Literature DB >> 31687383

Virulence Factor Genes Incidence among Enterococci from Sewage Sludge in Eastern Slovakia following Safety Aspect.

Andrea Lauková1, Viola Strompfová1, Jana Ščerbová1, Monika Pogány Simonová1.   

Abstract

The sewage sludges represent a potential health hazard because of the quantity of different microbiota detected in sewages. Among microbiota detected in sewages, also belong representatives of the phylum Firmicutes. In the past, environmental enterococci in addition to coliforms were widely used as indicators of faecal contamination. Regarding the enterococcal strains as potential pathogenic bacteria, their pathogenicity is mainly caused by production of virulence factors. Therefore, the aim of the study was to analyse incidence of virulence factors in enterococci from cows' dung water. Species identification of 24 enterococci using MALDI-TOF MS system allotted 23 strains to the species Enterococcus faecium with highly probable species identification and E. faecalis EEV20 with a score value meaning secure genus identification/probable species identification. Enterococci were absent of cytolysin A gene, hyaluronidase gene, and element IS gene. It can be concluded that they are not invasive which is very important from safety aspect. The most frequently detected gene was adhesin E. faecium (efaAfm, in 22 E. faecium strains and in one E. faecalis). Adhesin efaAfs gene was detected in E. faecalis EEV20 and in two E. faecium. GelE gene was present in three strains. E. faecium EF/EC31 was absent of virulence factor genes.
Copyright © 2019 Andrea Lauková et al.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31687383      PMCID: PMC6800973          DOI: 10.1155/2019/2735895

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Stabilized animal sewage sludge, including cow's dung water is frequently used for agricultural purposes to farmland application due to its high organic matter content serving, e.g., as a source of nutrients for plants [1]. However, it has brought the hygienic and/or safety aspect into focus. That is, the sewage sludges represent a potential health hazard. The hazards are mainly associated with the amount of different microbiota detected in sewages, especially pathogenic species [2]. Stiborová et al. [1] assessed sewage sludges in Czech Republic through both taxonomic and phylogenetic approaches. There, the bacterial community dominated was affiliated with Proteobacteria including the phyla Deinococcus-Thermus and Thermotogae. The most frequently detected genera in the sludge in Czech Republic were Mycobacterium and Streptomyces [1]. However, they also detected the phylum Firmicutes. In the framework of the phylum Firmicutes, Lauková et al. [3] reported representatives of the genus Enterococcus. Previously, environmental enterococci in addition to coliforms were widely used as indicators of faecal contamination [4]. Regarding the enterococcal strains as potential pathogenic bacteria, their pathogenicity is mainly caused by production of virulence factors and/or resistance to antibiotics [5]. Therefore, the aim of this study was to analyse incidence of virulence factors in enterococci isolated from cow's dung water (in Eastern Slovakia), which is useful to know from at least two aspects—characteristic and properties of enterococci from different niches in the framework of the basic research and from safety aspect. That is, in sewage sludge could perform possible conjugative transfer or another way of virulence factor gene transfer among strains which can threaten human population.

2. Materials and Methods

2.1. Sampling, Strain Management, and Identification

Bacterial strains tested (24) were isolated from cow's dung water (sewage sludge) as previously described by Lauková et al. [3]. They were collected from the basins of 25 cattle farms in 15 North-Eastern Slovakian districts. Forty-five samples were transported in bottles and analysed. They were treated according to ISO (International Organization for Standardization), diluted in Ringers solution (Oxoid), and appropriate dilutions were spread plated onto M-Enterococcus agar (Becton and Dickinson, Cockeysville, USA). Incubation was performed in a CO2 atmosphere at 37ºC for 24–48 h. Isolated strains were phenotyped with the API 20 Strep system (API, Biomerieux, L‘Etoile, France). Then, they were stored using a freeze dryer (MicroModulyo,Thermo corp., Asheville, Nebraska, USA). However, before testing of virulence factor genes, strains were re-covered in MRS broth (De Man-Rogosa-Sharpe, Merck, Germany) by cultivating at 37ºC for 24 h following their plating on Brain heart agar enriched with sheep's blood (5%), and then plated on M-Enterococcus agar (Difco, Detroit, Michigan, USA). Pure strains were stored for next analyses with the Microbank system (Pro-Lab Diagnostic, Richmond, Canada). Besides phenotypization, species identification was performed using matrix–assisted laser desorption ionisation time-of-flight mass spectrometry (MALDI-TOF MS, Bruker Daltonics, Billerica, Maryland, USA); [6], meaning BiotyperTM identification system (Bruker Daltonics, USA [7]). This system is used especially for research microbiology. The method is based on analysis of bacterial proteins (fingerprints) using a Microflex MALDI-TOF mass spectrometer. Briefly, a single colony from M-Enterococcus agar was mixed with the matrix (α-cyano-4-hydroxycinnamic acid and trifluoroacetic acid) and the suspension was spotted onto a MALDI plate and ionized with a nitrogen laser (wave-length 337 nm, frequency 20 Hz). Lysates of bacterial cells were prepared according to the producer's instructions (Bruker Daltonics). The results were evaluated using the MALDI Biotyper 3.0 (Bruker Daltonics) identification database. Taxonomic allocation was evaluated on the basis of highly probable species identification-score 2.300–3.000, then secure genus identification/probable species identification (value score 2.000–2.299) and probable genus identification associated with score value of 1.700–1.999. Positive controls were Enterococcus faecium CCM4231 [8] and Enterococcus faecalis DSM 20478 (Bruker Daltonics database 2008).

2.2. Detection of Virulence Factor Genes

Genes for seven virulence factors were screened using PCR amplification with the primers and conditions reported by Kubašová et al. [9]. Genes for the following virulence factors were controlled: gelE (gelatinase), esp (enterococcal surface protein), efaAfm (adhesin E. faecium), efaAfs (adhesin E. faealis), cylA (cytolysin A), hylEfm (hyaluronidase), IS16 (element IS, Table 1). The PCR products were separated by agarose gel electrophoresis (1.2% w/v, Sigma-Aldrich, Saint Louis, USA) containing 1µl/ml ethidium bromide (Sigma-Aldrich) using 0.5x TAE buffer (Merck, Darmstadt, Germany PCR fragments were visualized by UV light. The positive controls were the strains E.faecalis 9Tr1 (our strain), E. faecium P36 (Dr. Semedo-Lemsaddek, University Lisbon, Portugal) and E. faecium UW 9086 provided by Dr. Klare from Robert Koch University, Germany). Briefly, the PCRs were carried out in 25 µl volume, the mix consisted of 1x reaction buffer, 0.2 mmol/l of deoxynucleoside triphosphate, 3 mmol/l MgCl2, 1 µmol/l of each primer, 1 U of Taq DNA polymerase, and 1.5 µl of DNA template with the cycling conditions previously reported by Kubašová et al. [9].
Table 1

Oligonucleotides used for amplification of virulence genes in enterococci isolated form sewage sludge.

PrimerLocusSequence (5'-3')bp
(1) Cytolysin cylA F:TAGCGAGTTATATCGTTCACTGTA1282
R:CTCACCTCTTTGTATTTAAGCATG
(2) ESPa esp F: TTGCTAATGCTAGTCCACGACC933
R: GCGGTCAACACTTGCATTGCCGAA
(3) Adhesin EEb efaAfsF:GACAGACCCTCACGAATA705
R:AGTTCATCATGCTGTAGTA
(4) Adhesin EFc efaAfmF: AACAGATCCGCATGAATA735
R:CATTTCATCATCTGATAGTA
(5) Gelatinase gelE F:ACCCCGTATCATTGGTTT419
R:ACGCATTGCTTTTCCATC
(6) Hyaluronidase hylEfmF: GAGTAGAGGAATATCTTAGC661
R: AGGCTCCAATTCTGT
(7) Element IS16 IS16 F:CATGTTCCACGAACCAGAG547
R:TCAAAAAGTGGGCTTGGC

(1) Semedo et al. (2003), (2) aenterococcal surface protein, Eaton and Gasson (2001), (3) badhesin Enterococcus faecalis, Eaton and Gasson (2001), (4) cadhesin Enterococcus faecium, Eaton and Gasson (2001), (5) Eaton and Gasson (2001), (6) Klare et al. (2005), (7) Werner et al. (2011).

3. Results and Discussion

Species identification of 24 enterococcal strains, done using MALDI-TOF MS system alloted, 23 strains to the species E. faecium and one strain to the species E. faecalis. Thirteen strains of 23 E. faecium (56.5%) were identified with a score value ranging from 2.300 to 3.000, meaning highly probable species identification. Ten strains (43.5%) were alloted to the species E.faecium with a score value ranging from 2.000 to 2.299, indicating secure genus identification/probable species identification. The strain E. faecalis EEV20 was alloted taxonomically with a score value ranging from 2.000 to 2.299 (Table 2).
Table 2

Score value and virulence factor genes detected in enterococci isolated from sewage sludge.

StrainsScore valueVirulence factor genes
gelE efaAfm efaAfs
EF/KK12.339+
EF/EC22.280+
EF/EE32.170+
EF3A2.369+
EF/EC52.366+
EF/EEV62.291+
EFP72.356+
EF92.418+
EFV102.299++
EF/EE112.399+
EF202.329+++
EF/EA212.310+
EF/ED212.077++
EF/SA252.239+
EF/EC312.349
WF/EC322.300+
EF/EC452.250+
EF/EC462.112+
EF/EC472.202+
EF/EC482.200+
EF116972.353+
EF14211982.367+
EF346972.379+
EEV202.281+++

EF-Enterococcus faecium; EE-E. faecalis; gelE-gelatinase; efaAfm−; efaAfs−, − it means no gene detected; +, it means, gene was detected; score value in MALDI-TOF mass spectrometry results evaluation.

All tested enterococci from sewage sludge were absent of cytolysin A-cylA gene,hyaluronidase— hylEfm gene and element IS (IS16) gene. The most frequently detected virulence factor gene was adhesin E. faecium (efaAfm). This efaAfm adhesin gene was present in 22 E. faecium strains and even in one E. faecalis strain (EEV20, Table 2); altogether in 95.8% strains out of all tested. Only E. faecium EF/EC31 strain was absent of efaAfm gene. On the other hand, adhesin efaAfs gene was detected not only in E. faecalis strain EEV20 but also in two E. faecium strains EF20 and EF/ED21. GelE gene was present in three strains, two E. faecium (EFV10 and EF20) as well as in the strain E. faecalis EEV20 (Table 2). Regarding the strains, only one strain-E. faecium EF/EC31 was absent of virulence factor genes. E. faecium EFV10 had gelE gene and efaAfm gene; E. faecium EF/ED21 had also two virulence factor genes: efaAfm and efaAfs. Three genes (gelE, efaAfm, efaAfs) were detected in the strains E. faecium EF20 and E. faecalis EEV20. Mass spectrometry is an analytical technique in which chemical compounds are ionized into charged molecules and the ratio of their mass to charge (m/z) is measured. The development of electron spray ionization (ESI) and matrix assisted laser desorption ionization (MALDI) in 1980s increased the applicability of MS to large biological molecules like proteins. In both spectrometries, peptides are converted into ions by either addition or loss of one or more than one proton [10]. MALDI-TOF is now considered to be a real alternative for bacterial identification due to the provision of rapid and specific determination analogous to molecular sequencing techniques, with benefit of significant time and cost savings. Comparing previously identified species using phenotypization, E. faecium was predominant species [3] as was also confirmed using MALDI-TOF system here. In addition, the species E. faecalis was also identified among those strains previously. However, phenotypization also indicated the representatives of the other species such as E. casseliflavus and E. durans among those strains; this was not confirmed using MALDI-TOF MS but a higher percentage of strains identified belonged to the species E. faecium. Our experience confirmed a high identification score using MALDI-TOF MS technology associated with phenotypization not only in species E. faecium [11] but also E. faecalis [12]. High quality MALDI-TOF mass spectra were also obtained in identification of environmental bacteria [13]. E.g., Cherkaoui et al. [14] compared MALDI-TOF technology with conventional phenotypic identification of clinical bacterial strains and they found high confidence identifications for 680 isolates, of which 674 (99.1%) were correct with phenotypization. So, implementation of MS as an identification strategy would improve its efficacy in further analyses to study additional properties of strains e.g., in the framework of basic research. Only one limitation of MALDI-TOF MS technology is that the spectral database containing peptide mass fingerprints of the type strains has to be upgraded to involve new species [10, 13]. As formerly indicated, potential pathogenicity of enterococci is associated with the presence of virulence factor determinants/genes or virulence factor production. Gene IS16 is a marker specific for clinical E. faecium/E. faecalis strains associated with nosocomial infection. None of our environmental enterococci contained IS16 gene. Similarly, enterococci tested were absent of hyl (hyaluronidase) gene. Hyaluronidase acts on hyaluronic acid and increases bacterial invasion [15]; it can play a role in different inflammations in host organism, e.g., ear inflammation. It was described to be a part of a genomic island located on a plasmid and this was shown to be enriched in hospital-associated, polyclonal subpopulation of E. faecium strains [16]. Enterococcal surface protein (esp) supports adhesion of bacteria; enterococci tested were also absent of esp gene. Similarly, Kubašová et al. [9] described no occurrence or only rare occurrence of those genes in faecal canine enterococci. In addition, faecal rabbits' enterococci from Pannon White breed of rabbits were free of hylefm and IS16 genes [12]. On the other hand, the most frequently detected determinants were those encoding adhesin efaAfm (95.8%) which is again similar as reported in canine enterococci by Kubašová et al. [9]. This is also in association with the most frequently detected species E. faecium in our study because adhesin efaAfm is typical for E. faecium species [17]. Cyl A, the cytolysin activator (bacterial toxin with hemolytic activity against eukaryotic cells encoded by cylA gene [18]; it can even induce tissue damage. Also this cylA gene was not present in tested enterococci. Although our strains were not tested to form a biofilm, we would be interested in further parameters because these factors not only participate in invasion and colonization of host but may also contribute to biofilm formation [19]. Gelatinase, extracellular metalloprotease is able to hydrolyze gelatin, collagen and hemoglobin, which has contributed to bacterial adherence and biofilm formation [20]. Occurrence of virulence factor determinants can be influenced with a source of tested strain or also with a species; that is, Eaton and Gasson [17] reported that E. faecium strains and E.faecalis showed significantly different patterns in the incidence of virulence determinants. Abouelnaga et al. [21] found three strains out of 88 from fermented food free from virulence determinants, and 16% strains from unfermented food were free of virulence factor determinants. Because enterococci tested were mostly absent of virulence factor determinants such as cylA gene, IS16 element, hylefm gene esp gene and rare in efaAfs, gelE gene detection; it can be concluded that they are not invasive which is very important from safety aspect. It can be supposed that their occurrence in environment did not represent health risk. However, here no antibiotic profile was shown; but resulting from previous studies, they were mostly susceptible to antimicrobials (bacteriocins) [22].

4. Conclusion

To conclude from our results, prevalence of the species E. faecium was detected in cow's dung water (sewage sludge from samples in Eastern Slovakia) with few species of E. faecalis. Detected strains were, however, mostly absent virulence factor determinants. This indicates that they did not present invasive character and pathogenicity in environment and host regarding safety aspect. Of course, other studies are underway. Moreover, this study is also a contribution to the basic knowledge regarding the environmental enterococci.
  17 in total

1.  Comparison of two matrix-assisted laser desorption ionization-time of flight mass spectrometry methods with conventional phenotypic identification for routine identification of bacteria to the species level.

Authors:  Abdessalam Cherkaoui; Jonathan Hibbs; Stéphane Emonet; Manuela Tangomo; Myriam Girard; Patrice Francois; Jacques Schrenzel
Journal:  J Clin Microbiol       Date:  2010-02-17       Impact factor: 5.948

2.  Comparison of direct colony method versus extraction method for identification of gram-positive cocci by use of Bruker Biotyper matrix-assisted laser desorption ionization-time of flight mass spectrometry.

Authors:  Adnan A Alatoom; Scott A Cunningham; Sherry M Ihde; Jayawant Mandrekar; Robin Patel
Journal:  J Clin Microbiol       Date:  2011-05-25       Impact factor: 5.948

3.  Bacterial community structure in treated sewage sludge with mesophilic and thermophilic anaerobic digestion.

Authors:  Hana Stiborova; Jan Wolfram; Katerina Demnerova; Tomas Macek; Ondrej Uhlik
Journal:  Folia Microbiol (Praha)       Date:  2015-04-30       Impact factor: 2.099

4.  Correlation between biofilm formation and gelE, esp, and agg genes in Enterococcus spp. clinical isolates.

Authors:  Renata O Soares; Ana Cláudia Fedi; Keli C Reiter; Juliana Caierão; Pedro A d'Azevedo
Journal:  Virulence       Date:  2014-04-29       Impact factor: 5.882

5.  A multiresistance megaplasmid pLG1 bearing a hylEfm genomic island in hospital Enterococcus faecium isolates.

Authors:  Jenny A Laverde Gomez; Willem van Schaik; Ana R Freitas; Teresa M Coque; Keith E Weaver; Maria Victoria Francia; Wolfgang Witte; Guido Werner
Journal:  Int J Med Microbiol       Date:  2010-10-15       Impact factor: 3.473

6.  Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates.

Authors:  T J Eaton; M J Gasson
Journal:  Appl Environ Microbiol       Date:  2001-04       Impact factor: 4.792

Review 7.  Virulence factors of Enterococcus faecalis: relationship to endodontic disease.

Authors:  Güven Kayaoglu; Dag Ørstavik
Journal:  Crit Rev Oral Biol Med       Date:  2004-09-01

8.  Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium.

Authors:  Vanessa Vankerckhoven; Tim Van Autgaerden; Carl Vael; Christine Lammens; Sabine Chapelle; Rosaria Rossi; Daniela Jabes; Herman Goossens
Journal:  J Clin Microbiol       Date:  2004-10       Impact factor: 5.948

9.  Presumptive fecal streptococci in environmental samples characterized by one-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

Authors:  R M Niemi; S I Niemelä; D H Bamford; J Hantula; T Hyvärinen; T Forsten; A Raateland
Journal:  Appl Environ Microbiol       Date:  1993-07       Impact factor: 4.792

Review 10.  MALDI-TOF mass spectrometry: an emerging technology for microbial identification and diagnosis.

Authors:  Neelja Singhal; Manish Kumar; Pawan K Kanaujia; Jugsharan S Virdi
Journal:  Front Microbiol       Date:  2015-08-05       Impact factor: 5.640

View more
  1 in total

1.  Slovak Local Ewe's Milk Lump Cheese, a Source of Beneficial Enterococcus durans Strain.

Authors:  Andrea Lauková; Martin Tomáška; Vladimír Kmeť; Viola Strompfová; Monika Pogány Simonová; Emília Dvorožňáková
Journal:  Foods       Date:  2021-12-13
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.