| Literature DB >> 31510033 |
Rosanna Tofalo1, Giorgia Perpetuini2, Noemi Battistelli3, Alessia Pepe4, Andrea Ianni5, Giuseppe Martino6, Giovanna Suzzi7.
Abstract
The influence of calf (R1), kid (R2) and pig (R3) rennets on microbiota, biogenic amines (BAs) and γ-aminobutyric acid (GABA) accumulation in raw milk ewe's cheeses was evaluated. Cheeses were investigated at different ripening times for their microbial composition, free amino acids (FAAs), BAs and GABA content. Moreover, the expression of tyrosine (tdc) and histidine (hdc) decarboxylases genes was evaluated by quantitative Real Time-Polymerase Chain Reaction (qRT-PCR). Microbial counts showed similar values in all samples. Pig rennet were cheeses were characterized by higher proteolysis and the highest values of BAs. The BAs detected were putrescine, cadaverine and tyramine, while histamine was absent. qRT-PCR confirmed this data, in fact hdc gene was not upregulated, while tdc gene expression increased over time in agreement with the increasing content of tyramine and the highest fold changes were detected in R3 cheeses. GABA showed the highest concentration in R2 cheeses reaching a value of 672 mg/kg. These results showed that the accumulation of BAs and GABA in Pecorino di Farindola is influenced by ripening time and type of coagulant. Further studies are required to develop starter cultures to reduce BAs content and improve health characteristics of raw milk ewe's cheeses.Entities:
Keywords: Pecorino di Farindola; biogenic amines; histidine decarboxylase (hdc) gene; raw milk ewe’s cheese; tyrosine decarboxylase (tdc) gene; γ-aminobutyric acid
Year: 2019 PMID: 31510033 PMCID: PMC6770426 DOI: 10.3390/foods8090401
Source DB: PubMed Journal: Foods ISSN: 2304-8158
Primer sequences and PCR conditions used in this study.
| Primer | Sequence (5′-3′) | qPCR Conditions | References |
|---|---|---|---|
|
| TCCTACGGGAGGCAGCAGT | 95 °C for 10 min, 40 cycles at 95 °C for 15 s, 60 °C for 1 min, 72 °C for 45 s | [ |
|
| CGTACACATTCAGTTGCATGGCAT | 94 °C for 5 min, 35 cycles at 94 °C for 20 s, 58 °C for 30 s, 72 °C for 45 s | [ |
|
| TTGACCGTATCTCAGTGAGTCCAT | 95 °C for 10 min, 40 cycles at 95 °C for 15 s, 58 °C for 1 min, 72 °C for 45 s | [ |
Figure 1Heat maps depicting abundance of microbial groups characterizing the cheeses obtained with different rennets throughout ripening. Calf (R1), kid (R2) and pig (R3) rennets. Aerobic Mesophilic Bacteria (AMB); Lactic Acid Bacteria (LAB).
Figure 2Evolution of free amino acids throughout ripening in Pecorino di Farindola produced with with different rennets. calf (R1), kid (R2) and pig (R3).
Figure 3Biogenic amines evolution in Pecorino di Farindola manufactured with the three different rennets: calf (R1), 216 kid (R2) and pig (R3). Putrescine (PUT); Cadaverine (CAD); Tyramine (TYR); Biogenic Amine (BA).
Figure 4Tyramine content and relative transcript levels of tdc gene during ripening. Transcript levels are expressed as x-fold increase in comparison with the expression at T0. Three biological replicates were performed. Calf (R1), kid (R2) and pig (R3).
Figure 5Evolution of GABA content in Pecorino di Farindola made with the three different rennets: calf (R1), kid (R2) and pig (R3).