Development of 20 chloroplast microsatellite primers in wuyao (Lindera aggregata, Lauraceae).

PREMISE OF THE STUDY: To investigate the population genetics and evolutionary history of wuyao (Lindera aggregata, Lauraceae) and other Lindera species, polymorphic chloroplast microsatellite (cpSSR) primers were developed. METHODS AND
RESULTS: The complete chloroplast genome of L. glauca was used to design 74 primers for L. aggregata. Agarose gel electrophoresis and Sanger sequencing were used to select 20 polymorphic primers. These primers were then tested in 70 individuals from three populations of L. aggregata. The number of alleles ranged from two to four, and the unbiased haploid diversity index ranged from 0.457 to 0.685. Up to 17 primers successfully amplified in four other Lindera species: L. prattii, L. chunii, L. lungshengensis, and L. pulcherrima var. hemsleyana.
CONCLUSIONS: The 20 primers reported here can potentially be used for future genetic studies of L. aggregata and other Lindera species.

Wuyao, Lindera aggregata (Sims) Kosterm. (Lauraceae), is a plant species whose use in traditional Chinese medicine can be traced back to the Zhou Dynasty (1046–256 BC). Wuyao has complex pharmacological effects, including anti‐inflammatory, antiviral, antibacterial, antioxidant, and anti‐fatigue effects (Chen and Yu, 2011). Since 2005, wuyao has been protected as a medicinal remedy in Tiantai County, Zhejiang Province, China (between 28.95–29.34°N and 120.69–121.26°E). Because L. aggregata is a dominant species in evergreen broad‐leaved forests and is widely distributed in subtropical China (Wang, 2006), its wild genetic diversity is an excellent source for genetic breeding.

DNA polymorphisms in the form of microsatellite (or simple sequence repeat [SSR]) markers are a powerful source for population genetic studies (Kalia et al., 2011). SSRs are present in both nuclear and organelle (such as chloroplast) genomes. Nuclear microsatellites (nSSRs) are codominant, biparentally inherited, and highly polymorphic, making them suitable to investigate distributions of genetic diversity and recent demographic histories. Chloroplast microsatellites (cpSSRs) also possess some unique characteristics, such as haploidy, nonrecombination, and uniparental inheritance (Ebert and Peakall, 2009). In particular, the chloroplast genome has a low nucleotide substitution rate, and therefore cpSSRs can provide unique insights into ancient evolutionary processes (Provan et al., 2001). Abundant nSSR primers have been developed in different Lindera Thunb. species, such as L. melissifolia (Walter) Blume (Echt et al., 2006), L. benzoin (L.) Blume (Edwards and Niesenbaum, 2007), and L. glauca (Siebold & Zucc.) Blume (Zhu et al., 2016), and these nSSRs have been used to investigate evolutionary histories of Lindera species (such as L. obtusiloba Blume [Ye et al., 2017]). However, no specific cpSSR primers have been developed in the Lindera genus. As complete chloroplast genomes have been widely used for cpSSR primer design (Deng et al., 2017), an existing chloroplast genome of L. glauca was used to develop novel cpSSR primers for L. aggregata.

METHODS AND RESULTS

We collected 70 L. aggregata individuals from three populations: Wuyunjie (WYJ) in Hunan Province, Tianmu Mountain (TMSH) in Zhejiang Province, and Nanning (NAN) in Guangxi Province (Appendix 1). Total genomic DNA was extracted from dried leaves using the Plant Genomic DNA Kit (DP305‐03; Tiangen, Beijing, China).

From the complete chloroplast genome of L. glauca (GenBank accession number MF188124.1), 74 cpSSR loci were identified using SSRHunter 1.3 (Li and Wan, 2005) with the repeat threshold settings of 10 repeat units for mononucleotide and five, four, three, or three repeats for di‐, tri‐, tetra‐, and pentanucleotide cpSSRs, respectively. Based on their flanking regions, we designed 74 cpSSR primers using Primer3Plus (Untergasser et al., 2007) with the following settings: primer size 18–27 bp, product length 150–300 bp, annealing temperature 57.0–63.0°C, and GC 20.0–80.0%.

Using the 74 cpSSR primers, PCR assays were performed in individual 40‐μL reaction mixes containing 10–20 ng of template DNA, 1× buffer, 10 mM Tris‐HCl (pH 8.3), 50 mM KCl, 200 mM each dNTP, 2.0 mM MgCl2, 0.1 mM each primer, and two units of Taq (TaKaRa Biotechnology Co., Dalian, China). PCR amplifications were performed as follows: an initial denaturation step at 94°C for 5 min; followed by 30 cycles of 50 s at 94°C, 50 s at the annealing temperature (Table 1), and 50 s at 72°C; with a final extension step at 72°C for 10 min. Agarose gel electrophoresis was used to select primers that generated a single clear band, and these primers were used to amplify cpSSRs in one individual each from the WYJ, TMSH, and NAN populations (Appendix 1). The amplicons were sequenced and then read in CodonCode Aligner 3.6.1 (CodonCode Corporation, Centerville, Massachusetts, USA) to screen for polymorphic loci.

Table 1

Characteristics of 20 chloroplast microsatellite markers of Lindera aggregata and locus position in the L. glauca chloroplast genome

Locus	Primer sequences (5′–3′)	Allele size range (bp)	T a (°C)	Repeat motif	Fluorescent labela	GenBank accession no.	Position
LAG20	F: TGGCCGTTGTTCCTTATTTC	203–205	60	(A)10	HEX	MH569843	atpB/rbcL (57972–58176)
	R: CAACCCAATCCTTGTTTTGC
LAG5	F: GCAGAAGTCCCAACCCTATTG	200–202	60	(A)16	6‐FAM	MH569849	ndhF/rpl32 (116030–116227)
	R: TTGAAAAATGGTAACTTCTTCATTTG
LAG9	F: GGAAGCGGCAGAAATCAAT	226–227	60	(A)14	TAMRA	MH569848	atpH/atpI (15049–15270)
	R: CAAAGACTCCACGGATAGGAA
LAG11	F: TAGTGGGAGTGACACGGATT	201–205	60	(A)13	HEX	MH569847	trnD‐GUC/trnY‐GUA (32657–32864)
	R: GGCGATATGTCTACGCTGGT
LAG12	F: ATTCTTCCCATCCCAAAACC	161–162	60	(A)16	6‐FAM	MH569846	trnG‐UCC/trnfM‐CAU (38941–39103)
	R: CGGGGTAGAGCAGTTTGGTA
LAG15	F: TACCGGAAAGAGTGGAAAGG	175–178	60	(A)16	TAMRA	MH569845	trnS‐GGA/rps4 (47813–47983)
	R: TTCCCGTCAGACTTGAACCT
LAG19	F: TTCTCGATGAAGTCGGTTGA	154–158	60	(A)12	HEX	MH569844	clpP (74861–75018)
	R: AAGAAAAAGCCCGCTACGA
LAG21	F: CCGTGTGAGAGCAACAATGA	165–166	60	(C)11(T)11	6‐FAM	MH569842	matK/rps16 (5095–5264)
	R: ATTTCAAAGAAGGCGGAGGT
LAG23	F: AAACGATTGATTCCCCTGTG	214–215	60	(T)13	TAMRA	MH569841	rps16 (5907–6117)
	R: TGGAGCTCGAGCATAAAGAA
LAG24	F: TGCATCATGTGAGAATCCAAA	226–228	60	(T)13	HEX	MH569840	rps16/trnQ‐UUG (7843–8067)
	R: TCACAAACAAACGGATCGAG
LAG26	F: AAGTCATTTGGGGTGCATTC	178–180	60	(T)17	6‐FAM	MH569839	trnG‐UCC (10893–11071)
	R: TTCATTCGGCTCCTTTATGG
LAG28	F: GATTGGCTTAGAGCCCTTACA	182–183	60	(T)10	TAMRA	MH569838	atpH/atpI (15585–15764)
	R: GTGAATCCATGGAGGGTCAT
LAG29	F: ATGGCCAAAATGAACTCCTG	159–164	60	(T)10	HEX	MH569837	rps2/rpoC2 (17350–17507)
	R: CGGTCAATCTCCGGTAGAAG
LAG31	F: GGCTCCTGTAACCGTGTCAT	227–231	60	(T)13	6‐FAM	MH569836	rpoC1 (23959–24184)
	R: GATGCCCCTGACTCTGACAT
LAG32	F: GTAACCCCGCCAAGAATGTA	235–237	60	(T)10	TAMRA	MH569835	trnC‐GCA/petN (29753–29989)
	R: ATACACAGTTGCCCCTTGGA
LAG33	F: AGGGATACACATGATGGGAAA	165–167	60	(T)12	HEX	MH569834	petN/psbM (30459–30623)
	R: GGTTCCCTCTTTGAACAGCA
LAG38	F: CGGGAGTCATTGGTTCAAA	225–226	60	(T)12	6‐FAM	MH569833	trnM‐CAU/atpE (55474–55692)
	R: CATATTTGGATTCCGCCAAT
LAG41	F: TGTGATTCAGCAATCCCAAA	168–170	60	(T)12	TAMRA	MH569832	clpP (74203–74372)
	R: ATGTATCGGGGTCCATTTCA
LAG48	F: CACCCCCAGACCTCCTAATA	245–248	60	(T)10	HEX	MH569831	ndhG/ndhI (123356–123598)
	R: GCGGGATTGATCCAATAACT
LAG49	F: TGAAATTCAACAGACCCTTTG	182–183	56	(T)12	6‐FAM	MH569830	rps15/ycf1 (128090–128268)
	R: TCCAGATTATTGGGTGTATCAGA

T a = annealing temperature.

Forward primers were modified at the 5′ end with fluorescent labels: HEX (green), 6‐FAM (blue), or TAMRA (yellow).

To determine the allelic size range of the polymorphic cpSSR loci, a fluorescent label was added to each forward primer (Table 1) and PCR was then performed in all 70 individuals following the procedure mentioned above (Appendix 1). The amplicons were resolved on an ABI 3500XL automated DNA sequencer with the GeneScan 500 ROX Size Standard (Applied Biosystems, Foster City, California, USA). The microsatellite marker profiles were analyzed using GeneMarker version 1.80 (Holland and Parson, 2011). To reduce score error, two people independently read all alleles, and any disputes were decided by a third person. For each locus, the number of alleles and unbiased haploid diversity index were calculated using GenAlEx 6.5 (Peakall and Smouse, 2012). The polymorphic cpSSR primers were further cross‐amplified in L. prattii Gamble, L. chunii Merr., and L. lungshengensis S. Lee using one individual in each species, and in L. pulcherrima (Nees) Benth. ex Hook. f. var. hemsleyana (Diels) H. P. Tsui using eight individuals (Appendix 1).

Among the 74 cpSSR primers developed in L. aggregata, five primers could not be successfully amplified, 49 primers were monomorphic, and the remaining 20 primers were polymorphic (Table 1). In all 70 individuals, the number of alleles ranged from two to four, and the unbiased haploid diversity index ranged from 0.457 to 0.685. In the three populations of L. aggregata, low genetic diversity was evident because most loci were fixed with one allele, and the TMSH population had relatively higher genetic diversity (Table 2). Up to 17 cpSSR primers were successfully amplified in L. prattii, L. chunii, and L. lungshengensis, and similar cpSSR range sizes were found in L. pulcherrima var. hemsleyana (Table 2).

Table 2

Genetic diversity of 20 chloroplast microsatellites in three populations of Lindera aggregata and cross‐amplification in four other Lindera species.a

Locus	Lindera aggregata								L. prattii (n = 1)	L. chunii (n = 1)	L. lungshengensis (n = 1)	L. pulcherrima var. hemsleyana (Allele size range) (n = 8)
	WYJ (n = 22)		TMSH (n = 24)		NAN (n = 24)		All (n = 70)
	A	h	A	h	A	h	A	h
LAG20	1	0.000	1	0.000	1	0.000	2	0.457	+	+	+	+ (208)
LAG5	1	0.000	1	0.000	1	0.000	3	0.676	+	+	+	+ (202–205)
LAG9	1	0.000	1	0.000	1	0.000	2	0.457	—	—	—	+ (235–237)
LAG11	1	0.000	2	0.344	2	0.083	4	0.552	+	+	+	+ (203–204)
LAG12	1	0.000	2	0.083	1	0.000	2	0.466	+	+	+	+ (160)
LAG15	1	0.000	2	0.344	1	0.000	3	0.542	—	—	—	+ (170–174)
LAG19	1	0.000	3	0.409	1	0.000	4	0.677	+	+	+	+ (154–155)
LAG21	1	0.000	2	0.344	1	0.000	2	0.492	—	—	—	+ (167–168)
LAG23	1	0.000	1	0.000	1	0.000	2	0.457	—	—	—	—
LAG24	1	0.000	2	0.344	1	0.000	3	0.670	+	+	+	+ (226–228)
LAG26	1	0.000	1	0.000	1	0.000	3	0.676	+	+	+	+ (181)
LAG28	1	0.000	1	0.000	1	0.000	2	0.457	—	—	—	—
LAG29	1	0.000	2	0.083	1	0.000	4	0.685	+	+	+	+ (156)
LAG31	1	0.000	2	0.083	1	0.000	4	0.685	+	+	+	+ (227)
LAG32	1	0.000	1	0.000	1	0.000	3	0.676	+	+	+	+ (234)
LAG33	2	0.519	1	0.000	1	0.000	3	0.626	+	+	+	+ (164–167)
LAG38	1	0.000	1	0.000	1	0.000	2	0.457	+	+	+	+ (222–223)
LAG41	1	0.000	1	0.000	1	0.000	3	0.676	+	+	+	+ (168)
LAG48	1	0.000	1	0.000	1	0.000	2	0.457	+	+	+	+ (242–243)
LAG49	1	0.000	1	0.000	1	0.000	2	0.457	—	—	—	—

+ = successful amplification; — = unsuccessful amplification; A = number of alleles; h = unbiased haploid diversity; n = number of individuals.

Voucher and locality information are provided in Appendix 1.

CONCLUSIONS

Using an existing chloroplast genome of L. glauca, we successfully developed and characterized 20 polymorphic L. aggregata chloroplast microsatellite markers. A limited number of alleles were found in all 20 loci, indicating a very low evolutionary rate in the chloroplast genome or a shallow history of L. aggregata. Low intrapopulation and high interpopulation diversity found in the three populations indicate these populations may have experienced long‐term isolation (Avise, 2000). Due to the high rate of cross‐amplification (70–85%), the 20 polymorphic cpSSR primers will likely be useful in intra‐ or interspecific genetic studies in Lindera.

Taxon	Population	Location	n	Latitude	Longitude	Voucher no.a
Lindera aggregata (Sims) Kosterm.	TMSH	Mt. Tianmu, Zhejiang, China	24	30.42	119.41	SHM22266
	WYJ	Wuyunjie, Hunan, China	22	28.62	111.49	SHM23283
	NAN	Nanning, Guangxi, China	24	22.73	108.30	SHM23287
L. prattii Gamble	EM	Mt. Emei, Sichuan, China	1	29.55	103.37	SHM23285
L. pulcherrima (Nees) Benth. ex Hook. f. var. hemsleyana (Diels) H. P. Tsui	CHD	Mt. Jinfo, Chongqing, China	8	29.08	107.16	SHM23295
L. chunii Merr.	DHS	Mt. Dinghu, Guangdong, China	1	23.17	112.55	SHM23299
L. lungshengensis S. Lee	LSH	Longsheng County, Guangxi, China	1	25.79	110.01	SHM23280

n = number of individuals.

Voucher specimens were deposited in the Shanghai Museum of Natural History (SHM), Shanghai, China.