Literature DB >> 31635074

Vitamins D and E Stimulate the PI3K-AKT Signalling Pathway in Insulin-Resistant SK-N-SH Neuronal Cells.

Amirah Salwani Zaulkffali1, Nurliyana Najwa Md Razip2, Sharifah Sakinah Syed Alwi3, Afifah Abd Jalil4, Mohd Sokhini Abd Mutalib5, Banulata Gopalsamy6, Sui Kiat Chang7, Zaida Zainal8, Nafissa Nadia Ibrahim9, Zainul Amiruddin Zakaria10, Huzwah Khaza'ai11.   

Abstract

This study investigated the effects of vitamins D and E on an insulin-resistant model and hypothesized that this treatment would reverse the effects of Alzheimer's disease (AD) and improves insulin signalling. An insulin-resistant model was induced in SK-N-SH neuronal cells with a treatment of 250 nM insulin and re-challenged with 100 nM at two different incubation time (16 h and 24 h). The effects of vitamin D (10 and 20 ng/mL), vitamin E in the form of tocotrienol-rich fraction (TRF) (200 ng/mL) and the combination of vitamins D and E on insulin signalling markers (IR, PI3K, GLUT3, GLUT4, and p-AKT), glucose uptake and AD markers (GSK3β and TAU) were determined using quantitative real-time polymerase chain reaction (qRT-PCR) and enzyme-linked immunosorbent assay (ELISA). The results demonstrated an improvement of the insulin signalling pathway upon treatment with vitamin D alone, with significant increases in IR, PI3K, GLUT3, GLUT4 expression levels, as well as AKT phosphorylation and glucose uptake, while GSK3β and TAU expression levels was decreased significantly. On the contrary, vitamin E alone, increased p-AKT, reduced the ROS as well as GSK3β and TAU but had no effect on the insulin signalling expression levels. The combination of vitamins D and E only showed significant increase in GLUT4, p-AKT, reduced ROS as well as GSK3β and TAU. Thus, the universal role of vitamin D, E alone and in combinations could be the potential nutritional agents in restoring the sensitivity of neuronal cells towards insulin and delaying the pathophysiological progression of AD.

Entities:  

Keywords:  SK-N-SH neuronal cells; glucose uptake; insulin resistance; vitamin D; vitamin E

Mesh:

Substances:

Year:  2019        PMID: 31635074      PMCID: PMC6836113          DOI: 10.3390/nu11102525

Source DB:  PubMed          Journal:  Nutrients        ISSN: 2072-6643            Impact factor:   5.717


1. Introduction

Insulin resistance and neuronal dysfunction are strongly correlated with Alzheimer’s disease (AD), as demonstrated by the Rotterdam study [1]. A dramatic increase in the worldwide incidence of diabetes is directly proportional to age. Moreover, age is a risk factor associated with diabetes and neurodegenerative diseases such as AD [2]. Post-mortem analysis of brains revealed that the molecular, biochemical, and signal transduction abnormalities in AD are identical to those that occur in type 1 diabetes mellitus (T1DM) and type 2 diabetes mellitus (T2DM) [2,3]. Decreased cerebrospinal fluid (CSF) insulin levels and reduced insulin-mediated glucose disposal were observed in AD patients compared to those observed in healthy subjects [4]. A cascade of reactions initiated by the reduced sensitivity of cells to insulin resulted in the reduced insulin level in the brain of AD patients. Reduced sensitivity to insulin can result in hyperinsulinaemia, which consequently downregulates the insulin receptors at the blood-brain barrier, impairing insulin signalling and reducing the uptake of insulin by brain cells. These events later manifest as brain inflammation, oxidative stress, alterations in beta-amyloid (Aβ) levels, and cell death [5]. Insulin resistance in brain is also named as ‘type 3 diabetes’ [6]. Since insulin resistance can be a component of AD pathogenesis, it could be a potent accelerator of AD. There are numerous aetiologies for insulin resistance, including lipotoxicity, inflammation, oxidative stress and hyperinsulinaemia [7]. Hyperinsulinaemia contributes to insulin resistance, and its effects on peripheral tissues, such as skeletal muscle, liver, and adipose tissue, have been demonstrated [8]. The involvement of neurons in brain insulin resistance is relatively unclear, since little is known about its molecular mechanism. The role of vitamins D and E in the pathogenesis and prevention of diabetes has generated enormous scientific interest. The association between vitamin D status and the risk of diabetes or glucose intolerance has been known since the early 1990s [9]. It has been shown that the prevalence of hypovitaminosis D is higher in diabetic patients than in non-diabetic people [10,11,12]. Indeed, vitamin D improves insulin resistance and T2DM by affecting insulin sensitivity, β-cell function or both [13,14]. Vitamin D may modulate insulin sensitivity because a functional vitamin D receptor (VDR) element has been identified in the promoter region of the insulin receptor, suggesting that vitamin D regulates insulin transcription through genomic interactions [15]. Vitamin E is a fat-soluble compound with antioxidant properties that exist in eight forms in nature (alpha-, beta-, gamma- and delta-tocopherol and alpha-, beta-, gamma- and delta- tocotrienol) each with its own biological properties [16]. The difference between tocopherol and tocotrienol is that they have different number and position of methyl groups attached to the aromatic ring [17]. Vitamin E exhibits antioxidant properties that improve the insulin signalling cascade in both in vitro and in vivo models [18,19,20]. Tocotrienol occurs at very low levels in nature, with the highest concentration found in palm oil. Currently, there is an increase of interests on tocotrienol rich fraction (TRF) from palm oil. TRF consist of 25% of alpha-tocopherol (α-TCP) and 75% of tocotrienol [16]. Hence, vitamin E in the form of tocotrienol-rich fraction (TRF) may also boost insulin sensitivity and decrease diabetes risk by quenching free radicals and simultaneously reducing oxidative stress in the body [21]. Although there are many factors that lead to the development of AD, this study focuses on insulin resistance as the causal factor that mimics AD in neuronal cells. It is anticipated that the results from this study would be useful to identify suitable remedies that help to reverse the condition of insulin resistance in AD. Therefore, this study aims to evaluate the potency of vitamins D and E in improving insulin resistance in neuronal-insulin resistance model. The potency of vitamins D and E in modulating insulin signalling cascade were assessed at the gene expression level. This study evaluates the gene expression of insulin signalling markers involved such as insulin receptor (IR), phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K), protein kinase B or (AKT), glucose transporter 3 (GLUT3) and glucose transporter 4 (GLUT4); Alzheimer’s disease (AD) markers such as glycogen synthase kinase-3 beta (GSK3β) and tau (TAU). Besides, glucose uptake was also carried out to substantiate the restoration of insulin signalling upon vitamins D and E supplementation. Finally, this study also determined the oxidative stress levels in the cells upon treatment with vitamins D and E under the condition of insulin resistance.

2. Materials and Methods

2.1. Materials

The neuroblastoma cell line, SK-N-SH (ATCC® HTB-11TM), was purchased from American Type Cell Culture (ATCC) (Manassas, VA, USA). Cell culture flasks, serological pipettes, and microplates were obtained from Techno Plastic Products (Trasadingen, Switzerland). Minimum essential medium (MEM) culture media, penicillin/streptomycin, 0.25% trypsin, foetal bovine serum (FBS) and phosphate buffer saline (PBS) were purchased from Nacalai Tesque (Kyoto, Japan). IR, PI3K, GLUT3, GLUT4, GSK3β, TAU and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers were purchased from Integrated DNA Technologies (Coralville, IA, USA). TBE buffer, TAE buffer and agarose powder were purchased from Amresco (Solon, OH, USA). Insulin and human recombinant E. coli were purchased from BioVision (San Francisco, CA, USA). 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) powder was purchased from PhytoTechnology Laboratories (Flint St, KS, USA). Dimethyl sulfoxide (DMSO) and vitamin D in the form of vitamin 1,25(OH)2D3 were purchased from Sigma Aldrich (St. Louis, MO, USA). Vitamin E in the form of tocotrienol-rich fraction (TRF) was supplied by Gold Tri E70 TRF, Sime Darby Research (Kuala Lumpur, Malaysia). The TRF content (25% α-tocopherol and 75% tocotrienols) and its purity were confirmed by our previous studies [22,23].

2.2. MTT Assay

Prior to developing an insulin resistance condition, an MTT assay was conducted to measure whether the induction with insulin induces toxicity to the cells. The function of the MTT assay is to cleave tetrazole rings in the functional mitochondria viable cells, producing insoluble dark purple formazan products. As a result, viable cells can be distinguished from dead cells. Ninety-six-well plates with a cell density of 2 × 105 cells/mL were seeded for treatment with different concentrations of insulin. Cells were harvested in trypsin-EDTA after reaching a confluence of 70–80%. After an overnight incubation to allow cell attachment, insulin was added to the culture medium at the previously prepared concentrations of 100, 150, 200 and 250 nM for 16 and 24 h. After 30 min, the cells were re-challenged with 100 nM insulin for 30 min. A control without treatment (0 nM insulin) was also included. The previous media was removed, and the wells were washed three times with 200 µL PBS. Then, 200 µL treatment solutions were pipetted into the respective wells, and 200 µL serum-free media was used as blank. Twenty microliters of MTT solution was added to each well without removing the treatment solution. The plate was thoroughly shaken to evenly mix the contents. The plate was then covered with aluminium foil to avoid light penetration and incubated for 3 to 4 h before adding DMSO. After 3 h of incubation, all solutions in the wells that contained cells were completely removed by pipetting. Then, 100 μL DMSO solution was added to each well, including the blank wells. The quantity of formazan was measured by recording the change in absorbance at 570 nm using a microplate reader (Biochrom Asys UVM 340) with a reference wavelength of 630 nm and 15 s shaking time [24].

2.3. Cell Culture and Induction of Insulin Resistance

SK-N-SH is a neuroblastoma cell line that displays epithelial morphology and grows in adherent culture. This neuronal cell line was used to model an insulin resistance condition since it expresses the components of the insulin signalling pathway [25,26,27,28,29]. Cells at 70–80% confluence were harvested with trypsin-EDTA and 2 × 105 cells were seeded in 96-well plates. After an overnight incubation, insulin was added to the culture medium beginning with the higher concentrations and progressing to the lower concentrations (100, 150, 200 and 250 nM) for 16 and 24 h. Cells were cultured in MEM supplemented with 10% FBS and antibiotics (penicillin 100 IU/ml, streptomycin 100 µg/ml) and were incubated at 37 °C and 5% CO2. Cells within three passages that were stored in liquid nitrogen were used for further experiments. The insulin resistance model was developed by different insulin concentrations in the range of 100–250 nM, as described in previous studies [28,30] with slight modifications. Briefly, serum-starved cells were incubated for 16 and 24 h at 37 °C in serum-free MEM in the absence or presence of insulin. After induction, the cells were re-challenged with 100 nM insulin in serum-free media for 30 min to determine the responsiveness of the insulin receptor.

2.4. Preparation and Treatment of Vitamins D and E in the Insulin Resistance Model

Vitamin D3 (1,25(OH)2D3) and vitamin E were prepared in a laminar flow hood to maintain sterility. Both vitamin D and vitamin E (in the form of TRF) were weighed, dissolved in 100% ethanol and dried under nitrogen gas before being diluted to the desired concentrations. After developing the insulin resistance model, the cells were supplemented with vitamin D at doses of 10 ng/mL and 20 ng/mL, vitamin E in the form of TRF at a dose of 200 ng/mL and the combination of vitamin D (10 or 20 ng/mL) and E (200 µg/mL) for 24 h at 37 °C and 5% CO2. The concentrations of vitamins D and E were chosen according to the results of previous studies by [25,31], respectively. Our previous studies demonstrated that 200 ng/mL vitamin E in the form of TRF was the optimum concentration to produce treatment effects in neuronal cells [22,23].

2.5. Quantification of Insulin Signalling and AD Markers by qRT-PCR

The expression levels of insulin signalling markers, such as IR, PI3K, GLUT3 and GLUT4, are closely related to the impairment of insulin signalling that is caused by prolonged exposure to insulin (hyperinsulin). In addition, the expression of the AD markers GSK3β and TAU were also examined to understand the link between insulin resistance and Alzheimer’s disease. The expression of all markers was quantified using real-time PCR (RT-PCR). Total RNA was isolated using a FavorPrep™ Blood/Cultured Cell Total RNA Mini Kit (Favorgen, Taiwan) according to the manufacturer’s instructions. cDNA synthesis was performed using a qPCRBIO cDNA Synthesis kit (PCR Biosystems, London, UK), following the manufacturer’s instructions. The isolated RNA was then reversed transcribed to cDNA by RT-PCR. RT-PCR was conducted using a qPCRBIO cDNA Synthesis kit purchased from PCR Biosystems (London, UK) according to the manufacturer’s instructions. The primers targeting the genes of interest in this procedure that were used in this experiment are shown in Table 1. The PCR conditions for these primers were 95 °C for 1 min and 40 cycles of 95 °C for 5 s and 60 °C for 20 s. The sequences of all primers targeting the genes of interest were synthesized by First Base (Kuala Lumpur, Malaysia), designed using the Ape software (http://biologylabs.utah.edu/jorgensen/wayned/ape/) and blasted using NCBI primer-BLAST. The housekeeping gene for all primers was glyceraldehyde-3-phosphate dehydrogenase (GAPDH); the qPCR data were normalized to the GADPH values. Three independent experiments were performed, and the quantitative data obtained were averaged based on quantification cycle (Cq) values, which were used to calculate the fold expression ratio.
Table 1

Primers for the genes of interest.

Gene of InterestForward PrimersReverse Primers
IR CAACATTCGAGGAGGCAACAATCCTCGAATCAGACGTAACTTCCGG
PI3K TGGATGCTCTACAGGGCTTTGTCTGGGTTCTCCCAATTCA
GLUT3 TCCCCTCCGCTGCTCACTATTTATCTCCATGACGCCGTCCTTTC
GLUT4 CCCTCAGAAGGTGATTGAACAGAGAGATGATACCAATGAGGAAGG
GSK3β CTAACACCACTGGAAGCTTGTGCGATGGTAGCCAGAGGTGGATTAC
TAU ACCTCCAAGTGTGGCTCATTAGGGACGTGGGTGATATTGTCCAG
GAPDH CAACTACATGGTTTACATGTTCGCCAGTGGACTCCACGAC

IR, insulin receptor; PI3K, phosphatidylinositol-4,5-bisphosphate 3-kinase; GLUT3, glucose transporter 3; GLUT4, glucose transporter 4; GSK3b, glycogen synthase kinase-3 beta; TAU, tau; and GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

2.6. Phosphorylation of AKT Assay

The phosphorylation of AKT assay was performed as described in the manual of Human Phospho-AKT Cell-Based ELISA kit (R & D Systems, Minneapolis, MN, USA). A total of 2 × 105 cells was seeded in 96-well plates. After an overnight incubation, insulin was added to the culture medium beginning with the lower concentrations and progressing to the higher concentrations (100, 150, 200 and 250 nM dissolved in serum-free media) for 16 and 24 h. A control without treatment (serum-free media without insulin) was also included. The treated SK-N-SH cells were fixed with 4% formaldehyde for 20 min at 37 °C and washed three times with 200 µL 1X wash buffer for 5 mins each with gentle shaking. Subsequently, 100 μL quenching buffer was added and incubated for 20 min. The cells were further incubated for 1 h with blocking buffer and aspirated. One hundred microliters of phospho-Tie-2 antibody mixture (1:100) was then added to each well and incubated for 16 h at 4 °C. After incubation, the wells were washed three times with 1X wash buffer followed by the addition of 100 µL HRP conjugated antibody mixture (1:100) to each well. Then, the mixtures were incubated for 2 h at room temperature. The secondary antibody mixtures were removed, and the cells were washed twice with 200 µL 1X wash buffer, followed by two washes with 200 µL 1X PBS. The contents in the wells were aspirated, and 75 µL fluorogenic substrate for HRP was added into each well and incubated for 1 h at 37 °C. The plates were protected from direct light. Finally, the plate was analysed twice using a fluorometric plate reader (FLUOstar® Omega, BMG LABTECH) at 450 nm/600 nm and 360 nm/450 nm excitation/emission wavelengths.

2.7. Glucose Uptake Assay

Glucose uptake was determined to demonstrate whether prolonged insulin treatment affects glucose transport into the cell. The glucose uptake assay was performed according to the manufacturer’s instructions as stated in the 2-D-Glucose (2-DG) Uptake Assay Kit purchased from Abnova (Taipei, Taiwan). A total of 2 × 105 cells were seeded in 96-well plates. After the successful development of cellular insulin resistance, the cells were then treated with vitamin D (10 and 20 ng/mL), vitamin E (200 ng/mL) or a combination of vitamins D and E for 24 h. After the incubation, the media from each well was removed, and the cells were washed twice with 100 µL 1X Krebs-Ringer-Phosphate-HEPES (KRPH) buffer. After washing, 90 µL glucose uptake buffer was added and incubated for 1 h at 37 °C in a 5% CO2 incubator. Subsequently, 10 µL 2-DG solution was added into each well and incubated for 4 h at 37 °C and 5% CO2. Afterwards, the solution was removed and gently washed three times with KRPH buffer to remove the remaining 2-DG from the solution. To lyse the cells, 25 µL acidic lysis buffer was added to each well, and the mixture was incubated at 37 °C for 20 min. Then, 25 µL neutralization buffer was added to each well to neutralize the cell lysate for 10 min. Finally, 50 µL 2-DG uptake mixture was added to each well and incubated at room temperature for 1 h. The results were immediately read at excitation/emission wavelengths of 570/610 nm using a fluorometric plate reader (FLUOstar® Omega, Biel/Bienne, Switzerland, BMG LABTECH).

2.8. ROS Measurement Assay

A commercially available dichlorodihydrofluorescein diacetate (DCFH-DA) dye (OxiSelect™ Intracellular ROS Assay Kit, Cell Biolabs) was used to measure the production of ROS according to the manufacturer’s instructions with slight modifications. A total of 2 × 105 cells were seeded in 96-well plates. After the successful development of cellular insulin resistance, the cells were then treated with vitamin D (10 and 20 ng/mL), vitamin E (200 ng/mL) or a combination of vitamins D and E for 24 h. The treated cells were washed gently twice with Dulbecco’s phosphate-buffered (DPBS) saline (Thermo Fisher, Waltham, MA, USA) before 200 μL DCFH-DA dye was added to the cells. Then the cells were incubated at 37 °C for 1 h washed twice with DPBS. Media (200 μL) was added to the cells, followed by 200 μL 2X cell lysis buffer; then, the lysates were incubated for 5 min. One hundred fifty microliters of lysate was then transferred to a black 96-well plate, and the fluorescence was measured using a fluorometric plate reader (FLUOstar® Omega, BMG LABTECH) at an excitation/emission wavelength of 480 nm/530 nm. The results were expressed in relative fluorescence units (RFUs) by plotting a standard curve of DCF concentration against RFU. The fluorescence intensity is proportional to the ROS levels in the cytoplasm.

2.9. Statistical Analysis

All independent experiments were conducted in triplicate. Statistical analyses were performed with one-way ANOVA followed by Dunnett’s multiple comparison test, with comparison to the control, using GraphPad Prism 5 Software for Windows (GraphPad Software, Inc., San Diego, CA, USA). All data were expressed as the mean ± SEM of three independent experiments, and significant values are expressed as * p < 0.05, ** p < 0.01 and *** p < 0.001 compared to the negative control group and # p < 0.05, ## p < 0.01 and ### p < 0.001 compared to the control group.

3. Results

3.1. Effects of Prolonged Insulin Induction on Cell Viability

The viability of SK-N-SH cells was assessed via MTT assay upon exposure to 100–250 nM insulin for either 16 or 24 h. Experimental insulin treatment concentrations were chosen to maximize the insulin induction levels while minimizing cytotoxicity. Figure 1a,b shows the insignificant increase in cell viability upon the induction of insulin (100–250 nM) for 16 and 24 h compared to the control. This result indicates that all insulin concentrations used in the current study were unable to induce cell death or cell toxicity in neuronal cells. Hence, the effects of prolonged exposure to insulin concentrations up to 250 nM were safe with no adverse effects on neuronal SK-N-SH cells.
Figure 1

Effects of prolonged insulin induction on cell viability with different concentrations (100–250 nM) in SK-N-SH cell line incubated for (a) 16 and (b) 24 h, respectively. Cell viability was measured with an MTT assay. Data were expressed as mean ± SEM of three independent experiments.

3.2. Establishment of Insulin Resistance Model in SK-N-SH Cell Line

3.2.1. Analysis of Expression of Insulin Signalling Markers

The expression of insulin signalling markers were determined to validate the insulin resistance model adopted in the current study. The most upstream gene IR was found to be significantly reduced at insulin concentrations of 200 and 250 nM upon incubation at 16 h. Further attenuation of IR was observed in cells exposed to 100–250 nM insulin for 24 h with fold ratio declined to 0.25 (Figure 2a). Collectively, all other markers in insulin signaling cascade; IR, PI3K, GLUT3, and GLUT4 were reduced significantly upon exposure to series of insulin concentrations. However, prominent and consistent attenuation of PI3K/AKT pathways was only achieved upon prolonged exposure to insulin for 24 h (Figure 2b–d). On the contrary, the expression of GSK3β increased significantly (p < 0.01) when exposed to high insulin concentration at 16 h but not at 24 h, as GSK3β activity is negatively regulated by insulin (Figure 2e).
Figure 2

Effects of prolonged insulin induction on insulin signal transduction cascade in SK-N-SH cells line. Serum deprived cells were incubated in the absence (control) or presence of insulin for 16 and 24 h, and challenged with 100 nM insulin for 30 minutes. Total RNAs were prepared and subjected to reverse transcriptase. The resulting cDNAs were used to perform Real-time PCR as described in Section 2.5 using specific primers for (a) IR; (b) PI3K; (c) GLUT3; (d) GLUT4 and (e) GSK3β. GAPDH was used to normalize the expression level. Data were expressed as mean ± SEM of three independent experiments. Significant values were expressed as * p < 0.05, ** p < 0.01 and *** p < 0.001 compared to the negative control group.

3.2.2. Phosphorylation of AKT in Insulin-Resistant Cells

Figure 3 shows that the level of AKT phosphorylation decreased signficantly (p < 0.05 and p < 0.01) in 16 and 24 h at 100–250 nM. At 16 h exposure, the highest reduction is achieved at 100 nM by 0.3 fold ratio. Similar signficant reduction (p < 0.05 and p < 0.01) was observed at 24 h exposure with all concentrations of insulin. Highest reduction by 0.5 fold ratio was achieved at 150 nM.
Figure 3

Effects of prolonged insulin induction with 100–250 nM concentrations on protein kinase B (AKT) phosphorylation. (a) A relative (p)-AKT phosphorylation was measured using Phospho-AKT Immunoassay ELISA at 16 h of exposure with insulin; while (b) at 24 h and both were re-challenged with 30 min induction. Relative p-AKT levels were normalized to total AKT and are shown as fold increase over control (0 nM of insulin). All data were expressed as mean ± SEM of three independent experiments. Significant values were expressed as * p < 0.05 and ** p < 0.01 compared to the negative control group.

3.2.3. Glucose Uptake in Insulin-Resistant Cells

The 2-DG uptake was reduced at all levels of insulin concentration (Figure 4) as compared to control. At 16 h exposure, 2-DG uptake was significantly decreased (p < 0.05) by 20% at 150–250 nM compared to control. At 24 h, the uptake of 2-DG decreased significantly (p < 0.05) by 20% at 100–250 nM. No marked changes between 16 and 24 h were observed, suggesting that exposure time has less influence on stimulating glucose uptake.
Figure 4

Effects of insulin exposure at 150–250 nM concentrations on 2-D-Glucose (2-DG) uptake after incubation at 16 and 24 h. The cells were subjected to prolonged exposure at 16 and 24 h with re-challenged for 30 min. The induced groups were compared with the control group (0 nM of insulin). Results were expressed as mean ± SEM of three independent experiments. Significant values were expressed as * p < 0.05 compared to the negative control group.

3.3. Expression of Insulin Signalling Markers upon Treatment with Vitamins D and E

Figure 5a–d show the relative transcriptional profiles of the key genes involved in insulin signalling upon intervention with vitamins D and E in insulin-resistant neuroblastoma SK-N-SH cell lines. High concentrations of insulin (250 nM) induced chronic insulin resistance in cells. This insulin resistance led to significant deterioration of insulin signalling markers IR, PI3K, GLUT3 and GLUT4 (p < 0.01). Supplementation with vitamin D significantly increased the expression of IR, PI3K, and GLUT3 (p < 0.05) by 2 fold ratio compared to the negative control (Figure 5a–c). On the other hand, the combination of both vitamins did not improve the expression of IR and PI3K as well as treatment with vitamin E alone (Figure 5a,b). The expression levels of both GLUT3 and GLUT4 increased significantly (p < 0.05) to ~2 and ~1 fold ratio, respectively after treatment with vitamin D and the combination of both vitamins D and E (Figure 5c,d). Treatment with vitamin E alone did not increase the expression levels of GLUT3 and GLUT4 (Figure 5c,d).
Figure 5

Gene expression levels of (a) IR (b) PI3K (c) GLUT3 and (d) GLUT4 after treatment with vitamins D and E at different concentrations. Red bar represents the expression level upon induction with 250 nM insulin for 16 h. White bar represents the expression level treated with vitamins D and E for 24 h after induced with 250 nM insulin. Relative expression of IR, PI3K, GLUT3, and GLUT4 were normalized with GAPDH. Data were expressed as mean ± SEM of three independent experiments. Significant values were expressed as * p < 0.05, ** p < 0.01, *** p < 0.001 compared to the negative control group and # p < 0.05, ## p < 0.01, ### p < 0.001 compared to the control group.

3.4. Phosphorylation of AKT

Vitamin D (10 and 20 ng/mL), vitamin E and the combination of vitamins D and E increased AKT phosphorylation level significantly (p < 0.05) compared to the negative control (Figure 6) after 16 h induction of chronic insulin resistance. The AKT phosphorylation level was increased by 1-fold after treatment with vitamin D, vitamin E and a combination of both vitamins (Figure 6).
Figure 6

AKT phosphorylation level in insulin-resistant cells upon treatment with various concentrations of vitamins D and E. Red bar represents AKT phosphorylation level upon induction with 250 nM insulin for 16 h. White bar represents AKT phosphorylation level upon treated with vitamins D and E for 24 h after induced with 250 nM insulin. Relative p-AKT phosphorylation levels were normalized to total AKT and were expressed as fold increase over control. Data were expressed as mean ± SEM of three independent experiments. Significant values were expressed as * p < 0.05 compared to the negative control group and ## p < 0.01 compared to the control group.

3.5. Glucose Uptake Assay

The induction of chronic insulin resistance impaired the uptake of 2-DG significantly (p < 0.001) compared to control (Figure 7). However, treatment with 10 and 20 ng/mL of vitamin D significantly increased 2-DG uptake by 17% (p < 0.01). Treatment with vitamin E alone significantly increased 2-DG uptake by 12% (p < 0.05). Additionally, the combination of both vitamins D (10 and 20 ng/mL) and E, increased the 2-DG uptake by 18% (p < 0.01).
Figure 7

2-DG uptake level in insulin-resistant cells upon treatment with various concentrations of vitamins D and E. Red bar represents the 2-DG uptake level upon induction with 250 nM insulin for 16 h. White bar represents the 2-DG uptake level upon treatment with vitamins D and E for 24 h after induced with 250 nM insulin. Data were expressed as mean ± SEM of three independent experiments. Significant values were expressed as * p < 0.05, ** p < 0.01 compared to the negative control group and ### p < 0.001 compared to the control group.

3.6. ROS Assay

The production of ROS was significantly (p < 0.001) increased upon induction with 250 nM insulin (Figure 8). The presence of vitamin D, vitamin E and their combinations significantly reduced ROS production (p < 0.001) compared to the negative control. Upon treating the cells with 10 and 20 ng/mL vitamin D, the ROS production level was significantly reduced (p < 0.001) by 32.2 and 30.5%, respectively. Compared to the control, treatment with 200 ng/mL vitamin E alone showed a reduction of 37.6% (p < 0.01). Additionally, vitamins D (10 and 20 ng/mL) combined with vitamin E reduced the production of ROS by 46.5% (p < 0.001) and 27.4% (p < 0.01), respectively (Figure 8).
Figure 8

Reactive Oxygen Species (ROS) production level in insulin resistance model to determine the antioxidant potential. Red bar represents the ROS production level upon induction with 250 nM insulin for 16 h. White bar represents the ROS production level after treated with vitamin D and E for 24 h after induced with 250 nM insulin. Data were expressed as mean ± SEM of three independent experiments. Significant values were expressed as *** p < 0.001 compared to the negative control group and ### p < 0.001 compared to the control group.

3.7. Gene Expression of AD Markers

In order to determine the modulation of vitamins D and E on glycogen kinase activity and the pathogenesis of AD, the relative gene expression of GSK3β and TAU in the neuronal cells treated with various concentrations of vitamins D and E as well as the combination of both vitamins was determined. Treatment with vitamin D (10 ng/mL and 20 ng/mL) reduced the GSK3β expression level by 1.5- and 2-fold, respectively, compared to the negative control (Figure 9a). Treatment with vitamin E (200 ng/mL) and the combination of both vitamins also significantly reduced the expression level of GSK3β (p < 0.001) by almost 2-fold (Figure 9a). Treatment with vitamin D (10 and 20 ng/mL) and a combination of both vitamins significantly reduced the TAU expression level (p < 0.001) by almost 1-fold compared to the negative control (Figure 9b). Moreover, treatment with 200 ng/mL vitamin E significantly (p < 0.001) reduced the TAU expression level by 1-fold compared to the negative control (Figure 9b).
Figure 9

(a) GSK3β and (b) TAU expressions level in insulin-resistant cells upon treatment with various concentrations of vitamins D and E. Red bar represents expression level upon induction with 250 nM insulin for 16 h. White bar represents expression level treated with vitamins D and E for 24 h after induced with 250 nM insulin. Relative GSK3β and TAU expressions were normalized to GAPDH. Data were expressed as mean ± SEM of three independent experiments. Significant values were expressed as ** p < 0.01, *** p < 0.001 compared to the negative control group and ### p < 0.001 compared to the control group.

4. Discussions

The insulin-independent glucose uptake of the brain led to the belief that the brain is an insulin-insensitive organ that uses the hypothalamus as a critical regulator of insulin action [32]. Therefore, little attention has been given to brain-insulin signalling in the past. Previously, the hyperinsulin-induced decrease in cellular insulin activity has been reported in myocytes and adipocytes as well as in the nervous system, which in turn causes insulin resistance [28,33,34]. Today, it is clear that insulin is involved in many functions and signalling pathways in the brain. Recent studies indicate that AD and dementia are related to insulin impairment, which has a profound association with cognitive disorders. Insulin signalling dysregulation wreaks havoc primarily by impacting other mediator proteins [35]. To identify suitable agents that are useful in the alleviation of the condition of insulin resistance, the in vitro model of 250 nM insulin treatment for 16 h and re-challenged with 100 nM insulin in 30 min that mimics the state of insulin resistance and reflects the pathophysiological progression of the AD condition was adopted in this study. Our results showed that induction with hyperinsulin did not result in any harmful effect in the neuronal cells. Another study reported similar findings whereby induction with 1 μM insulin did not elicit any cytotoxic effects but promoted the growth of SH-SY-5Y neuronal cells [36]. Despite promoting growth, prolonged exposure to high insulin concentrations in this cell line has shown to induce insulin resistance [37]. More importantly, Pandini et al. [38] confirmed the presence of insulin markers in SK-N-SH neuronal cells and hence, attribute to the successful induction of insulin resistance model in this study. Insulin mediates its action through the insulin receptor substrate family. To develop a chronic insulin model, the concentration of 250 nM insulin was used to treat SK-N-SH cell lines for 16 h, and then the cells were re-challenged with insulin (100 nM) for 30 min as depicted in Figure 10. The compensation of chronic insulin causes the binding site of insulin receptors to become imbalanced, conferring the significant downregulation of the insulin signalling molecules IR, PI3K, GLUT3 and GLUT4, as determined by the gene expression analysis (Figure 2a–d). Other studies indicate that prolonged exposure to high insulin concentrations increased IR degradation, which further dampened the insulin response [37]. and subsequently caused IR desensitization. The expression of phosphorylated AKT and PI3K are used as indicators of insulin activation in the PI3K/AKT pathway. PI3K plays a key role in insulin-stimulated glucose uptake in insulin-responsive tissues and was able to show whether chronic presence of insulin has any inhibitory effect after insulin challenge at different time points [28]. The level of PI3K expression in the current study was also decreased as a consequence of the reduction in IR expression after treatment with the high insulin concentration. Since AKT exerts its effect following PI3K activation, the decrease in PI3K expression leads to the reduction of AKT phosphorylation [39]. In the present study, induction with 100 nM insulin readily decreased AKT phosphorylation. Although 100 nM insulin was the lowest concentration adopted in this study, concentration as low as 5 nM have been observed to deplete insulin signalling in peripheral cells [40,41]. It has been shown that neuronal cell lines have a greater tolerance to the effects of hyperinsulin than do peripheral cells. Previous work on various neuronal cells also re-challenged cells with 100 nM insulin to determine the responsiveness of insulin resistance [28,42].
Figure 10

Continuous impaired insulin signalling causes the activation of AD markers (GSK3β and TAU genes), thus increasing the amyloid beta aggregations leading to AD. Current study reports the role of vitamin D, E and the combinations of vitamins D and E in restoring insulin signalling to normal physiological condition by downregulating GSK3β and TAU genes, eventually reducing the risk of AD.

Decreased AKT phosphorylation inhibits the insulin-stimulated glucose transporter GLUT4. Although GLUT4 is a glucose transporter in peripheral tissues, its expression has also been reported in the brain [30]. High insulin levels promote a reduction in the activity of the insulin signalling cascade and consequently reduces GLUT4 translocation and/or expression [43]. Similar effects were also observed in SK-N-SH cells; the GLUT4 expression levels were decreased after 16 and 24 h of insulin treatment (Figure 2d), resulting from the reduction in AKT phosphorylation. A reduction of GLUT4 expression is related to the development of insulin resistance, since transgenic mice lacking GLUT4 were shown to have insulin insensitivity [44]. GLUT3 is considered the main glucose transporter in the brain. Although some studies demonstrated that GLUT3 translocation is not sensitive to insulin stimulation, there is a study demonstrating that insulin regulates neuronal glucose uptake by promoting the translocation of GLUT3 to the plasma membrane, suggesting that GLUT3 might be involved in the insulin signalling cascade via the activation of PI3K/AKT pathway [45]. Although GLUT3 has been reported to be insulin-independent, this mechanism only occurs in the brain as an endogenous protective mechanism against hypoglycaemia [46]. In parallel with our results, the GLUT3 expression level in SK-N-SH neuronal cells was decreased (Figure 2c) as a consequence of the decrease in IR expression that led to the attenuation of the PI3K/AKT signalling pathway. In this study, 10 and 20 ng/mL of vitamin D were able to upregulate IR, and hence, preserve insulin sensitivity similar to the negative control. Similarly, vitamin D is able to restore the function of PI3K, GLUT3, and GLUT4 up to 50%. As suggested by previous studies, vitamin D upregulates GLUT3 in the brainstem [47], where high glucose induces GLUT4 translocation in 3T3L1 adipocytes [31]. Our findings indicate that vitamin D exhibits a high potency in the regulation of glucose homeostasis by improving the downstream key insulin signalling molecules and reversing hyperinsulinaemia [48]. This treatment effect occurs because the promoter region of the insulin receptor gene that regulates insulin receptor expression is adjacent to the vitamin D response element (VDRE), which is activated upon binding with the vitamin D receptor (VDR)-retinoic acid X-receptor (RXR) complex [49,50]. Besides, vitamin D has also been shown to regulate AMP-activated protein kinase (AMPK)-calmodulin, AKT or Notch signalling, which is responsible for the indirect effects in reducing intracellular oxidative stress. This explanation highlights the role of vitamin D by activating Ca2+/AMPK pathway, leading to glucose-sensing outcomes [51]. Thus, vitamin D has a rather direct effect on the insulin signalling cascade pathway. Additionally, vitamin D is also associated with the decreased production of advanced glycated end product (RAGE) receptors in hepatocytes, which is an oxidative stress marker that is closely associated with the pathogenesis of diabetes [52]. A study using hippocampal neurons HN9.10e demonstrates that vitamin D is responsible for the differentiation of hippocampal neurons that is regulated by VDR in nuclear microdomain [53]. In relation to previous findings, the presence of vitamin D receptors (VDRs) at hippocampus improved the glucose tolerance in high fat diet-induced rats [54]. It shows that VDRs in the neuronal cells could stimulate the PI3K/AKT signalling pathway to improve insulin sensitivity towards the cells in the presence of vitamin D, thus, modulates glucose homeostasis. Collectively, VDRs and vitamin D binding protein (DBP) have been detected in cerebrospinal fluid [55], macrophages, neurons and microglial in various in vivo and in vitro models [56]. In contrast, vitamin E did not show any significant improvement in restoring the sensitivity of any of the insulin signalling markers. However, the combination of vitamins D and E showed similar GLUT4 expression levels compared to the group treated with vitamin D alone. This observation suggests the effectiveness of vitamin D in improving the immediate insulin signalling of neuronal cells. Thus, vitamin D could possibly act as a potential nutritional therapy that might be involved in stimulating PI3K-AKT signalling in insulin resistance, sensitizing the neuronal cells to downregulate the AD-like markers, particularly GSK3β and TAU gene expression. The hypothetical evidence of insulin signalling dysregulation affecting hyper-phosphorylated AD markers by treating the hyperinsulin SK-N-SH cells with vitamins D and E was also validated. The chronic insulin resistance model shows significant suppression of AKT phosphorylation, suggesting the impairment of proteins in insulin signalling cascade pathways [57]. Clearly, the effect of vitamins D and E on increasing AKT phosphorylation has a high potency to restore insulin sensitization similar to the negative control (Figure 4). Previous research demonstrated that vitamin D increased the AKT phosphorylation cascade in apoptotic osteoblasts, which reduced caspase-3, an inflammatory cytokine [58]. A previous report also demonstrated that vitamin D suppressed cyclooxygenase-2 expression in response to inflammation in macrophages via the activation of AKT phosphorylation [59]. The binding of insulin to its receptor activates a phosphorylation cascade leading to the inhibition of GSK3β. When the activity of insulin signalling is disturbed, hyperphosphorylation of GSK3β occurs, which later causes an increase in TAU expression, a marker of AD [60]. In the present study, the decrease in insulin signalling markers was correlated with an increase in GSK3β and TAU expression levels. Not only does inhibiting insulin signalling cause an increase in GSK3β activation, but oxidative stress can also induce an increase in GSK3β expression [61,62]. Consistent with the above findings, GSK3β and TAU expression levels increased along with an increase in ROS production. The over-activation of GSK3β causes beta amyloid plaque aggregation, enhancing apoptosis and leading to neuronal loss in AD [61]. Interestingly, the increase in GSK3β and TAU expression upon insulin induction was reduced to normal levels with the treatment of both vitamins D and E. The antioxidant properties exhibited by vitamins D and E can potentially explain the reduction in both markers. Vitamin E, in the form of tocopherol and tocotrienol, acts as an exogenous antioxidant to sustain the redox balance by the compensation of endogenous antioxidants inside the body [63]. Our results have clearly demonstrated that vitamin E in the form of TRF significantly downregulates ROS production after the induction of chronic insulin resistance, even though it did not exert any significant effect on the insulin signalling molecules. Tocotrienols exhibit good neuroprotective, radio-protective, anticancer, anti-inflammatory and lipid-lowering properties [23,64]. Chronic insulin resistance increases ROS production, leading to oxidative stress, mitochondrial dysfunction and activation of inflammatory cytokines. Oxidative stress inhibits the phosphorylation of insulin receptor substrate, leading to the inhibition of PI3K cascades signaling [65]. Similarly, vitamin E-treated L6 myotubes induced with insulin-stimulated hydrogen peroxide exhibited reduced ROS production [66]. Mechanistically, vitamin E acts as a protective agent to quench free radicals in cells leading to normalization of glucose uptake function of cells, preventing chain-breaking antioxidant properties. This reduces the activity of the endogenous antioxidant enzymes, such as catalase and superoxide dismutase, which plays more important roles in the endogenous antioxidant defense of human body [67]. However, the combination of both vitamins did not show a greater improvement in the insulin signalling cascade than treatment with vitamin D alone. It has been reported that the presence of more than one fat-soluble vitamin (at large doses) at one time may reduce the uptake of other fat-soluble vitamins by approximately 10 to 50% due to competition in the absorption across the intestinal endothelial cells [24]. Thus, to maximize the potency of vitamins D and E in improving the insulin signalling cascade and reducing ROS production, respectively, both vitamins can be given separately with a time gap at different concentrations. The results from this study present a unique opportunity for the prevention of ‘type 3 diabetes’, which is insulin resistance in the brain and the nervous system [6,68]. The results suggest that this validated in vitro model of hyperinsulinaemia in neuronal cells could be a simple, quick and physiologically-relevant model to study the complications of ‘type 3 diabetes’. However, in vitro studies are inadequate to ascertain in vivo mechanisms. Hence, in vivo studies should be conducted in the future. In light of the growing reports of the pervasiveness of insulin abnormalities in AD, there is an urgent need to search for therapeutic agents in AD. Thus, both vitamins D and E could be possible therapeutic agents that show great efficacy in improving neuronal insulin resistance and AD.

5. Conclusions

Treatment with vitamin D might improve the insulin signalling cascade by increasing all insulin signalling markers, which, in turn, increased glucose uptake that could reduce the risk of type 3 diabetes. However, vitamin E and the combination of vitamins D and E were not as effective as in improving insulin signalling compared to vitamin D alone. In addition, treatment with vitamins D and E reduced the production of ROS, where the expression of GSK3β was reduced to normal levels, leading to the normal expression of TAU. Collectively, vitamin E alone reduces oxidative stress that occurs during insulin resistance, as well as AD markers of GSK3β and TAU. These findings suggest a therapeutic role of vitamins D and E in managing the neurological disorders associated with diabetes since vitamin D increased the activity of IR, improving the insulin signalling cascade.
  66 in total

1.  Peripheral insulin-sensitizer drug metformin ameliorates neuronal insulin resistance and Alzheimer's-like changes.

Authors:  Amit Gupta; Bharti Bisht; Chinmoy Sankar Dey
Journal:  Neuropharmacology       Date:  2011-01-26       Impact factor: 5.250

2.  Association of diabetes mellitus and dementia: the Rotterdam Study.

Authors:  A Ott; R P Stolk; A Hofman; F van Harskamp; D E Grobbee; M M Breteler
Journal:  Diabetologia       Date:  1996-11       Impact factor: 10.122

Review 3.  Does vitamin D play a role in autoimmune endocrine disorders? A proof of concept.

Authors:  Barbara Altieri; Giovanna Muscogiuri; Luigi Barrea; Chantal Mathieu; Carla V Vallone; Luca Mascitelli; Giorgia Bizzaro; Vincenzo M Altieri; Giacomo Tirabassi; Giancarlo Balercia; Silvia Savastano; Nicola Bizzaro; Cristina L Ronchi; Annamaria Colao; Alfredo Pontecorvi; Silvia Della Casa
Journal:  Rev Endocr Metab Disord       Date:  2017-09       Impact factor: 6.514

4.  Vitamin D up-regulates glucose transporter 4 (GLUT4) translocation and glucose utilization mediated by cystathionine-γ-lyase (CSE) activation and H2S formation in 3T3L1 adipocytes.

Authors:  Prasenjit Manna; Sushil K Jain
Journal:  J Biol Chem       Date:  2012-10-16       Impact factor: 5.157

5.  Hypovitaminosis D is associated with insulin resistance and beta cell dysfunction.

Authors:  Ken C Chiu; Audrey Chu; Vay Liang W Go; Mohammed F Saad
Journal:  Am J Clin Nutr       Date:  2004-05       Impact factor: 7.045

6.  Insulin and leptin induce Glut4 plasma membrane translocation and glucose uptake in a human neuronal cell line by a phosphatidylinositol 3-kinase- dependent mechanism.

Authors:  Yacir Benomar; Nadia Naour; Alain Aubourg; Virginie Bailleux; Arieh Gertler; Jean Djiane; Michèle Guerre-Millo; Mohammed Taouis
Journal:  Endocrinology       Date:  2006-02-23       Impact factor: 4.736

Review 7.  Brain insulin resistance and deficiency as therapeutic targets in Alzheimer's disease.

Authors:  Suzanne M de la Monte
Journal:  Curr Alzheimer Res       Date:  2012-01       Impact factor: 3.498

8.  Role of vitamin D on the expression of glucose transporters in L6 myotubes.

Authors:  Bubblu Tamilselvan; Krishna G Seshadri; Ganesh Venkatraman
Journal:  Indian J Endocrinol Metab       Date:  2013-10

Review 9.  Changes in insulin and insulin signaling in Alzheimer's disease: cause or consequence?

Authors:  Molly Stanley; Shannon L Macauley; David M Holtzman
Journal:  J Exp Med       Date:  2016-07-18       Impact factor: 14.307

10.  Vitamin D Supplementation Reduces Both Oxidative DNA Damage and Insulin Resistance in the Elderly with Metabolic Disorders.

Authors:  Sylwia Wenclewska; Izabela Szymczak-Pajor; Józef Drzewoski; Mariusz Bunk; Agnieszka Śliwińska
Journal:  Int J Mol Sci       Date:  2019-06-13       Impact factor: 5.923

View more
  10 in total

1.  Neuroprotective Effect and Possible Mechanisms of Berberine in Diabetes-Related Cognitive Impairment: A Systematic Review and Meta-Analysis of Animal Studies.

Authors:  Yanwei Hao; Jiaxin Li; Shengnan Yue; Shaofeng Wang; Shuangyuan Hu; Bin Li
Journal:  Front Pharmacol       Date:  2022-06-06       Impact factor: 5.988

2.  Effects of 4- and 6-h Time-Restricted Feeding on Weight and Cardiometabolic Health: A Randomized Controlled Trial in Adults with Obesity.

Authors:  Sofia Cienfuegos; Kelsey Gabel; Faiza Kalam; Mark Ezpeleta; Eric Wiseman; Vasiliki Pavlou; Shuhao Lin; Manoela Lima Oliveira; Krista A Varady
Journal:  Cell Metab       Date:  2020-07-15       Impact factor: 31.373

3.  Healing Properties of Epidermal Growth Factor and Tocotrienol-Rich Fraction in Deep Partial-Thickness Experimental Burn Wounds.

Authors:  Hui-Fang Guo; Roslida Abd Hamid; Razana Mohd Ali; Sui Kiat Chang; Mohammed Habibur Rahman; Zaida Zainal; Huzwah Khaza'ai
Journal:  Antioxidants (Basel)       Date:  2020-02-03

4.  Analysis of expression of vitamin E-binding proteins in H2O2 induced SK-N-SH neuronal cells supplemented with α-tocopherol and tocotrienol-rich fraction.

Authors:  Aishatu Ali Chiroma; Huzwah Khaza'ai; Roslida Abd Hamid; Sui Kiat Chang; Zainul Amiruddin Zakaria; Zaida Zainal
Journal:  PLoS One       Date:  2020-11-24       Impact factor: 3.240

Review 5.  Time-Restricted Eating and Metabolic Syndrome: Current Status and Future Perspectives.

Authors:  Iwona Świątkiewicz; Alina Woźniak; Pam R Taub
Journal:  Nutrients       Date:  2021-01-14       Impact factor: 5.717

6.  Association of vitamin D receptor gene TaqI polymorphism with Alzheimer's disease in a Southeastern European Caucasian population.

Authors:  Efthimios Dimitrakis; Martha-Spyridoula Katsarou; Maria Lagiou; Vasiliki Papastefanopoulou; Evangelia Stanitsa; Demetrios A Spandidos; Aristidis Tsatsakis; Socratis Papageorgiou; Paraskevi Moutsatsou; Katerina Antoniou; Christos Kroupis; Nikolaos Drakoulis
Journal:  Exp Ther Med       Date:  2022-03-22       Impact factor: 2.447

Review 7.  Mechanisms Linking Vitamin D Deficiency to Impaired Metabolism: An Overview.

Authors:  Nurulmuna Mohd Ghozali; Nelli Giribabu; Naguib Salleh
Journal:  Int J Endocrinol       Date:  2022-07-06       Impact factor: 2.803

8.  An Association between Insulin Resistance and Neurodegeneration in Zebrafish Larval Model (Danio rerio).

Authors:  Nurliyana Najwa Md Razip; Suzita Mohd Noor; Anwar Norazit; Norshariza Nordin; Nurshafika Mohd Sakeh; Huzwah Khaza'ai
Journal:  Int J Mol Sci       Date:  2022-07-27       Impact factor: 6.208

9.  Synergistic effect of micronutrients and metformin in alleviating diabetic nephropathy and cardiovascular Dysfunctioning in diabetic rat.

Authors:  Aaishwarya Deshmukh; Prajakta Manjalkar
Journal:  J Diabetes Metab Disord       Date:  2021-04-05

10.  Decarboxylated osteocalcin, a possible drug for type 2 diabetes, triggers glucose uptake in MG63 cells.

Authors:  Shi Jin; Xiao-Cen Chang; Jing Wen; Jing Yang; Na Ao; Ke-Ying Zhang; Lin-Na Suo; Jian Du
Journal:  World J Diabetes       Date:  2021-07-15
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.