Literature DB >> 31699981

ESCRT-III-driven piecemeal micro-ER-phagy remodels the ER during recovery from ER stress.

Marisa Loi1,2, Andrea Raimondi3, Diego Morone1, Maurizio Molinari4,5.   

Abstract

The endoplasmic reticulum (ER) produces about 40% of the nucleated cell's proteome. ER size and content in molecular chaperones increase upon physiologic and pathologic stresses on activation of unfolded protein responses (UPR). On stress resolution, the mammalian ER is remodeled to pre-stress, physiologic size and function on activation of the LC3-binding activity of the translocon component SEC62. This elicits recov-ER-phagy, i.e., the delivery of the excess ER generated during the phase of stress to endolysosomes (EL) for clearance. Here, ultrastructural and genetic analyses reveal that recov-ER-phagy entails the LC3 lipidation machinery and proceeds via piecemeal micro-ER-phagy, where RAB7/LAMP1-positive EL directly engulf excess ER in processes that rely on the Endosomal Sorting Complex Required for Transport (ESCRT)-III component CHMP4B and the accessory AAA+ ATPase VPS4A. Thus, ESCRT-III-driven micro-ER-phagy emerges as a key catabolic pathway activated to remodel the mammalian ER on recovery from ER stress.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31699981      PMCID: PMC6838186          DOI: 10.1038/s41467-019-12991-z

Source DB:  PubMed          Journal:  Nat Commun        ISSN: 2041-1723            Impact factor:   14.919


Introduction

The endoplasmic reticulum (ER) is the site of protein, lipid, and oligosaccharide synthesis, calcium storage, and drugs detoxification. Its size (and functions) is maintained at steady state and is adapted to environmental and developmental conditions by a homeostatic equation that comprises the anabolic transcriptional and translational programs of the unfolded protein response (UPR) and the catabolic programs relying on receptor-mediated, lysosomal clearance of select ER subdomains. The UPR increases the size of the ER and its content in resident proteins[1,2]. In contrast, the lysosomal-regulated ER turnover maintains ER size at steady state, prevents excessive ER expansion during ER stress, and, as we recently discovered, regulates ER return at physiologic size during recovery from ER stresses[3,4]. Selective clearance of the ER by endolysosomes (ELs) has originally been observed, in the mid-1960s, during butterfly pupation[5] and remained confined to morphological analyses for over 50 years. It is only with the discovery that lysosomal turnover of the ER is controlled by dedicated ER-resident proteins (FAM134B[6], SEC62[7], RTN3[8], ATL3[9], CCPG1[10], TEX264[11,12] in mammalian cells, Atg39 and Atg40 in yeast[13]) that the studies entered a phase of mechanistic dissection (reviewed in refs. [4,14-18]). All these proteins engage components of the autophagic machinery via their cytosolic domains, which display FIP200-[10] and/or LC3-[6-8,10-12] and/or GABARAP-interacting[9] regions in mammals, and Atg11- and/or Atg8-interacting motifs in yeast[13]. Nutrient deprivation indiscriminately enhances several autophagic pathways to rapidly mobilize amino acids and other cellular building blocks and it has extensively been used to activate and investigate the mechanisms of receptor-mediated ER clearance by mammalian and yeast macro-ER-phagy pathways[6,8-13]. Starvation-induced mammalian macro-ER-phagy relies on engulfment of ER subdomains decorated with FAM134B[6], RTN3[8], ATL3[9], CCPG1[10], and TEX264[11,12] by double-membrane autophagosomes. These eventually fuse with EL for cargo clearance. However, ER-centric signals do exist that trigger clearance of select ER subdomains on activation of individual receptors as reported for CCPG1-mediated control of ER expansion during ER stress[10], for SEC62-controlled reduction of the ER volume to physiologic state after conclusions of acute ER stresses[7], and for ER-to-lysosome-associated degradation (ERLAD) pathways activated to deliver proteasome-resistant misfolded proteins from the ER to EL for destruction[19-21] (and reviewed in refs. [15,17]). Mechanistic dissection of all these pathways is in its infancy and characterization of signal-specific (ER-centric) activation of individual LC3 receptors at the ER membrane awaits further studies and is assessed here in the case of SEC62-regulated recov-ER-phagy. SEC62 is an essential component of the SEC61 protein translocation machinery, where it acts in a functional complex with SEC63 to promote the post-translational entrance of newly synthesized polypeptides in the ER[22,23]. Notably, the function of SEC62 in selective delivery of ER subdomains to EL for clearance is not activated by nutrient deprivation[12], nor at steady state or during ER stress[7]. Our studies revealed that SEC62 controls delivery of excess ER to RAB7/LAMP1-positive EL for clearance during the recovery phase that follows the conclusion of acute ER stresses. In our experiments, acute ER stresses were triggered on transient perturbation of calcium or redox homeostasis to mimic original observation in liver cells showing lysosomal removal of excess ER after cessation of treatments with antiepileptic drugs such as phenobarbital[24,25] (please refer to the detailed description of the protocols for reversible and non-toxic induction of ER stress in ref. [7] and in the Methods section). SEC62-controlled ER turnover during recovery from ER stress, recov-ER-phagy, can also be induced on SEC62 overexpression or on silencing of SEC63, which participates in SEC62-containing heterodimers[7,26]. Here we report that in contrast to starvation-induced, receptor-mediated ER-clearance[6,8-13], SEC62-driven ER turnover, which is activated in response to an ER-centric signal, that is, the conclusion of an acute ER stress, does not rely on engagement of the macro-autophagy pathway. Rather, resolution of ER stress activates catabolic processes where RAB7/LAMP1-positive EL directly engulf excess ER subdomains via ESCRT-III-mediated piecemeal micro-ER-phagy.

Results

ER subdomains delivery within EL on ER stress resolution

To characterize the mechanisms of mammalian ER remodeling that re-establish physiologic (pre-stress) condition on resolution of ER stresses, we made use of a previously established protocol for acute induction of ER stress on transient exposure of mouse embryonic fibroblasts (MEFs) to cyclopiazonic acid (CPA)[7], a reversible inhibitor of the sarco/ER calcium ATPase[27]. Western blot analyses show that the level of ER stress marker proteins increases in wild-type (WT) MEFs exposed to CPA (Fig. 1a, lane 1 vs. 2, upper and middle panels for BiP and HERP, respectively) and decreases after interruption of the pharmacologic treatment (lane 3)[7]. For ERAD factors like HERP, return at the pre-stress level relies on the activity of cytosolic proteasomes and other ERAD tuning mechanisms[7,28-30]. For conventional ER-resident chaperones and members of the protein disulfide isomerase superfamily, it relies on SEC62-controlled delivery of excess ER within EL for clearance in catabolic processes collectively defined as recov-ER-phagy[7]. Inactivation of lysosomal hydrolases with bafilomycin A1 (BafA1) delays return of these ER-resident chaperones to the pre-stress level[7] and causes their accumulation within EL displaying RAB7 and LAMP1 at the limiting membrane[7] (Fig. 1b, o, Supplementary Fig. 1a). Recov-ER-phagy is faithfully recapitulated on SEC62 overexpression (Supplementary Fig. 1b) and on release of orphan endogenous SEC62 upon silencing of SEC63 expression[7].
Fig. 1

Delivery of endogenous SEC62-labeled EV within EL during recovery from ER stress. a Upper panel, WB analysis showing steady-state level of BiP in WT MEF (Mock), BiP induction on cell exposure to CPA (ER stress, lane 2), and return of BiP to the pre-stress level after CPA wash-out (Recovery, lane 3); middle panel, same for HERP; lower panel, GAPDH as a loading control. Quantification of BiP levels in WB, n = 3 independent experiments, mean ± SEM, unpaired, two-tailed t test, *P = 0.0037. b Delivery of SEC62-decorated EV within LAMP1-positive EL in WT MEF during 12 h recovery from an ER stress in the presence of 50 nM BafA1. c Same as a in Atg4BKO MEF; n = 3 independent experiments, mean ± SEM, unpaired, two-tailed t test, P = 0.4001. d Same as b in Atg4BKO MEF. e Same as a in Atg7KO MEF, n = 3 independent experiments, mean ± SEM; unpaired, two-tailed t test, P = 0.3159. f Same as b in Atg7KO MEF. g Same as a in Atg16L1KO MEF; n = 4 independent experiments, mean ± SEM; unpaired, two-tailed t test, P = 0.6909. h Same as b in Atg16L1KO MEF. i Same as a in Ulk1/2 double-KO MEF; n = 3 independent experiments, mean ± SEM; unpaired, two-tailed t test, **P = 0.0083. j Same as b in Ulk1/2 double-KO MEF. k Same as a in Atg13KO MEF; n = 3 independent experiments, mean ± SEM; unpaired, two-tailed t test, *P = 0.0232. l Same as b in Atg13KO MEF. m Same as a in Atg14KO MEF; n = 3 independent experiments, mean ± SEM; unpaired, two-tailed t test, *P = 0.0497. n Same as b in Atg14KO MEF. See Supplementary Fig. 1 for recov-ER-phagy recapitulated on overexpression of SEC62-HA. o Quantification of SEC62-positive EV delivery within LAMP1-positive EL (n = 10, 11, 10, 10, 9, 10, 11 cells, respectively). One-way analysis of variance (ANOVA) and Dunnett’s multiple comparisons test, n.s.P > 0.05, ****P < 0.0001. Molecular weight markers in WB are in kDa. Scale bars for CLSM: 10 μm. WB and IF panels are representative of at least three independent experiments

Delivery of endogenous SEC62-labeled EV within EL during recovery from ER stress. a Upper panel, WB analysis showing steady-state level of BiP in WT MEF (Mock), BiP induction on cell exposure to CPA (ER stress, lane 2), and return of BiP to the pre-stress level after CPA wash-out (Recovery, lane 3); middle panel, same for HERP; lower panel, GAPDH as a loading control. Quantification of BiP levels in WB, n = 3 independent experiments, mean ± SEM, unpaired, two-tailed t test, *P = 0.0037. b Delivery of SEC62-decorated EV within LAMP1-positive EL in WT MEF during 12 h recovery from an ER stress in the presence of 50 nM BafA1. c Same as a in Atg4BKO MEF; n = 3 independent experiments, mean ± SEM, unpaired, two-tailed t test, P = 0.4001. d Same as b in Atg4BKO MEF. e Same as a in Atg7KO MEF, n = 3 independent experiments, mean ± SEM; unpaired, two-tailed t test, P = 0.3159. f Same as b in Atg7KO MEF. g Same as a in Atg16L1KO MEF; n = 4 independent experiments, mean ± SEM; unpaired, two-tailed t test, P = 0.6909. h Same as b in Atg16L1KO MEF. i Same as a in Ulk1/2 double-KO MEF; n = 3 independent experiments, mean ± SEM; unpaired, two-tailed t test, **P = 0.0083. j Same as b in Ulk1/2 double-KO MEF. k Same as a in Atg13KO MEF; n = 3 independent experiments, mean ± SEM; unpaired, two-tailed t test, *P = 0.0232. l Same as b in Atg13KO MEF. m Same as a in Atg14KO MEF; n = 3 independent experiments, mean ± SEM; unpaired, two-tailed t test, *P = 0.0497. n Same as b in Atg14KO MEF. See Supplementary Fig. 1 for recov-ER-phagy recapitulated on overexpression of SEC62-HA. o Quantification of SEC62-positive EV delivery within LAMP1-positive EL (n = 10, 11, 10, 10, 9, 10, 11 cells, respectively). One-way analysis of variance (ANOVA) and Dunnett’s multiple comparisons test, n.s.P > 0.05, ****P < 0.0001. Molecular weight markers in WB are in kDa. Scale bars for CLSM: 10 μm. WB and IF panels are representative of at least three independent experiments

LC3 lipidation in resolution of ER stress

LC3 lipidation is required for FAM134B-, RTN3-, CCPG1-, ATL3-, and TEX264-dependent macro-ER-phagy[3,6,8-12,14,18]. Not surprisingly, individual ablation of Atg4B, Atg7, or Atg16L1, three components of the LC3 lipidation machinery (Supplementary Fig. 2)[31], inhibits return of ER stress-induced marker proteins to the pre-stress level (BiP in Fig. 1c, e, g, upper panels, lanes 2 vs. 3). Return of HERP at the pre-stress level, which relies on cytosolic proteasomes[7,28], remains unaffected (Fig. 1c, e, g, middle panels). Consistently, ablation of LC3 lipidation abolishes delivery of ER subdomains within EL during recovery from ER stress (Fig. 1d, f, h, o) and when recov-ER-phagy is recapitulated by overexpression of HA-tagged SEC62 (Supplementary Fig. 1d).

Autophagosome dispensability to resolve ER stress

To corroborate the notion that SEC62-driven clearance of excess ER on UPR resolution occurs via macro-ER-phagy, we verified the involvement of the autophagosome biogenesis machinery in recov-ER-phagy. Surprisingly, individual ablation of Ulk1, Ulk2, Atg13, and Atg14, which are dispensable for LC3 lipidation (Supplementary Fig. 2) but are required for biogenesis of double-membrane autophagosomes[31-34], does not prevent return of BiP to pre-stress level on ER stress resolution (Fig. 1i, k, m, upper panels, lanes 1 vs. 3). Consistently, inactivation of autophagosome biogenesis does not affect delivery of excess ER within EL during recovery from stress (Fig. 1j, l, n, o) and when recov-ER-phagy is recapitulated by SEC62 overexpression (Supplementary Fig. 1e–g).

SNAREs dispensability to resolve ER stress

To investigate lysosomal delivery of ER subdomains with ultrastructural resolution, we turned to immuno electron microscopy (IEM) and invariably found that ER-derived vesicles (EVs) displaying SEC62 at their limiting membrane (red arrows, Fig. 2a, b) are sequestered by a SEC62-negative membrane (blue arrows, Fig. 2a, b), within the EL (green arrows, Fig. 2a, b). This topology is consistent with macro-ER-phagy, where ER subdomains are captured by double-membrane autophagosomes that eventually fuse with EL to clear their cargo (Fig. 2c), or with micro-ER-phagy, where ER subdomains are directly engulfed by EL (Fig. 2d). A major difference between macro- and micro-autophagy is the requirement for the former of an heterotypic membrane fusion event (arrow 2, Fig. 2c, fusion vs. Fig. 2d, engulfment), which is substantially impaired on ablation of the SNARE proteins STX17 and VAMP8[35,36]. Ablation of STX17 (Fig. 3a, d, f) or of VAMP8 (Fig. 3b, e, f) does not affect delivery of excess ER within EL and does not delay return of chaperones at their pre-stress level during recovery from ER stress (Fig. 3g, h). In agreement with our genetic analyses showing dispensability of autophagosomes and macro-ER-phagy (Figs. 1i–o, 3a–h), IEM analyses do not reveal SEC62-labeled ER fragments within double-membrane autophagosomes when cells are recovering from ER stress. Rather, they show EL caught in the act of capturing SEC62-positive EV by inward invagination of their membranes (Fig. 4a–d and Supplementary Movie 1). Thus, recov-ER-phagy is topologically equivalent to micro-autophagy, a poorly characterized type of autophagy involved in clearance of organelles including large ER whorls in yeast[37-40].
Fig. 2

Distribution of gold-labeled, endogenous SEC62 by IEM. a WT MEFs are exposed 12 h to 10 μM CPA. Recovery is initiated on CPA wash-out and progresses for 12 h in the presence of 50 nM BafA1 to inhibit clearance of EV delivered within EL. b Inset of a. IEM images are representative of two independent experiments with similar results. c Macro-ER-phagy pathway. d Micro-ER-phagy pathway. EV, ER-derived vesicle; EL, endolysosome; LIR, LC3-interacting region. Color code of arrows is given in the panels. Scale bar for IEM: 1 μm

Fig. 3

SNAREs dispensability for delivery of endogenous SEC62-labeled EV within EL. a WB analysis showing the efficiency of STX17 knockout in CRISPR17 MEF (please also refer to ref. [19]). b Same as a for VAMP8 in CRISPR8 MEF (please also refer to ref. [19]). c Delivery of endogenous SEC62-labeled EV within LAMP1-positive EL during recovery from CPA-induced ER stress in WT MEF exposed to 50 nM BafA1 for 12 h. d Same as c in MEF lacking STX17. e Same as c in MEF lacking VAMP8. Scale bars: 10 μm. f Quantification of EV delivery within EL in c–e (n = 15, 12, 10 cells, respectively). One-way ANOVA and Dunnett’s multiple comparisons test, n.s.P > 0.05. IF panels are representative of three independent experiments. g Same as Fig. 1a in cells lacking STX17, n = 4 independent experiments, mean ± SEM, unpaired, two-tailed t test, **P = 0.0083. h Same as Fig. 1a in cells lacking VAMP8; n = 3 independent experiments, mean ± SEM, unpaired, two-tailed t test, **P = 0.0043. Molecular weight markers in WB are in kDa

Fig. 4

Engulfment of endogenous SEC62-labeled EV by EL. a WT MEF after 12 h recovery from an ER stress in the presence of 50 nM BafA1. IF panel is representative of >10 independent experiments. b Inset from a. c Single slice of an electron tomogram showing the distribution of gold-labeled endogenous SEC62 during recovery from ER stress. IEM image is representative of two independent experiments with similar results. Color code of arrows in b, c as in Fig. 2a–d. d 3D visualization by electron tomography of EL containing EV that display gold-labeled, endogenous SEC62 at the limiting membrane. See also Supplementary Movie 1. Scale bar for CLSM: 10 μm; scale bar for IEM: 200 nm

Distribution of gold-labeled, endogenous SEC62 by IEM. a WT MEFs are exposed 12 h to 10 μM CPA. Recovery is initiated on CPA wash-out and progresses for 12 h in the presence of 50 nM BafA1 to inhibit clearance of EV delivered within EL. b Inset of a. IEM images are representative of two independent experiments with similar results. c Macro-ER-phagy pathway. d Micro-ER-phagy pathway. EV, ER-derived vesicle; EL, endolysosome; LIR, LC3-interacting region. Color code of arrows is given in the panels. Scale bar for IEM: 1 μm SNAREs dispensability for delivery of endogenous SEC62-labeled EV within EL. a WB analysis showing the efficiency of STX17 knockout in CRISPR17 MEF (please also refer to ref. [19]). b Same as a for VAMP8 in CRISPR8 MEF (please also refer to ref. [19]). c Delivery of endogenous SEC62-labeled EV within LAMP1-positive EL during recovery from CPA-induced ER stress in WT MEF exposed to 50 nM BafA1 for 12 h. d Same as c in MEF lacking STX17. e Same as c in MEF lacking VAMP8. Scale bars: 10 μm. f Quantification of EV delivery within EL in c–e (n = 15, 12, 10 cells, respectively). One-way ANOVA and Dunnett’s multiple comparisons test, n.s.P > 0.05. IF panels are representative of three independent experiments. g Same as Fig. 1a in cells lacking STX17, n = 4 independent experiments, mean ± SEM, unpaired, two-tailed t test, **P = 0.0083. h Same as Fig. 1a in cells lacking VAMP8; n = 3 independent experiments, mean ± SEM, unpaired, two-tailed t test, **P = 0.0043. Molecular weight markers in WB are in kDa Engulfment of endogenous SEC62-labeled EV by EL. a WT MEF after 12 h recovery from an ER stress in the presence of 50 nM BafA1. IF panel is representative of >10 independent experiments. b Inset from a. c Single slice of an electron tomogram showing the distribution of gold-labeled endogenous SEC62 during recovery from ER stress. IEM image is representative of two independent experiments with similar results. Color code of arrows in b, c as in Fig. 2a–d. d 3D visualization by electron tomography of EL containing EV that display gold-labeled, endogenous SEC62 at the limiting membrane. See also Supplementary Movie 1. Scale bar for CLSM: 10 μm; scale bar for IEM: 200 nm

CHMP4B and VPS4A intervention during ER stress resolution

Inward membrane invagination (i.e., reverse-topology membrane remodeling and scission) is driven by ESCRT-III[41-44]. Consistently, silencing of the charged multivesicular body protein 4B (CHMP4B), an essential ESCRT-III subunit, prevents capture of cytosolic proteins by inward endolysosomal membrane budding[45]. In our experimental setup, silencing of CHMP4B expression (Fig. 5a) substantially inhibits delivery of EV within LAMP1-positive EL during recovery from ER stress (Fig. 5b–d) and when recov-ER-phagy is recapitulated by SEC62 induction (Fig. 5e–g). Consistently, CHMP4B silencing delays return of ER stress-induced chaperones at their pre-stress level (Fig. 5h, upper panel), without affecting return of HERP (middle panel).
Fig. 5

A role of CHMP4B in recov-ER-phagy. a WB showing knockdown efficiency for siCHMP4B. b Same as Fig. 1b in MEF transfected with a scrambled siRNA. c Same as b in cells transfected with a siRNA silencing CHMP4B expression. d Quantification of EV delivery within EL in b, c (n = 11, 11 cells, respectively). Unpaired, two-tailed t test, **P = 0.0052. e Same as b in cells where recov-ER-phagy is recapitulated on SEC62 overexpression. f Same as c in cells where recov-ER-phagy is recapitulated on SEC62 overexpression. g Quantification of EV delivery within EL in e, f (n = 10, 10 cells, respectively). Unpaired t test, ***P = 0.0006. Data are representative of at least two independent experiments. Scale bars: 10 μm. h Same as Fig. 1a in cells transfected with a siRNA silencing CHMP4B expression. Quantification of BiP levels in WB, n = 3 independent experiments, mean ± SEM; unpaired, two-tailed t test, P = 0.4776. Molecular weight markers in WB are in kDa; n.s. not significant

A role of CHMP4B in recov-ER-phagy. a WB showing knockdown efficiency for siCHMP4B. b Same as Fig. 1b in MEF transfected with a scrambled siRNA. c Same as b in cells transfected with a siRNA silencing CHMP4B expression. d Quantification of EV delivery within EL in b, c (n = 11, 11 cells, respectively). Unpaired, two-tailed t test, **P = 0.0052. e Same as b in cells where recov-ER-phagy is recapitulated on SEC62 overexpression. f Same as c in cells where recov-ER-phagy is recapitulated on SEC62 overexpression. g Quantification of EV delivery within EL in e, f (n = 10, 10 cells, respectively). Unpaired t test, ***P = 0.0006. Data are representative of at least two independent experiments. Scale bars: 10 μm. h Same as Fig. 1a in cells transfected with a siRNA silencing CHMP4B expression. Quantification of BiP levels in WB, n = 3 independent experiments, mean ± SEM; unpaired, two-tailed t test, P = 0.4776. Molecular weight markers in WB are in kDa; n.s. not significant ESCRT-III-driven membrane remodeling and scission relies on the energy delivered on ATP hydrolysis by the auxiliary AAA+ ATPase VPS4A[41-44]. In our experiments, engulfment of SEC62-positive EV by EL during recovery from ER stress was normal in cells expressing fluorescently labeled VPS4AWT (Fig. 6a, merge 1, inset 1, Fig. 6c), but it was substantially inhibited in cells expressing VPS4AK173Q, a dominant-negative mutant that cannot bind and hydrolyze ATP[46] (Fig. 6b, merge 1, inset 1, Fig. 6c). The role of VPS4A in EV engulfment by LAMP1-positive EL was confirmed on overexpression of SEC62-HA to faithfully recapitulate recov-ER-phagy (Fig. 6d–g). Ultrastructural analyses of cells where the engulfment of excess ER by LAMP1-positive EL is inhibited on inactivation of the ESCRT-III machinery show that SEC62-positive EV remain in close proximity of the EL and are not delivered within the degradative organelles (Fig. 6h–k, Supplementary Movie 2). Notably, VPS4AWT, which drives EV engulfment, accumulates within LAMP1-positive EL on inactivation of proteolytic enzymes with BafA1 (Fig. 6a, merge 2, inset 2, Fig. 6e, merge 2, white arrows in inset 2 and in inset VPS4A). The inactive VPS4AK173Q is not found within EL (Fig. 6b, merge 2, inset 2, Fig. 6f, merge 2, red arrows in inset 2 and in inset VPS4A). This is consistent with partitioning of VPS4A within the inward budding structure after the ESCRT-III mediated scission event[44]. Finally, we confirm VPS4A-dependent engulfment of excess ER by LAMP1-positive EL by HaloTag pulse chase (Fig. 7), a protocol for time-resolved analyses of EV segregation recently developed in our lab[19]. Briefly, to monitor by time-resolved fluorescence microscopy the sequential steps of ER subdomains delivery within EL for clearance, WT MEF were transfected with SEC62-HaloTag (Supplementary Fig. 3) and with VPS4AWT (Fig. 7a, c) or VPS4AK173Q (Fig. 7b, c). The fate of newly synthesized SEC62-HaloTag is followed by pulsing cells, for 15 min, with the fluorescent HaloTag ligand PBI 5030 (ref. [19] legend of Fig. 7 and Materials and methods). Initially (0–2 h chase), SEC62-HaloTag is not visible within LAMP1-positive EL. Only in cells expressing VPS4AWT, it is eventually delivered within the EL, where it progressively accumulates on EL inactivation with BafA1 (Fig. 7a, c, 5–12 h chase). In cells expressing inactive VPS4AK173Q, SEC62-HaloTag remains virtually excluded from the EL throughout the chase (Fig. 7b, c).
Fig. 6

A role of VPS4A in recov-ER-phagy. a Same as Fig. 1b in MEF transfected with a plasmid for expression of GFP-VPS4A (VPS4AWT). b Same as a in cells transfected with a plasmid for expression of GFP-VPS4AK137Q (VPS4AK137Q). c Quantification of EV delivery within EL in a, b (n = 8, 8 cells, respectively). Unpaired, two-tailed t test, ***P = 0.0002. Data are representative of three independent experiments with similar results. d Delivery of SEC62-HA within LAMP1-positive EL in MEF transfected with an empty plasmid exposed to BafA1 for 12 h. e Same as d in cells transfected with a plasmid for expression of GFP-VPS4AWT. f Same as d in cells transfected with a plasmid for expression of GFP-VPS4AK137Q. g Quantification of EV delivery within EL in d–f (n = 10, 10, 9 cells, respectively); ANOVA and Dunnett’s multiple comparisons test, n.s.P > 0.05, ****P < 0.0001. Data are representative of at least three independent experiments. h SEC62-HaloTag-positive EV outside LAMP1-positive EL in cells expressing VPS4AK137Q. See also Supplementary Fig. 3. i inset of h. Scale bars: 10 μm. j Single slice of an electron tomogram. k 3D visualization by electron tomography of SEC62-positive EV adjacent to EL. For j, k, IEM images are representative of two independent experiments with similar results. Scale bar: 250 nm. See Supplementary Movie 2

Fig. 7

Time-resolved analyses of VPS4A-dependent delivery of EV within EL. a Cells expressing SEC62-HaloTag and VPS4AWT are incubated for 30 min with 6-chlorohexanol, a non-fluorescent HaloTag ligand that quenches fluorescent detection of the SEC62-HaloTag chimera. Cells are subsequently incubated with a cell-permeable fluorescent HaloTag ligand (PBI 5030) to label, for 15 min, newly synthesized SEC62-HaloTag (fluorescent pulse). Cells are fixed at different times after interruption of the fluorescent pulse on PBI 5030 replacement with 6-chlorohexanol (0 to 12 h[19]) to monitor the progressive delivery of SEC62-HaloTag-labeled EV within LAMP1-positive EL. b Same as a in MEF expressing SEC62-HaloTag and VPS4AK137Q, where EV delivery within EL is virtually abolished. c Quantification of SEC62-HaloTag positive EL (VPS4AWT n = 3, 3, 3, 4, 4; VPS4AK173Q n = 3, 3, 4, 4, 4 cells for the corresponding time points). Mean ± SEM. IF panels are representative of two independent experiments. Scale bar: 10 μm

A role of VPS4A in recov-ER-phagy. a Same as Fig. 1b in MEF transfected with a plasmid for expression of GFP-VPS4A (VPS4AWT). b Same as a in cells transfected with a plasmid for expression of GFP-VPS4AK137Q (VPS4AK137Q). c Quantification of EV delivery within EL in a, b (n = 8, 8 cells, respectively). Unpaired, two-tailed t test, ***P = 0.0002. Data are representative of three independent experiments with similar results. d Delivery of SEC62-HA within LAMP1-positive EL in MEF transfected with an empty plasmid exposed to BafA1 for 12 h. e Same as d in cells transfected with a plasmid for expression of GFP-VPS4AWT. f Same as d in cells transfected with a plasmid for expression of GFP-VPS4AK137Q. g Quantification of EV delivery within EL in d–f (n = 10, 10, 9 cells, respectively); ANOVA and Dunnett’s multiple comparisons test, n.s.P > 0.05, ****P < 0.0001. Data are representative of at least three independent experiments. h SEC62-HaloTag-positive EV outside LAMP1-positive EL in cells expressing VPS4AK137Q. See also Supplementary Fig. 3. i inset of h. Scale bars: 10 μm. j Single slice of an electron tomogram. k 3D visualization by electron tomography of SEC62-positive EV adjacent to EL. For j, k, IEM images are representative of two independent experiments with similar results. Scale bar: 250 nm. See Supplementary Movie 2 Time-resolved analyses of VPS4A-dependent delivery of EV within EL. a Cells expressing SEC62-HaloTag and VPS4AWT are incubated for 30 min with 6-chlorohexanol, a non-fluorescent HaloTag ligand that quenches fluorescent detection of the SEC62-HaloTag chimera. Cells are subsequently incubated with a cell-permeable fluorescent HaloTag ligand (PBI 5030) to label, for 15 min, newly synthesized SEC62-HaloTag (fluorescent pulse). Cells are fixed at different times after interruption of the fluorescent pulse on PBI 5030 replacement with 6-chlorohexanol (0 to 12 h[19]) to monitor the progressive delivery of SEC62-HaloTag-labeled EV within LAMP1-positive EL. b Same as a in MEF expressing SEC62-HaloTag and VPS4AK137Q, where EV delivery within EL is virtually abolished. c Quantification of SEC62-HaloTag positive EL (VPS4AWT n = 3, 3, 3, 4, 4; VPS4AK173Q n = 3, 3, 4, 4, 4 cells for the corresponding time points). Mean ± SEM. IF panels are representative of two independent experiments. Scale bar: 10 μm

Endogenous LC3B decorates EV

In macro-autophagy, LC3 is lipidated on the phagophore membrane and eventually recruits cargo within double-membrane autophagosomes[31]. Since autophagosome biogenesis is dispensable for ER turnover at the end of acute ER stresses, we assessed LC3 localization during recov-ER-phagy. Our analyses reveal that endogenous LC3 co-localizes with SEC62-labeled ER accumulating within LAMP1-positive EL on inhibition of lysosomal activity with BafA1 (Fig. 8a). The inhibition of EV engulfment by LAMP1-positive EL on expression of the inactive variant of VPS4A reveals the presence of endogenous LC3B on SEC62-labeled structures both in WT MEF (Fig. 8b) and in MEF with defective autophagosome biogenesis (Fig. 8c, d). The vesicular nature of the SEC62/LC3-positive ER-derived structures that deliver excess ER within EL during recovery from ER stress is confirmed by orthogonal sections of deconvoluted images (Fig. 8f). The formation of EV is abolished in cells expressing a SEC62LIR variant that cannot bind LC3[7] (Fig. 8g) and in Atg7KO MEF with defective LC3 lipidation (Fig. 8e, h). All in all, these results support the notion that the ER-resident LC3-binding protein SEC62, LC3 lipidation and the VPS4A-powered ESCRT-III machinery, but not autophagosome biogenesis, regulate ER fragmentation and piecemeal micro-ER-phagy characterizing the ER turnover on ER stress resolution.
Fig. 8

LC3B localization on SEC62-positive EV. a SEC62-HA co-localizes with endogenous LC3B inside LAMP1-positive EL in WT MEF-expressing VPS4AWT exposed to BafA1 for 12 h. b SEC62-HA/LC3B-positive EV (white arrows) fails to be delivered inside the EL in WT MEF-expressing VPS4AK173Q. c Same as b in Ulk1/2 double-KO MEF. d Same as b in Atg14KO MEF. e Same as b in Atg7KO MEF. f Max projection of a WT cell expressing SEC62-HA and VPS4AK173Q after deconvolution. Insets show orthogonal sections of selected region. g Same as in f with SEC62LIR-HA. h Same as f in Atg7KO MEF cells. Scale bars: 10 μm. IF panels are representative of at least two independent experiments

LC3B localization on SEC62-positive EV. a SEC62-HA co-localizes with endogenous LC3B inside LAMP1-positive EL in WT MEF-expressing VPS4AWT exposed to BafA1 for 12 h. b SEC62-HA/LC3B-positive EV (white arrows) fails to be delivered inside the EL in WT MEF-expressing VPS4AK173Q. c Same as b in Ulk1/2 double-KO MEF. d Same as b in Atg14KO MEF. e Same as b in Atg7KO MEF. f Max projection of a WT cell expressing SEC62-HA and VPS4AK173Q after deconvolution. Insets show orthogonal sections of selected region. g Same as in f with SEC62LIR-HA. h Same as f in Atg7KO MEF cells. Scale bars: 10 μm. IF panels are representative of at least two independent experiments

Discussion

The ER is a plastic organelle of eukaryotic cells, whose volume and activities are adapted in response to intra- and extracellular signals. The anabolic pathways that enlarge the ER and increase its content in resident proteins and enzymes are collectively defined as UPR and have been characterized in molecular details[1,2]. The catabolic pathways that reduce ER volume and content by delivering ER subdomains to acidic compartment for destruction are much less understood. The identification of several ER-resident proteins that may engage, upon appropriate stimuli, cytosolic factors such as LC3s/Atg8, GABARAPs, and FIP200/Atg11 to promote delivery of ER fragments within EL/vacuole for clearance has opened the run to dissect receptor-mediated, lysosomal-controlled, ER turnover pathways. At the end of an ER stress, the reduction of the ER volume and of the ER content in resident proteins to pre-stress, physiologic status is crucial to re-establish ER homeostasis. In this phase, cells must, among other things, also re-gain the capacity to produce the secretOME (i.e., the 40% of the proteOME destined to the organelles of the secretory and endocytic compartments, the plasma membrane, and the extracellular space), whose production is temporarily halted during the ER stress phase[47]. The secretOME enters the ER co-translationally via the SEC61 protein translocation machinery that is endowed with a SEC62:SEC63 functional complex to facilitate access of those polypeptides that are synthesized in the cytosol and imported only after completion of the polypeptide chain via post-translational translocation[22,23]. We recently reported that conclusion of ER stresses activates the LC3-binding function of SEC62 and triggers lysosomal turnover of ER subdomains containing folding factors, but lacking ERAD factors via catabolic pathways collectively defined as recov-ER-phagy[7]. The finding that selective ER delivery to EL for clearance is recapitulated by SEC62 overexpression and by SEC63 silencing[7] hint at possible mutually exclusive role of SEC62 in ER protein import vs. receptor-mediated, selective ER turnover. Notably, the LC3-binding region is dispensable for the former and required for the latter function of SEC62 (ref. [7] and Supplementary Fig. 3c). It will be of interest to verify whether the changes in newly synthesized proteins getting access to the ER during steady state (presumably more cargo) vs. ER stress (presumably more ER-resident proteins) vs. recovery from ER stress (back to more cargo proteins import?) phases results in variations in the SEC61:SEC62:SEC63 oligomeric composition[22,23] and if this in turn generates orphan SEC62 to promote ER turnover. Alternatively, the triggering signal for a switch in SEC62 function from protein translocation to ER turnover could be a change in the luminal fraction of free BiP (which is regulated in complex manner[48-50]). In fact, SEC63 is a BiP-binding protein and BiP association could set SEC62 free for its role in recov-ER-phagy. All these issues will be assessed in future work. Here, we report that lipidation of LC3 is required, but the autophagosome biogenesis machinery and macro-ER-phagy are dispensable for clearance of excess ER characterizing the recovery phase from acute ER stresses. As such, recov-ER-phagy, which is triggered by an ER-centric signal, is mechanistically different from starvation-induced turnover of the mammalian ER, which activates (unselective?) macro-autophagic clearance of ER subdomains decorated with FAM134B[6], RTN3[8], ATL3[9], CCPG1[10], TEX264[11,12]. Rather, SEC62-driven return of ER size and content at pre-stress, physiologic status, entails the LC3 lipidation machinery, the ESCRT-III component CHMP4B and the accessory AAA+ ATPase VPS4A. During recovery from ER stress, CHMP4B and VPS4A, whose involvement in physiologic and pathogen-induced membrane repair, remodeling and fission events has been reported[43,44,51], ensure the inward budding of the EL membrane required for the engulfment and clearance of pre-formed ER vesicles that display SEC62 and LC3 at the limiting membrane and contain excess ER chaperones and membranes generated during the phase of ER stress. The function of LC3 in recov-ER-phagy (and in other types of receptor-mediated ER turnover by lysosomes/vacuole) as well as the mode of recruitment of the ESCRT-III machinery that welcomes the incoming ER-derived vesicle containing material to be cleared from cells remains a matter for further studies. However, these data highlight the variety of pathways that cells can activate in response to pleiotropic and to ER-centric signals to ensure lysosomal turnover of the ER. For the mechanistic dissection of catabolic regulation of ER function via lysosomal-controlled ER turnover, it seems crucial to examine in detail cellular responses to ER-centric signals that may activate individual ER-resident LC3-binding proteins. ER-centric signals activate client-specific autophagic and not autophagic pathways that deliver fragmented ER subdomains containing defective material (certainly misfolded proteins[15,17], possibly aberrant lipids or ER-resident proteins, whose activity is determined post-translationally by regulated turnover[29]) to the lysosomal/vacuolar compartments. Significant on this line, is the characterization of ERLAD pathways that ensure disposal of ER or of ER-exit site subdomains containing misfolded proteins that cannot be dislocated across the membrane for proteasomal degradation[15,17]. Emerging evidence reveal the involvement in ERLAD of mammalian ER-resident LC3-binding proteins such as FAM134B[19,20] and CCPG1[10] and the yeast ER-resident Atg8-binding protein Atg40[52]. These receptors operate conventionally to engage autophagosomes in macro-ER-phagy-like processes[20,52], or unconventionally by ensuring direct delivery of the ER subdomain to be cleared from cells to EL via vesicular trafficking[19] or via poorly characterized micro-autophagy-like processes[21]. Back to recov-ER-phagy, the broader, possible implications of our findings relate to the fact that amplification of the SEC62 gene and the consequent enhanced ER turnover confers a stress tolerance that correlates with resistance to anti-cancer therapies to a number of carcinomas, including breast, prostate, thyroid, lung adenocarcinoma, and head and neck squamous cell carcinoma[53-55]. Our characterization of the catabolic pathways activated by cells recovering from ER stress to remodel the ER paves the way for identification of therapeutic targets to treat diseases caused by impaired proteostatic control and to unravel in more detail the novel function of the ESCRT-III/VPS4A machinery in membrane remodeling to better define molecular aspects of organelle and membrane dynamics.

Materials and methods

Antibodies, expression plasmids, and chemicals

Antibodies against CNX (Western blot (WB) 1:3000, immunofluorescence (IF) 1:100), CHMP4B (1:1000), SEC62 (WB 1:1000, IF 1:100), and ERj3 (1:250) are kind gifts from A. Helenius, H. Stenmark, and R. Zimmermann. Plasmid encoding GFP-RAB7 is a kind gift from T. Johansen. Commercial antibodies used in this study are from Stressgen (BiP, 1:1000), Chondrex (HERP, 1:1500), Developmental Studies Hybridoma Bank (LAMP1, 1:50), Sigma and Santa Cruz (HA, WB 1:3000, IF 1:100), Merck Millipore (GAPDH, 1:30,000), Sigma (STX17, 1:1000), Abcam (VAMP8, 1:1000), Santa Cruz (Actin 1:500), Novus and Sigma (LC3B, WB 1:1000, IF 1:50), Promega (HaloTag, 1:1000), and MBL (p62, 1:1500). The secondary horse radish peroxidase (HRP)-conjugated antibodies were from Jackson Immunoresearch (rabbit, 1:10,000), Santa Cruz (goat, 1:20,000), and SouthernBiotech (mouse, 1:20,000). Alexa Fluor-conjugated secondary antibodies (1:300) from Invitrogen, Jackson Immunoresearch, Thermo Fisher, and BioLegend. Plasmids encoding GFP-VPS4AWT and GFP-VPS4AK173Q were a kind gift from John McCullough. SEC62 was subcloned in a pcDNA3.1 expression plasmid with the addition of a C-terminal HA-tag or HaloTag[7]. CPA (Sigma) and BafA1 (Sigma) were used for 12 h, if not otherwise specified, at final concentrations of 10 μM and 50 nM, respectively. PS341 (Millennium Pharmaceuticals) was used for 8 h at a final concentration of 10 μM.

Induction of transient ER stress

To induce a mild and reversible ER stress, cultured cells were exposed for up to 12 h to CPA, a reversible inhibitor of the sarco/ER calcium ATPase[7,27]. An alternative protocol implies cell exposure to dithiothreitol[7] (DTT, a reversible perturbator of redox homeostasis[56]), whereas other ER stress-inducing drugs such as tunicamycin and thapsigargin, which are irreversible inhibitors of GlcNAc phosphotransferase[57] and of the sarco/ER calcium ATPase[58], respectively, are toxic[7]. Consistent with UPR induction, CPA treatment caused splicing of XBP1 transcripts, 25% attenuation of global protein synthesis, and induction of ER stress marker transcripts and proteins[7]. The catabolic events characterizing recovery from ER stress (i.e., the delivery of ER subdomains within EL for clearance) were investigated after CPA wash-out as specified in the figure legends and in ref. [7].

Cell culture, transient transfection, and RNA interference

MEF and HEK cells were grown at 37 °C and 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM) medium supplemented with 10% fetal calf serum (FCS). WT and Atg7KO MEF cells were gifts from M. Komatsu. Atg4BKO, Atg13KO, Atg14 and Atg16L1KO, and Ulk1/2DKO MEF cells were kindly provided by G. Marino, F. Reggiori, T. Saitoh, and S. Tooze, respectively, and have been characterized in ref. [19] and in Supplementary Fig. 2. To induce autophagy, cells were washed three times with Earle’s balanced salt solution (EBSS, Thermo Fisher) and then incubated in EBSS for 2 h in the presence or absence of 100 nM BafA1. Transient transfections were performed using JetPrime transfection reagent (PolyPlus) according to the manufacturer’s instructions. RNA interferences were performed in MEF cells plated at 50–60% confluence. Cells were transfected with scrambled small interfering RNA or small interfering RNA (siRNA) against CHMP4B (5′-AAACAGUCCCUCUACCAAAtt-3′, 50 nM per dish, Silencer Select Pre-designed, Ambion). Cells were processed for immunofluorescence or for biochemical analyses 48 h after transfection (see below).

Preparation of KO cells

STX17- and VAMP8-KO MEF and SEC62-KO HEK cells were generated by CRISPR/Cas9 genome editing. For the generation of the guideRNA‐Cas9 plasmids, lentiCRISPRv2‐puro system (Addgene52961) was obtained from Addgene (http://www.addgene.org). Guide sequences were obtained from the Cas9 target design tools (crispr.mit.edu:8079 and/or www.addgene.org/pooled-library). All protocols and information can be found at the website https://www.addgene.org/crispr. The target sequences for guide RNA were synthesized by Microsynth. Two annealed oligonucleotides (5′-CACCGCTGTGGTTGACTACTGCAAC-3′, 5′-AAACGTTGCAGTAGTCAACCACAGC-3′ for human SEC62; 5′‐GCGCTCCAATATCCGAGAAA‐3′, 5′‐TTTCTCGGATATTGGAGCGC‐3′ for murine STX17; 5′‐CCACCTCCGAAACAAGACAG‐3′, 5′‐CTGTCTTGTTTCGGAGGTGG‐3′ for murine VAMP8) were inserted into the lentiCRISPRv2‐puro vector using the BsmBI restriction site. Vectors were transfected in HEK and MEF cells with JetPrime (Polyplus) according to the manufacturer’s instructions[7,19]. Cells were cultured in DMEM supplemented with 10% FBS. Two days after transfection, the medium was supplemented with 2 μg/ml puromycin. After 10 days, puromycin‐resistant clones were picked and gene KO was verified by WB (ref. [7] for SEC62; Fig. 3a, b and ref. [19] for STX17 and VAMP8) and with a translocation assay for SEC62 (ref. [7] and Supplementary Fig. 3c).

Cell lysis, Western blot

Cells were washed in ice cold phosphate-buffered saline (PBS) containing 20 mM N-ethylmaleimide (NEM) and lysed in 1% sodium dodecyl sulfate (SDS) in HEPES-buffered saline, pH 6.8, or with RIPA buffer (1% Triton X-100, 0.1% SDS, 0.5% sodium deoxycholate in HBS, pH 7.4) containing 20 mM NEM and protease inhibitor cocktail (1 mM PMSF, chymostatin, leupeptin, antipain, and pepstatin, 10 μg/ml each). Post-nuclear supernatants were collected by centrifugation at 10,000 × g for 10 min at 4 °C. Samples were denatured and reduced in DTT-containing sample buffer for 5 min at 95 °C and separated by SDS-PAGE (polyacrylamide gel electrophoresis). Proteins were transferred to polyvinylidene fluoride membranes with the Trans-Blot Turbo Transfer System (Bio-Rad). Membranes were blocked 10 min with 10% (w/v) non-fat dry milk (Bio-Rad) and stained with the above-mentioned primary antibodies for 90 min and for 45 min with HRP-conjugated secondary antibodies. Membranes were developed using the Luminata Forte ECL detection system (Millipore) and signals were acquired with the ImageQuant LAS 4000 system (GE Healthcare Life Sciences) or with the Amersham Imager 680 system. Image quantifications were performed with the Multi Gauge Analysis tool (Fujifilm). Membrane stripping was performed using Re-Blot Plus Strong Solution (Millipore) following the manufacturer’s instructions. Uncropped blots can be found as Supplementary Fig. 4.

Confocal laser scanning microscopy

MEF cells plated on alcian blue-coated glass coverslips were treated according to the experimental setup. Cells were washed twice in PBS and fixed at room temperature for 20 min with 3.7% formaldehyde in PBS or 5 min in 100% methanol at −20 °C for endogenous LC3B detection. Cells were then incubated for 15 min with permeabilization solution (PS, 0.05% saponin, 10% goat serum, 10 mM HEPES, 15 mM glycine, pH 7.4) to improve antigen accessibility. Cells were incubated with the primary antibodies diluted 1:50–1:200 in PS for 90 min, washed for 15 min in PS, and then incubated with Alexa Fluor-conjugated secondary antibodies diluted 1:300 in PS for 30 min. Cells were rinsed with PS and water and mounted with Vectashield (Vector Laboratories) supplemented with 4′,6-diamidino-2-phenylindole. Confocal pictures were acquired using a Leica TCS SP5 microscope with a 63.0 × 1.40 Oil UV objective. FIJI was used for image analysis and processing. Figure 8f–h were acquired with LEICA HCX PL APO CS 100.0 × 1.44 Oil UV objective with a XY pixel size of 50 nm and Z step of 125 nm and pinhole 0.8 AU. Images were deconvoluted with Autoquant 3.1.1 (Media Cybernetics) with a spherical aberration correction.

Immunogold electron microscopy

Cells were plated on alcian blue-coated glass coverslips and fixed 10 min with 0.05% glutaraldehyde in 4% paraformaldehyde (PFA) EM grade and 0.2 M HEPES buffer and 50 min in 4% PFA EM grade in 0.2 M HEPES buffer. After three washes in PBS, cells were incubated 10 min with 50 mM glycine and blocked 1 h in blocking buffer (0.2% bovine serum albumin, 5% goat serum, 50 mM NH4Cl, 0.1% saponin, 20 mM PO4 buffer, 150 mM NaCl). Staining with primary antibodies and nanogold-labeled secondary antibodies (Nanoprobes) were performed in blocking buffer at room temperature. Cells were fixed 30 min in 1% glutaraldehyde and nanogold was enlarged with gold enhancement solution (Nanoprobes) according to the manufacturer’s instructions. Cells were post fixed with osmium tetroxide, embedded in epon, and processed into ultrathin slices. After contrasting with uranyl acetate and lead citrate, the sections were analyzed with Zeiss LEO 512 electron microscope. Images were acquired by 2k × 2k bottom-mounted slow-scan Proscan camera controlled by the EsivisionPro 3.2 software.

HaloTag pulse-chase analyses

MEF cells were plated on alcian blue-coated glass coverslip and transfected with SEC62-HaloTag and VPS4WT or VPS4K173Q. Seventeen hours after transfection, cells were incubated with 15 μM 6-chlorohexanol (Sigma) in DMEM 10% FCS for 30 min. 6-Chlorohexanol is cell-permeable black ligand that irreversibly binds the SEC62-HaloTag-binding pocket. After three washes in DMEM 10% FCS, cells are pulsed 15 min with 1 μM of the fluorescent ligand PBI 5030 (Promega), which exclusively enters the HaloTag ligand binding pocket of newly synthetized SEC62-HaloTag, and 100 nM BafA1 in DMEM 10% FCS. The fluorescent ligand is removed and after three washes in DMEM 10% FCS, cells are incubated with 15 μM of the black ligand to block incorporation of the fluorescent ligand in the newly synthetized SEC62-HaloTag, and 100 nM BafA1 in DMEM 10% FCS. Cells were fixed at increasing time points (0, 30 min, 2, 5, 6, and 12 h) and processed for confocal laser scanning microscopy as described above. HaloTag pulse chase has been described in ref. [19].

Statistical analyses and reproducibility

In panels showing WB or IF, unless stated otherwise, images are representative of three independent experiments with similar results. The number of independent experiments or cell numbers is given in the figure’s legend. Statistical analyses were performed only if sample size was ≥3 using GraphPad Prism 7 software. One-way analysis of variance with Dunnett’s multiple comparisons test or unpaired, two-tailed t test were used to asses statistical significance. P values are given in the figure legends; n.sP < 0.05; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.
  56 in total

Review 1.  Protein misfolding in the endoplasmic reticulum as a conduit to human disease.

Authors:  Miao Wang; Randal J Kaufman
Journal:  Nature       Date:  2016-01-21       Impact factor: 49.962

2.  Identification of 3q oncogene SEC62 as a marker for distant metastasis and poor clinical outcome in invasive ductal breast cancer.

Authors:  Ferenc Zoltan Takacs; Julia Caroline Radosa; Maximilian Linxweiler; Mariz Kasoha; Rainer M Bohle; Florian Bochen; Clara Unger; Erich-Franz Solomayer; Bernard Schick; Ingolf Juhasz-Böss
Journal:  Arch Gynecol Obstet       Date:  2019-02-12       Impact factor: 2.344

Review 3.  Chaperone-mediated autophagy and endosomal microautophagy: Joint by a chaperone.

Authors:  Kumsal Tekirdag; Ana Maria Cuervo
Journal:  J Biol Chem       Date:  2017-12-15       Impact factor: 5.157

4.  Global profiling of genes modified by endoplasmic reticulum stress in pancreatic beta cells reveals the early degradation of insulin mRNAs.

Authors:  P Pirot; N Naamane; F Libert; N E Magnusson; T F Ørntoft; A K Cardozo; D L Eizirik
Journal:  Diabetologia       Date:  2007-03-01       Impact factor: 10.122

5.  TEX264 Is an Endoplasmic Reticulum-Resident ATG8-Interacting Protein Critical for ER Remodeling during Nutrient Stress.

Authors:  Heeseon An; Alban Ordureau; Joao A Paulo; Christopher J Shoemaker; Vladimir Denic; J Wade Harper
Journal:  Mol Cell       Date:  2019-04-18       Impact factor: 17.970

6.  The hairpin-type tail-anchored SNARE syntaxin 17 targets to autophagosomes for fusion with endosomes/lysosomes.

Authors:  Eisuke Itakura; Chieko Kishi-Itakura; Noboru Mizushima
Journal:  Cell       Date:  2012-12-07       Impact factor: 41.582

7.  Ube2g2-gp78-mediated HERP polyubiquitylation is involved in ER stress recovery.

Authors:  Long Yan; Weixiao Liu; Huihui Zhang; Chao Liu; Yongliang Shang; Yihong Ye; Xiaodong Zhang; Wei Li
Journal:  J Cell Sci       Date:  2014-02-04       Impact factor: 5.285

8.  Manipulating disulfide bond formation and protein folding in the endoplasmic reticulum.

Authors:  I Braakman; J Helenius; A Helenius
Journal:  EMBO J       Date:  1992-05       Impact factor: 11.598

9.  Full length RTN3 regulates turnover of tubular endoplasmic reticulum via selective autophagy.

Authors:  Paolo Grumati; Giulio Morozzi; Soraya Hölper; Muriel Mari; Marie-Lena Ie Harwardt; Riqiang Yan; Stefan Müller; Fulvio Reggiori; Mike Heilemann; Ivan Dikic
Journal:  Elife       Date:  2017-06-15       Impact factor: 8.140

10.  CCPG1 Is a Non-canonical Autophagy Cargo Receptor Essential for ER-Phagy and Pancreatic ER Proteostasis.

Authors:  Matthew D Smith; Margaret E Harley; Alain J Kemp; Jimi Wills; Martin Lee; Mark Arends; Alex von Kriegsheim; Christian Behrends; Simon Wilkinson
Journal:  Dev Cell       Date:  2017-12-28       Impact factor: 12.270

View more
  29 in total

1.  Endoplasmic Reticulum (ER) and ER-Phagy.

Authors:  Marisa Loi; Alessandro Marazza; Maurizio Molinari
Journal:  Prog Mol Subcell Biol       Date:  2021

2.  Reticulon proteins modulate autophagy of the endoplasmic reticulum in maize endosperm.

Authors:  Xiaoguo Zhang; Xinxin Ding; Richard Scott Marshall; Julio Paez-Valencia; Patrick Lacey; Richard David Vierstra; Marisa S Otegui
Journal:  Elife       Date:  2020-02-03       Impact factor: 8.140

3.  Sec62 promotes gastric cancer metastasis through mediating UPR-induced autophagy activation.

Authors:  Song Su; Yan-Ting Shi; Yi Chu; Ming-Zuo Jiang; Nan Wu; Bing Xu; He Zhou; Jun-Chao Lin; Yi-Rong Jin; Xiao-Fei Li; Jie Liang
Journal:  Cell Mol Life Sci       Date:  2022-02-15       Impact factor: 9.261

Review 4.  The different autophagy degradation pathways and neurodegeneration.

Authors:  Angeleen Fleming; Mathieu Bourdenx; Motoki Fujimaki; Cansu Karabiyik; Gregory J Krause; Ana Lopez; Adrián Martín-Segura; Claudia Puri; Aurora Scrivo; John Skidmore; Sung Min Son; Eleanna Stamatakou; Lidia Wrobel; Ye Zhu; Ana Maria Cuervo; David C Rubinsztein
Journal:  Neuron       Date:  2022-02-07       Impact factor: 17.173

Review 5.  The emerging mechanisms and functions of microautophagy.

Authors:  Liming Wang; Daniel J Klionsky; Han-Ming Shen
Journal:  Nat Rev Mol Cell Biol       Date:  2022-09-12       Impact factor: 113.915

Review 6.  Autophagy and organelle homeostasis in cancer.

Authors:  Dannah R Miller; Andrew Thorburn
Journal:  Dev Cell       Date:  2021-03-08       Impact factor: 12.270

7.  TcpC inhibits neutrophil extracellular trap formation by enhancing ubiquitination mediated degradation of peptidylarginine deiminase 4.

Authors:  Qian Ou; Jia-Qi Fang; Zhe-Sheng Zhang; Zhe Chi; Jie Fang; Di-Yan Xu; Kai-Zhong Lu; Meng-Qing Qian; Da-Yong Zhang; Jun-Ping Guo; Wei Gao; Na-Ru Zhang; Jian-Ping Pan
Journal:  Nat Commun       Date:  2021-06-09       Impact factor: 14.919

8.  Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1.

Authors:  Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong
Journal:  Autophagy       Date:  2021-02-08       Impact factor: 13.391

Review 9.  Endoplasmic reticulum stress and unfolded protein response in cardiovascular diseases.

Authors:  Jun Ren; Yaguang Bi; James R Sowers; Claudio Hetz; Yingmei Zhang
Journal:  Nat Rev Cardiol       Date:  2021-02-22       Impact factor: 32.419

10.  Quantitative live-cell PALM reveals nanoscopic Faa4 redistributions and dynamics on lipid droplets during metabolic transitions of yeast.

Authors:  Santosh Adhikari; Joe Moscatelli; Elias M Puchner
Journal:  Mol Biol Cell       Date:  2021-06-23       Impact factor: 4.138

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.