1 immunoprecipitation experiments. Actin5C was used as a negative control for non-specific pull down. (D) RT-PCR showing the knockdown efficiency of dsn in dsn RNAi versus control S2 cells. Actin5C was used as a loading control. (E) RT-qPCR showing no change in the binding of DIP1 to CG32000 pre-mRNA in dsn RNAi versus control S2 cells. N = 3 biological replicates. (F) RT-qPCR showing no change in the expression of CG32000 pre-mRNA in dsn RNAi versus control S2 cells. N = 3 biological replicates. (G) RT-qPCR showing no change in the binding of DIP1 to CG32000, CG2316 and Ank pre-mRNA in dsn mutant versus control ovaries. N = 3 biological replicates.

DIP1 binds to nascent transcripts in a Dsn-independent manner.

(A) RT-qPCR showing no change in the expression of DIP1 mRNA in dsn mutant versus control ovaries. N = 3 biological replicates. (B) Confocal images showing the localization of DIP1 (green) in the control and dsn mutant nurse cell nuclei. Scale bar: 7 μm. Arrowheads point to the heterochromatin of the fourth chromosomes. (C) RT-qPCR showing enrichment of CG32000, CG2316 and ANK pre-mRNAs in three independent DIP1 immunoprecipitation experiments. Actin5C was used as a negative control for non-specific pull down. (D) RT-PCR showing the knockdown efficiency of dsn in dsn RNAi versus control S2 cells. Actin5C was used as a loading control. (E) RT-qPCR showing no change in the binding of DIP1 to CG32000 pre-mRNA in dsn RNAi versus control S2 cells. N = 3 biological replicates. (F) RT-qPCR showing no change in the expression of CG32000 pre-mRNA in dsn RNAi versus control S2 cells. N = 3 biological replicates. (G) RT-qPCR showing no change in the binding of DIP1 to CG32000, CG2316 and Ank pre-mRNA in dsn mutant versus control ovaries. N = 3 biological replicates. One possible mechanism is that Dsn could inhibit the binding of DIP1 to nascent transcripts to prevent them from being degraded. Alternatively, Dsn may regulate the activity of DIP1 on nascent transcripts. We performed RNA-immunoprecipitation (RNA-IP) using DIP1 antibody and found that DIP1 generally binds more strongly to INE-1 containing CG32000, CG2316 and ANK pre-mRNAs than to a control actin5C mRNA (Fig 3C). As a positive control, we detected an enrichment of INE-1 sisRNAs in the precipitates in S2 cells (S3 Fig). This result was surprising as it showed that nascent transcripts are already bound to DIP1 under normal conditions. We next knocked down the expression of dsn by RNAi in S2 cells (Fig 3D) and asked if it led to an increase in the binding of DIP1 to nascent transcripts. To our surprise, we did not observe any changes in the binding of DIP1 to CG32000 pre-mRNA (Fig 3E). To determine if Dsn regulates nascent transcripts in S2 cells, we examined the expression of CG32000 pre-mRNA and found no change in its expression in dsn RNAi S2 cells (Fig 3F). Therefore, Dsn appears to be dispensable for the regulation of nascent transcripts in S2 cells. We therefore repeated the DIP1 immunoprecipitation experiments using ovarian lysates where Dsn activity was needed for pre-mRNA stability. Similar to the results from S2 cells, we did not observe an increase in the binding of DIP1 to pre-mRNAs (CG32000, CG2316 and Ank) in dsn mutant ovaries when compared to wild-type controls (Fig 3G). Together, our results suggested that under normal circumstances, nascent transcripts are already bound by DIP1 independently of Dsn.

Dsn counteracts the activity of DIP1

We next considered the alternative hypothesis that Dsn may regulate the activity of DIP1 on nascent transcripts. On the FlyBase, DIP1 was found to interact with Lesswright (Lwr) via a yeast-two-hybrid screen. Drosophila lwr encodes for the Ubc9 protein, which is a Sumo conjugating enzyme responsible for sumoylation of its targets [20,21]. In Drosophila, sumoylation has been found to regulate the activities of various proteins in a dynamic manner [22]. To investigate if DIP1 is sumoylated in vivo, we immunopreciptated DIP1 in ovarian and S2 cell lysates, and performed western blotting using an antibody detecting Sumo protein. In both lysates, we detected a specific band of ~55 kDa, which is a size that is consistent with sumoylated DIP1 (DIP1: 44 kDa + Sumo: 10 kDa = 55 kDa) (Fig 4A, arrowhead), indicating that DIP1 is indeed sumoylated in vivo. Interestingly, immunostaining of ovaries revealed that Sumo and DIP1 co-localized at the satellite bodies (Fig 4B), suggesting that the activity of DIP1 at the satellite bodies may be regulated by sumoylation.
Fig 4

Dsn counteracts the activity of DIP1 via repressing DIP1 sumoylation.

(A) Western blots showing the presence of sumoylated DIP1 after immunoprecipitation of DIP1 in ovaries and S2 cells. (B) Confocal images showing the enrichment of Sumo proteins (green) at the satellite bodies, co-localizing with DIP1 (red) in wild type ovaries. DAPI (white). (C) Western blot showing the reduction of slower-migrating forms of DIP1 in lwr/CyO and smt3/CyO ovaries compared to control. Actin5C was used as a loading control. (D) Western blot showing an increase in the abundance of slower-migrating DIP1 protein in dsn mutant versus control ovaries in 3 biological replicates. Actin5C was used as a loading control. (E) Western blots showing the increase in sumoylated DIP1 (arrowhead) in dsn RNAi S2 cells. Actin was used as a loading control in the input lanes. (F) RT-qPCR showing downregulation of CG32000 pre-mRNA in vasa-Gal4>dsn RNAi versus vasa-Gal4 and no change in CG32000 pre-mRNA expression in vasa-Gal4 versus DIP1+/-; vasa-Gal4>dsn RNAi. *p < 0.05, two-tailed t test. N = 3 biological replicates. (G) RT-qPCR showing upregulation of CG32000 pre-mRNA in smt3/+;dsn/dsn versus dsn/dsn. Two-tailed t test. N = 2 biological replicates.

Dsn counteracts the activity of DIP1 via repressing DIP1 sumoylation.

(A) Western blots showing the presence of sumoylated DIP1 after immunoprecipitation of DIP1 in ovaries and S2 cells. (B) Confocal images showing the enrichment of Sumo proteins (green) at the satellite bodies, co-localizing with DIP1 (red) in wild type ovaries. DAPI (white). (C) Western blot showing the reduction of slower-migrating forms of DIP1 in lwr/CyO and smt3/CyO ovaries compared to control. Actin5C was used as a loading control. (D) Western blot showing an increase in the abundance of slower-migrating DIP1 protein in dsn mutant versus control ovaries in 3 biological replicates. Actin5C was used as a loading control. (E) Western blots showing the increase in sumoylated DIP1 (arrowhead) in dsn RNAi S2 cells. Actin was used as a loading control in the input lanes. (F) RT-qPCR showing downregulation of CG32000 pre-mRNA in vasa-Gal4>dsn RNAi versus vasa-Gal4 and no change in CG32000 pre-mRNA expression in vasa-Gal4 versus DIP1+/-; vasa-Gal4>dsn RNAi. *p < 0.05, two-tailed t test. N = 3 biological replicates. (G) RT-qPCR showing upregulation of CG32000 pre-mRNA in smt3/+;dsn/dsn versus dsn/dsn. Two-tailed t test. N = 2 biological replicates. By performing western blotting, we observed that the majority of the DIP1 protein was not sumoylated in ovaries (Fig 4C, ~44 kDa predicted size), however some DIP1 protein also appeared as slower-migrating (presumably sumoylated) forms (Fig 4C, arrowhead). The appearance of these slower-migrating DIP1 was reduced in lwr and smt3 heterozygous mutant ovaries, indicating that they represent sumoylated forms of DIP1 (Fig 4C). The non-sumoylated form of DIP1 protein was unchanged in dsn mutant ovaries (Fig 4D, arrow, ~44 kDa predicted size). In two out of three biological replicates, the abundance of the sumoylated forms of DIP1 was up-regulated in dsn mutant ovaries (Fig 4D). We believe that the extent of up-regulation of sumoylation is greater in Expt 2 and 3 than in Expt 1. In Expt 1, the upper-most band in the dsn mutant lane was stronger than that in the control lane, suggesting that DIP1 is more heavily modified in the mutants than controls. Thus, the result is still consistent with that of Expt 2 and 3. In contrast, we observed little change in sumoylated DIP1 in S2 cells after dsn RNAi (Fig 4E). This could be due to the fact that majority of the DIP1 was already sumoylated in S2 cells (Fig 4E), explaining why we did not observe any change in CG32000 pre-mRNA after Dsn knockdown (Fig 3F). Taken together, our data indicated that Dsn represses the sumoylation of DIP1 at the protein level. To confirm that the decrease in nascent transcripts in dsn mutants was indeed caused by the increase in activity of DIP1, we asked if reducing a copy of DIP1 was able to rescue the phenotype in dsn RNAi ovaries. Consistent with dsn mutant ovaries, we also observed a decrease in the expression of CG32000 pre-mRNA in vasa-Gal4>dsn RNAi ovaries (Fig 4F). As expected, reducing a copy of DIP1 was able to rescue the expression of CG32000 pre-mRNA back to wild-type levels (Fig 4F, no significant difference between vasa-Gal4 and DIP1+/-; vasa-Gal4>dsn RNAi). To further confirm if the activity of Dsn is due to increase in sumoylation of DIP1, we reduced a copy of smt3 in the dsn homozygous mutant ovaries. Indeed, the level of CG32000 pre-mRNA was rescued (Fig 4G). Thus, we concluded that Dsn regulates pre-mRNA by counteracting sumoylation of DIP1.

Discussion

SON encodes for an evolutionary conserved protein that binds to nascent transcripts and localizes to nuclear speckles [23-27]. Various functions have been assigned to SON, which includes regulation of splicing and transcription [23,24,28,29]. Besides that, SON has been implicated in various processes such as stem cell self-renewal and differentiation and cell cycle progression [16,23,25,29]. In human, mutations in SON have been linked to brain developmental defects and leukemia [28,30,31]. In this study, we uncovered a novel role for Drosophila homolog of SON (Dsn) in protecting nascent transcripts from unproductive degradation by DIP1 (Fig 5). During transcription, nascent transcripts that contain INE-1 sequences in the introns are bound by both Dsn and DIP1. Dsn inhibits the activity of DIP1, and shields the nascent transcripts from entering the decay pathway. Upon splicing, the intron is excised and Dsn would be released from the transcripts, which leads to the alleviation of the inhibition by Dsn. As a consequence, the INE-1 sisRNA is degraded by DIP1. Conceptually, Dsn acts as a ‘timer’ to ensure that nascent transcripts are fully spliced before the decay activity of DIP1 kicks in. Based on the fact that SON is highly conserved in mammals and mammalian SON had been shown to bind to nascent transcripts, we envision that this novel role of SON may be conserved.
Fig 5

Working model of Dsn and DIP1 in regulating the abundance of INE-1 containing pre-mRNA and INE-1 sisRNA in Drosophila.

“S” stands for sumoylation.

Working model of Dsn and DIP1 in regulating the abundance of INE-1 containing pre-mRNA and INE-1 sisRNA in Drosophila.

“S” stands for sumoylation. Our model is consistent with the prevailing idea that nascent transcripts are highly susceptible to decay, and cells have evolved active mechanisms to safeguard nascent transcripts [1]. One such example is the process of telescripting whereby U1 snRNA protects the nascent transcript from cryptic intronic cleavage and polyadenylation [32]. How does Dsn regulate the activity of DIP1? We suggest that Dsn regulates the activity of DIP1 via its sumolyation. In dsn mutants, there is a strong correlation between the increase in sumoylated DIP1 and increase in DIP1 activity. This observation suggests that DIP1 activity may be influenced by sumoylation. Our data suggest that sumoylation is the primary modification that is responsible for the subsequent modification of DIP1. We show that reduction of sumoylation pathway genes (lwr and smt3) led to an overall reduction of DIP1 modification (Fig 4C). Thus, without sumoylation, other forms of posttranslational modifications are also dramatically reduced. We hypothesize that the satellite body serves as a protective zone where nascent transcripts are bound and protected by Dsn. An interesting hypothesis is that Dsn limits the concentration of modified forms (including sumoylation) of DIP1 so that it is not sufficient to degrade transient nascent transcripts before splicing occurs. After splicing, the introns are released from the pre-mRNAs and the repressive effect of Dsn is alleviated. Sumoylation of DIP1 then activates its degradation activity. Sumoylation of DIP1 may influence its conformation and binding partners, thereby modulating its activity [33]. Future work will aim to address the molecular mechanism on how DIP1 activity is regulated by sumoylation. Although we did not observe any differences in binding of DIP1 to nascent transcripts between wildtype and dsn mutant ovaries, we cannot totally exclude the possibility that Dsn may regulate the binding activity of DIP1 to nascent transcripts. As DIP1 binds to and degrades nascent transcripts, we envision the regulation of DIP1 binding and decay as a dynamic and coordinated event. Thus, it is possible that the binding of DIP1 to nascent transcripts may be coupled to its decay activity. One interesting observation was that the repressive activity of Dsn on DIP1 was seen in ovaries but not in S2 cells. Knockdown of dsn in S2 cells did not lead to a dramatic increase in sumoylation of DIP1. This observation can be explained by the fact that most of the DIP1 protein is already being sumoylated in S2 cells, unlike the case in the ovaries. This difference between S2 cells and ovaries may be due to an intrinsic difference in the activity of sumoylation pathway between these two cell types, thus making the ovaries more sensitive to changes in Dsn activity. In closing, our work encourages the use of satellite body as a model for studying RNA metabolism. We envision that by identifying and characterizing more proteins/RNAs that localize to the satellite body, we can in principle learn more about the intricate regulation of RNA splicing and decay pathways.

Materials and methods

Fly strains

y w flies were used as controls unless otherwise stated. The following strains were used in this study: MTD-Gal4 [34], FLAG- Dsn (this study), CG8273 (dsn mutant) (Kyoto #201169), vasa-Gal4 (kind gift from Yukiko Yamashita), CG8273/dsn RNAi (TRiP HMS00114 Bloomington #34805), DIP1[EY02625], smt3/CyO (Bloomington #11378) and lwr/CyO (Bloomington #11410). Flies were maintained at 25°C. Before dissection, newly eclosed females were fed with wet yeast paste for 3 days at 25°C. Generation of UASp-FLAG-Dsn transgenic flies was performed as previously described [15]. PCR of dsn full-length coding sequence (CDS) was performed using primers, CACC-dsn Fw (5’CACCATGACGGAGAACACAGAGAAAGGG3’) and dsn Rv (5’CTAGCTGGGCGGAAGAATGCCTAA3’). Transgenic flies were generated by BestGene using P-element-mediated insertion.

Immunostaining

Immunostaining was performed as described previously [15]. Ovaries were fixed in 16% paraformaldehyde and Grace’s medium at a ratio of 2:1 for 10–20 min, rinsed and washed in PBX three times for 10 min each and pre-absorbed in PBX containing 5% normal goat serum for 30 min. Ovaries were incubated in primary antibodies overnight at room temperature, washed in PBX three times for 20 min each and incubated in secondary antibodies for 4 hr at room temperature. Finally, the ovaries were washed again in PBX three times for 20 min each before mounting on slides. The primary antibodies used were rabbit anti-DIP1 (1:300) [15], mouse anti-FLAG (1:500, M2 Sigma) and mouse anti-Sumo (1:500, DSHB 8A2). Images were taken with a Leica SP8 Inverted STED microscope and processed using Leica microscope software, LAS X.

Actinomycin D treatment

Actinomycin D treatment was performed as described previously [9]. Dissected ovaries were incubated in Grace’s medium containing 20 μg/ml actinomycin D with constant rocking at room temperature.

α-amanitin treatment

Dissected ovaries were incubated in Grace’s medium containing 20 μg/ml of α-amanitin with constant rocking at room temperature.

RNA extraction

Tissues were homogenized in 1.5 ml Eppendorf tubes using a plastic pestle and RNA was extracted using the TRIzol extraction protocol (Ambion) or the Direct-zol RNA miniprep kit (Zymo Research). RNA was quantified using a Nanodrop spectrophotometer to ensure equivalent loading for subsequent experiments.

RT-PCR

For standard RT-PCR, total RNA was reverse transcribed with random hexamers for 1hr using M-MLV RT (Promega). PCR was carried out using the resulting cDNA. For quantitative PCR (qPCR), SYBR Fast qPCR kit master mix (2X) ABI Prism (Kapa Biosystems, USA) was used and carried out on the Applied Biosystems 7900HT Fast Real-Time PCR system. Primers sequences for INE-1, CG32000 exon, CG2316 exon and DIP1 were reported previously [15]. For calculation of fold-change between controls and mutants/RNAi samples, changes in gene expression were normalized against actin5C as a loading control. For calculation of fold-change between DIP1 immunoprecipitations, the abundance of RNA in the immunoprecipitates was normalized against the abundance of the same transcript in the inputs. Primer sequences are CG32000 intron Fw (5’ TGGCAACAGTGTCCCAATTA3’), CG32000 exon Rv (5’ TGACGCCACCAATGTAACAC3’), CG2316 intron Fw (5’ TCTTTTATTTGGAATGCGTTTCT3’), CG2316 exon Rv (5’ ACCCATATCTATTTGCTTCTTCC3’), ANK exon Fw (5’ TGATGTGACCCCATTACACG3’), ANK exon Rv (5’ TGCATCGCAATTTCCAGATA3’), ANK exon Fw2 (5’ CGATTCCGATGACGAATCTT3’), ANK intron Rv2 (5’ GATCAATTTCGGACGTCACC3’), Myoglianin intron Fw (5’ GGCCCGATTTGGTTATAGGT3’), Myoglianin exon Rv (5’ AAAACATCGACCTTGCGATT3’), Maverick intron Fw (5’ TGCCAAACCGTATACAGAAGG3’), Maverick exon Rv (5’ AGGAAGCTCCCATGAAGTTG3’).

Western blot

Western blotting was performed as previously described [11,15]. Ovaries were dissected in Grace’s medium and homogenized in 2X sample buffer containing β-mercaptoethanol. Primary antibodies used were rabbit anti-DIP1 (1:5000) [15], mouse anti-Sumo (1:1000, DSHB 8A2) and mouse anti-Actin (1:100, DSHB JLA20). Western blot detection was done digitally using the ChemiDoc Touch Imaging System (BioRad) and under non-saturating conditions.

Immunoprecipitation

S2 cells, which were obtained from Steve Cohen’s laboratory, were grown in serum-free medium. ~200 ovaries were dissected for each immunoprecipitation experiment. Immunoprecipitation was performed as previously described [15]. Cells or ovaries were lysed in protein extraction buffer (50mM Tris-HCl pH 7.5, 150mM NaCl, 5mM MgCl2, 0.1% NP-40) supplemented with Protease Inhibitor Cocktail (Roche). Lysates were blocked using protein A/G agarose beads (Merck Millipore) before incubating in rabbit anti-DIP1 (10 μl) overnight at 4°C. As a control, no antibody was added. Protein A/G agarose beads were then added and incubated for another 2 hr. After incubation, beads were washed in protein extraction buffer three times. Protein and RNA were extracted using 2X sample buffer containing β-mercaptoethanol and Direct-zol RNA miniprep kit (Zymo Research), respectively.

siRNA-mediated knockdown

For dsRNA knockdown, experiments were performed as described previously [35]. S2 cells were treated with 15 μg of dsRNA once for four days before cells were harvested. Primers used for generating the template for in vitro transcription were reported previously [16].

FLAG-Dsn transgene produces a fully functional protein.

(A) RT-qPCR showing over-expression of dsn mRNA in MTD>FLAG-Dsn versus MTD/CyO ovaries. N = 3 technical replicates. (B) CG32000 pre-mRNA expression was rescued in the dsn mutant rescue ovaries as compared to dsn mutant. A total of 2 independent experiments were done. (TIF) Click here for additional data file.

Stability of Marverick pre-mRNA is not affected in dsn mutant ovaries.

Chart showing the levels of Marverick pre-mRNA in the ovaries of control and dsn mutant flies before and after 0.5h of α-amanitin treatment. Error bars depict SD from three biological replicates. (TIF) Click here for additional data file.

Positive control for DIP1 immunoprecipitation.

Western blot showing enrichment of DIP1 in DIP1 immunoprecipitate in S2 cells. RT-PCR depicting enrichment of INE-1 sisRNA in DIP1 immunoprecipitate. (TIF) Click here for additional data file. 15 Oct 2019 * Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. * Dear Dr Pek, Thank you very much for submitting your Research Article entitled 'SON protects nascent transcripts from unproductive degradation by counteracting DIP1' to PLOS Genetics. Your manuscript was fully evaluated at the editorial level and by three independent peer reviewers. The reviewers appreciated the attention to an important topic but identified some aspects of the manuscript that should be improved. We therefore ask you to modify the manuscript according to the review recommendations before we can consider your manuscript for acceptance. Your revisions should address the specific points made by each reviewer. In addition we ask that you: 1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. 2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images. We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org. If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist. While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission. PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process. To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder. [LINK] Please let us know if you have any questions while making these revisions. Yours sincerely, Gregory P. Copenhaver Editor-in-Chief PLOS Genetics Gregory Barsh Editor-in-Chief PLOS Genetics Reviewer's Responses to Questions Comments to the Authors: Please note here if the review is uploaded as an attachment. Reviewer #1: My remaining concerns have been satisfactorily addressed in this second revision. I agree with the authors that removal of the data with the Dsn antibody (Figure S2, with which I had questions about validity) does not affect the main conclusions of the paper. Reviewer #2: Here are what would be my major highlights of this work : - In drosophila ovaries, Dsn localizes to the satellite body where active decay of INE-1-containing introns by DIP1 occurs after splicing. - Dsn is a negative regulator of DIP1 activity via inhibition of sumoylation and, likely, of subsequent post-translational DIP1 modifications. - This Dsn-mediated DIP1 inhibition protects the spliced introns less efficiently than the corresponding pre-mRNAs. I think these data warrant a paper in PLOS Genetics but I would like to warn the reader against some overstatements found in the Abstract and working model (Figure 5): - I am not convinced that “nascent transcripts are already bound by DIP1 independently of Dsn” (page 9 bottom of first paragraph) - There is no evidence either that, page 11 :” Upon splicing, (…) Dsn would be released from the transcripts, “ A possible alternative version of the Abstract would be : Gene expression involves the transcription and splicing of nascent transcripts through the removal of introns. In Drosophila, a double-stranded RNA binding protein Discointeracting protein 1 (DIP1) targets INE-1 stable intronic sequence RNAs (sisRNAs) for degradation after splicing. How nascent transcripts that also contain INE-1 sequences escape degradation remains unknown. Here we observe that these nascent transcripts can also be bound by DIP1 but the Drosophila homolog of SON (Dsn) protects them from unproductive degradation in ovaries. Dsn localizes to the satellite body where active decay of INE-1 sisRNAs by DIP1 occurs. Moreover, the pre-mRNA destabilization caused by Dsn depletion is rescued in a DIP1 heterozygous mutant, suggesting that Dsn is a negative regulator of DIP1. In fact, Dsn is a repressor of DIP1 posttranslational modifications (primarily sumoylation) that are assumed to be required for efficient DIP1 activity. This Dsn-mediated reduction of DIP1 posttranslational modifications is not sufficient to totally abolish DIP1-mediated sisRNAs decay. Minor comments: - Figure 2F: Dsn should also point positively toward INE-1 introns (using a broken arrow ?) to emphasize the fact that the amount of INE-1 is also somewhat reduced in the absence of Dsn (see Figure 2B) - Since Figure 1D was removed, Figure 3D should be removed too. - I could not find how Dsn RNAi was performed in ovaries (Figure 3) Reviewer #3: This manuscript describes a process by which pre-mRNAs carrying introns that are potential targets for degradation are protected until splicing has occurred. The authors primarily focus on the Drosophila ovary, where they have previously implicated the proteins DIP1 and Dsn (the Drosophila homolog of SON) as regulators of gene expression. They report that a FLAG-tagged version of Dsn localizes to the satellite body (a nuclear body where DIP1 also localizes), and a loss of function mutation in Dsn results in loss of RNA that carries INE-1 elements, which is opposite to the phenotype of loss of function mutations in DIP1, and suggests a protective role for wild type Dsn. They hypothesize that the two proteins act in opposition via Dsn regulation of the RNA-binding DIP1. RNA-IP experiments with a DIP1 antibody support that DIP1 binds to INE-1 RNAs more strongly than to other RNAs, and, in Dsn mutants, DIP1 binding to INE-1 pre-RNAs is unchanged relative to wild type, suggesting that Dsn may regulate DIP1 activity rather than RNA-binding. The authors use western blot analysis to support that DIP1 is sumoylated, likely by Lwr since modified DIP1 is decreased in oocytes heterozygous for an allele of lwr, and that SUMOylation of DIP1 increases in a Dsn mutant background. This leads to a model wherein DIP1 bound to pre-mRNAs carrying INE-1 sequences is held inactive by a SUMOylation-inhibiting activity of Dsn; after splicing, Dsn would no longer inhibit SUMOylation, which would lead to activitation of DIP1 activity and subsequent degradation of INE-1 introns. The overall story is a very interesting example of RNA biology - how nascent transcripts can be protected when spliced introns are targeted for degradation is likely to be of broad interest to the readership of PLoS Genetics, and the paper addresses some specific mechanistic insights. I am overall positive on the paper and commend the authors on pursuing this interesting biology, and I recognize that the authors have already been through peer review at another journal. However, I believe that several aspects of the manuscript should be addressed before publication. My specific comments follow. Comments that may require additional evidence/analysis: 1. for the super-resolution deconvolution microscopy, it would be helpful to state the specific type of microscopy in the main text (I believe it is STED). In addition, the analysis of overlap performed in the figure is not described in the main text or methods - are these single optical slices? Were they chosen for any specific reason, or are the “representative”? In addition, some summary of the percent overlap of the two signals overall would be helpful in addition to the examples shown. Finally, I am unclear on the authors’ conclusions from this experiment - they refer to DIP1 and FLAG-Dsn as forming an “intermingling network” - what does this phrase mean? 2. in Figure 3C, please use statistical tests to compare binding of DIP1 to INE-1 RNAs relative to the Act5C control RNA. (It is surprising that statistics are used in most other comparisions in the paper, but not here.) 3. the qRT-PCR experiments in figure 2b and c are well controlled with analyses of genes that do not harbor INE-1 elements. The experiments in figure 2d and e are not controlled - the same analysis (at least one) should be done with a gene that does not harbor an INE-1 element (e.g. Myoglianin or Maverick) to show that it the effect is specific to the proposed mechanism. 4. The authors state that their western exposures are non-saturating, but the 44kDa DIP1 bands in Figure 4d do appear saturated, making comparisons between lanes challenging. Since Figure 4f represents the only experiment tying dsn to their proposed model of DIP1 regulation by SUMOylation, ideally these data would be better presented and more convincing, particularly since at least one trial shows no clear evidence of a change. Similarly, ideally these data would be quantified and compared statistically. 5. the final experiment in figure 4f confirms that a loss of a copy of DIP1 suppresses the dsn mutant phenotype on CG32000 pre-mRNA levels (importantly, it also provides a second dsn mutant genetic background to confirm that the phenotype is not specific to the one allele used thus far - the authors may wish to highlight this, as it strengthens their evidence). While this is an important and interesting result, it does not speak to the proposed model of DIP1 regulation by SUMOylation - i.e. there is no evidence that a change in DIP1 SUMOylation regulates its activity. This, to me, is a key experiment to tie the SUMOylation data to the rest of the manuscript. Could the authors, for example, examine INE-1 pre-RNAs in the lwr background where DIP1 sumoylation is significantly reduced? It seems that all of the necessary reagents and techniques are in place for this experiment, and there is a clear prediction. Genetic evidence for regulation via DIP1 SUMOylation would solidify their proposed model; in the absence of this evidence, the data are largely circumstantial. Comments that can be addressed via changes to the text: 1. the authors state that in their dsn mutants, there is a decrease in INE-1 sisRNAs and mRNAs from genes harboring INE-1 (figures 2b-c). This is based on assessment of three genes, CG32000, CG2316, and ANK. Exonic qRT-PCR shows that ANK levels are not reduced, even though pre-mRNAs for this gene are reduced. The authors should be clear that 2 of 3 genes follow the pattern they describe, and comment on why this might be the case. 2. for Figure 4a, please describe what the “Control IP” is (e.g. in the methods or legend). 3. the localization of the satellite body to the region of the 4th chromosome is based on DAPI staining only, where a high density of localized staining is presumed to represent the 4th. Since the chromosome is not specifically identified (e.g. through DNA-FISH or POF staining), it seems that wording like “the presumed 4th” would be more appropriate. 4. I am confused by the presentation of data from S2 cells. The authors first report “an enrichment of INE-1 sisRNAs in the precipitates in S2 cells”, which is presented as a positive control of RNA-IP experiment in oocytes. It is unclear to me how S2 cells are a positive control in this experiment (I presume “precipitates” refers to RNA-IP with DIP1 antibody.) They then report the a Dsn knockdown in S2 cells does not change DIP1 binding to CG32000, nor is there a change in CG32000 pre-mRNA in S2 cells - whereas there was a change in oocytes. Finally, they show no change in DIP1 sumoylation in dsn knockdown cells. It is unclear how the negative data from S2 cells help to explain the relationship between Dsn and DIP1, except that perhaps the relationship is specific to the ovary. Is that the point? If so, perhaps the relevance of this could be commented on in the Discussion. 5. While the experiments and phenomenology are quite interesting, I confess that I found this paper very challenging to read and understand. I see from prior reviews that a previous reviewer made similar comments and suggestions for improving the manuscript, which the authors opted not to do. Here are specifics that I hope the authors can improve upon: -it is confusing that the authors are inconsistent in whether they use SON or Dsn - the title uses SON, but most of the Results refer to Dsn, but then the authors revert to SON again in the Discussion. It would be helpful to stick with one name after telling us about both names. -the introduction is very short, and I did not understand the background information until I had read the whole manuscript. It would be helpful to better explain the background information in the Introduction. Specifically, what it INE-1? and, explain sisRNAs - they are “stable”, but they are degraded? Does the term refer to the pre-mRNAs, the spliced introns, or both, or something else? I don’t understand the name. And, how are satellite bodies “microscopically visible”? by staining? (for what?) or by some other means? Also, it becomes evident later that satellite bodies localize to the 4th chromosome region, it would be helpful to know this in the introduction. -I do not understand the statement “nascent transcripts are already susceptible to degradation by binding to DIP1” in the Introduction. I wonder whether this simply means “nascent transcripts are bound to DIP1”, or is there more to this? -the results begin with reference to the gene rga - what is this gene, and how is it relevant to the present study? (is it a sisRNA? a satellite body component? Is it perhaps not relevant?) -in describing the localization of FLAG-Dsn, I appreciate the honesty of the authors, but I believe they do themselves a disservice by explaining that the localization of an overexpressed protein may not reflect the endogenous localization before the actual localization is even discussed. I understand that this was added in response to a previous reviewer, but as written, it undermines the confidence of the reader - if the authors do not believe that the FLAG-Dsn localization is valid, the data should not be in the paper. If they do think it is valid, the language of the paragraph should reflect why they are confident that it is so, even with a potential caveat. -in the Discussion, the authors state that nascent transcripts are bound by Dsn. I do not see the evidence for this in the current manuscript, a citation for this result should therefore be provided (or please correct my error if the data are in fact included). ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No Reviewer #3: No 20 Oct 2019 Submitted filename: Response to reviewers.docx Click here for additional data file. 28 Oct 2019 Dear Dr Pek, We are pleased to inform you that your manuscript entitled "SON protects nascent transcripts from unproductive degradation by counteracting DIP1" has been editorially accepted for publication in PLOS Genetics. Congratulations! Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional accept, but your manuscript will not be scheduled for publication until the required changes have been made. Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org. In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. If you have a press-related query, or would like to know about one way to make your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics! Yours sincerely, Gregory P. Copenhaver Editor-in-Chief PLOS Genetics Gregory Barsh Editor-in-Chief PLOS Genetics www.plosgenetics.org Twitter: @PLOSGenetics ---------------------------------------------------- Comments from the reviewers (if applicable): Reviewer's Responses to Questions Comments to the Authors: Please note here if the review is uploaded as an attachment. Reviewer #3: The authors have addressed my primary concerns. Note that, for one experiment that they added in response to one of my comments (Fig 4g), a difference was noted with a p value of 0.06. Some may take issue with this result as "not significant". However, I don't believe that a p value of 0.05 has any magical properties, though it is often used as a standard to determine whether a biological effect is "real". It is likely that a third replicate of this experiment would provide more statistical power to reach the common 0.05 threshold, and in a perfect world these authors would perform this experiment. But, I am fine with the current practice of the authors - i.e. simply report the magnitude of the difference and the associated p value for the two replicates that they performed. ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #3: Yes ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #3: No ---------------------------------------------------- Data Deposition If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website. The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly: http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-19-01345R1 More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support. Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present. ---------------------------------------------------- Press Queries If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org. 6 Nov 2019 PGENETICS-D-19-01345R1 SON protects nascent transcripts from unproductive degradation by counteracting DIP1 Dear Dr Pek, We are pleased to inform you that your manuscript entitled "SON protects nascent transcripts from unproductive degradation by counteracting DIP1" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work! With kind regards, Matt Lyles PLOS Genetics On behalf of: The PLOS Genetics Team Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom plosgenetics@plos.org | +44 (0) 1223-442823 plosgenetics.org | Twitter: @PLOSGenetics
  35 in total

1.  Maternally Inherited Stable Intronic Sequence RNA Triggers a Self-Reinforcing Feedback Loop during Development.

Authors:  Mandy Li-Ian Tay; Jun Wei Pek
Journal:  Curr Biol       Date:  2017-03-23       Impact factor: 10.834

Review 2.  Stable Intronic Sequence RNAs (sisRNAs): An Expanding Universe.

Authors:  Seow Neng Chan; Jun Wei Pek
Journal:  Trends Biochem Sci       Date:  2018-10-31       Impact factor: 13.807

Review 3.  The role of SON in splicing, development, and disease.

Authors:  Xinyi Lu; Huck-Hui Ng; Paula A Bubulya
Journal:  Wiley Interdiscip Rev RNA       Date:  2014-04-30       Impact factor: 9.957

4.  The Ovhts polyprotein is cleaved to produce fusome and ring canal proteins required for Drosophila oogenesis.

Authors:  Lisa N Petrella; Tracy Smith-Leiker; Lynn Cooley
Journal:  Development       Date:  2007-01-10       Impact factor: 6.868

Review 5.  Stable Intronic Sequence RNAs Engage in Feedback Loops.

Authors:  Jun Wei Pek
Journal:  Trends Genet       Date:  2018-01-31       Impact factor: 11.639

6.  De Novo Mutations in SON Disrupt RNA Splicing of Genes Essential for Brain Development and Metabolism, Causing an Intellectual-Disability Syndrome.

Authors:  Jung-Hyun Kim; Deepali N Shinde; Margot R F Reijnders; Natalie S Hauser; Rebecca L Belmonte; Gregory R Wilson; Daniëlle G M Bosch; Paula A Bubulya; Vandana Shashi; Slavé Petrovski; Joshua K Stone; Eun Young Park; Joris A Veltman; Margje Sinnema; Connie T R M Stumpel; Jos M Draaisma; Joost Nicolai; Helger G Yntema; Kristin Lindstrom; Bert B A de Vries; Tamison Jewett; Stephanie L Santoro; Julie Vogt; Kristine K Bachman; Andrea H Seeley; Alyson Krokosky; Clesson Turner; Luis Rohena; Maja Hempel; Fanny Kortüm; Davor Lessel; Axel Neu; Tim M Strom; Dagmar Wieczorek; Nuria Bramswig; Franco A Laccone; Jana Behunova; Helga Rehder; Christopher T Gordon; Marlène Rio; Serge Romana; Sha Tang; Dima El-Khechen; Megan T Cho; Kirsty McWalter; Ganka Douglas; Berivan Baskin; Amber Begtrup; Tara Funari; Kelly Schoch; Alexander P A Stegmann; Servi J C Stevens; Dong-Er Zhang; David Traver; Xu Yao; Daniel G MacArthur; Han G Brunner; Grazia M Mancini; Richard M Myers; Laurie B Owen; Ssang-Taek Lim; David L Stachura; Lisenka E L M Vissers; Eun-Young Erin Ahn
Journal:  Am J Hum Genet       Date:  2016-08-18       Impact factor: 11.025

7.  A complex containing the CCR4 and CAF1 proteins is involved in mRNA deadenylation in Drosophila.

Authors:  Claudia Temme; Sophie Zaessinger; Sylke Meyer; Martine Simonelig; Elmar Wahle
Journal:  EMBO J       Date:  2004-06-24       Impact factor: 11.598

8.  Abundant and species-specific DINE-1 transposable elements in 12 Drosophila genomes.

Authors:  Hsiao-Pei Yang; Daniel A Barbash
Journal:  Genome Biol       Date:  2008-02-21       Impact factor: 13.583

9.  DIP1 modulates stem cell homeostasis in Drosophila through regulation of sisR-1.

Authors:  Jing Ting Wong; Farzanah Akhbar; Amanda Yunn Ee Ng; Mandy Li-Ian Tay; Gladys Jing En Loi; Jun Wei Pek
Journal:  Nat Commun       Date:  2017-10-02       Impact factor: 14.919

10.  A sisRNA/miRNA Axis Prevents Loss of Germline Stem Cells during Starvation in Drosophila.

Authors:  Ismail Osman; Jun Wei Pek
Journal:  Stem Cell Reports       Date:  2018-06-28       Impact factor: 7.765

View more
  1 in total

1.  Maternal starvation primes progeny response to nutritional stress.

Authors:  Kelly Voo; Jeralyn Wen Hui Ching; Joseph Wee Hao Lim; Seow Neng Chan; Amanda Yunn Ee Ng; Jasmine Yi Ying Heng; Shiao See Lim; Jun Wei Pek
Journal:  PLoS Genet       Date:  2021-11-29       Impact factor: 5.917

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.