| Literature DB >> 31516359 |
Mohammed G Eladli1, Naiyf S Alharbi1, Jamal M Khaled1,2, Shine Kadaikunnan1, Ahmed S Alobaidi1, Sami A Alyahya3.
Abstract
Antibiotic-resistant Staphylococci are a global issue affecting humans, animals, and numerous natural environments. Antibiotic-resistant Staphylococcus epidermidis is an opportunistic pathogen frequently isolated from patients and healthy individuals. This study aimed to examine the antibiotic resistance of S. epidermidis isolated from patients, healthy students and compare the results with antibiotic-resistant bacteria isolated from pasteurized milk. Clinical strain isolation was performed in several hospitals in the Riyadh. Skin swabs from 100 healthy undergraduate candidate students were obtained at King Saud University. The pasteurized milk samples were obtained from local market (company, X). After isolation, identification and susceptibility tests were performed using an automated system. A multiplex tuf gene-based PCR assay was used to confirm identification. Biofilm production and biofilm-related gene expression were studied. S. epidermidis represented 17% of clinical bacterial isolates, and 1.7% of isolates obtained from healthy students were multiantibiotic-resistant. All patient strains were teicoplanin- and vancomycin-susceptible, while all student strains were gentamicin-, levofloxacin-, moxifloxacin-, and trimethoprim/sulfamethoxazole-susceptible. All the bacteria isolated from pasteurized milk were benzylpenicillin and oxacillin-resistant strains. Of the S. epidermidis strains, 91% could produce biofilms, and mecA, icaADBR, ica-ADB, ica-AD, ica-A only, and ica-C only were expressed in 83, 17.1, 25.7, 37.1, 20, and 0% of the strains, respectively. This work demonstrates that S. epidermidis can be accurately identified using a multiplex tuf-based assay, and that multiantibiotic-resistant S. epidermidis strains are widespread amongst patients and healthy students.Entities:
Keywords: Antibiotics; Biofilm; Clinical isolates; Staphylococcus epidermidis; icaABCDR; mecA
Year: 2018 PMID: 31516359 PMCID: PMC6733385 DOI: 10.1016/j.sjbs.2018.05.008
Source DB: PubMed Journal: Saudi J Biol Sci ISSN: 1319-562X Impact factor: 4.219
Primers used in the multiplex biofilm-related gene-based PCR assay.
| Primer | Sequence 5′ → 3′ | Amplicon size (bp) | |
|---|---|---|---|
| Forward | Reverse | ||
| ACAGTCGCTACGAAAAGAAA | GGAAATGCCATAATGACAAC | 103 | |
| CTGATCAAGAATTTAAATCACAAA | AAAGTCCCATAAGCCTGTTT | 302 | |
| TAACTTTAGGCGCATATGTTTT | TTCCAGTTAGGCTGGTATTG | 400 | |
| ATGGTCAAGCCCAGACAGAG | CGTGTTTTCAACATTTAATGCAA | 198 | |
| TAATCCCGAATTTTTGTGAA | AACGCAATAACCTTATTTTCC | 453 | |
Fig. 1Percentages of different species in clinical isolates collected from patients in several hospitals in the Riyadh region (n = 200).
Fig. 2Percentages of different species in clinical microbial isolates from healthy KSU students (n = 100).
Percentages of antibiotic-resistant and susceptible S. epidermidis isolated from patients, healthy students and pasteurized milk (n = 60 strains).
| Patients | Health students and pasteurized milk | |||
|---|---|---|---|---|
| Resistance | Antibiotic | Pasteurized milk | Health students | Antibiotic |
| Resistance | Resistance | |||
| 85.71% | Amox/K Clav | 100% | 100% | Benzylpenicillin |
| 54.29% | Ciprofloxacin | 100% | 40% | Oxacillin |
| 37.14% | Clindamycin | 37% | 0% | Gentamicin |
| 100.00% | Daptomycin | 0% | 40% | Tobramycin |
| 60.00% | Erythromycin | 0% | 0% | Levolfoxcin |
| 97.14% | Fosfomycin | 0% | 0% | Moxifloxacin |
| 14.29% | Fusidic Acid | 16% | 60% | Erythromycin |
| 54.29% | Gentamicin | 33% | 60% | Clindamycin |
| 82.86% | Lmipenem | 40% | 40% | Linezolid |
| 54.29% | Levofloxacin | 16% | 20% | Teicoplanin |
| 97.14% | Linezolid | 16% | 20% | Vancomycin |
| 48.57% | Moxifloxacin | 0% | 60% | Tetracycline |
| 22.86% | Mupirocin | 0% | 0% | Tigecycline |
| 88.57% | Oxacillin | 80% | 100% | Fostamycin |
| 14.29% | Rifampin | 0% | 20% | Nitrofurantoin |
| 5.71% | Synercid | 16% | 80% | Fusidic Acid |
| 0.00% | Teicoplanin | 80% | 40% | Rifampicin |
| 34.29% | Tetracycline | 80% | 0% | Trimethoprim/Sulfamethoxazole |
| 40.00% | Trimethoprim/Sulfamethoxazole | |||
| 0.00% | Vancomycin | |||
Fig. 3Comparison of the antibiotic-resistant S. epidermidis strains isolated from patients and healthy students (n = 35).
Summary of the S. epidermidis isolate identification and virulence factor screens.
| Identification by VITEK 2 system | Multiplex | Biofilm detection using the microtiter assay | Multiplex biofilm-related gene-based PCR assay | |||||
|---|---|---|---|---|---|---|---|---|
| Identified isolates | 35 | 33 | 32 | 6 | 9 | 13 | 7 | 29 |
| Total isolates | 35 | 35 | 35 | 35 | 35 | 35 | 35 | 35 |
| % Identified | 100 | 94 | 91 | 17.1 | 25.7 | 37.1 | 20 | 83 |