Chloroplast microsatellite markers for Pseudotaxus chienii developed from the whole chloroplast genome of Taxus chinensis var. mairei (Taxaceae).

PREMISE OF THE STUDY: Pseudotaxus chienii (Taxaceae) is an old rare species endemic to China that has adapted well to ecological heterogeneity with high genetic diversity in its nuclear genome. However, the genetic variation in its chloroplast genome is unknown. METHODS AND
RESULTS: Eighteen chloroplast microsatellite markers (cpSSRs) were developed from the whole chloroplast genome of Taxus chinensis var. mairei and successfully amplified in four P. chienii populations and one T. chinensis var. mairei population. Of these loci, 10 were polymorphic in P. chienii, whereas six were polymorphic in T. chinensis var. mairei. The unbiased haploid diversity per locus ranged from 0.000 to 0.641 and 0.000 to 0.545 for P. chienii and T. chinensis var. mairei, respectively.
CONCLUSIONS: The 18 cpSSRs will be used to further investigate the chloroplast genetic structure and adaptive evolution in P. chienii populations.

Taxus L. and Pseudotaxus W. C. Cheng are two closely related sister genera with similar appearance in Taxaceae (Fu et al., 1999). Their only distinction is the difference in color in the stomatal bands and aril (Fu et al., 1999). Both T. chinensis (Pilg.) Rehder var. mairei (Lemée & H. Lév.) W. C. Cheng & L. K. Fu and P. chienii (W. C. Cheng) W. C. Cheng are coniferous species endemic to China. Taxus chinensis var. mairei, in particular, has a high medicinal value because it contains the anticancer agent taxol (Li et al., 2008). Pseudotaxus chienii, the sole species in the monotypic genus, is an evergreen shrub or small tree with an average height of 4 m (Su et al., 2009). Due to overexploitation and human activities, the population size of P. chienii is shrinking. The species is categorized as an endangered species in the Red List of Endangered Plants in China (Fu and Jin, 1992). As an “old rare species,” P. chienii has adapted well to habitat fragmentation and ecological heterogeneity across a wide range of habitats and is found in Zhejiang, Jiangxi, Hunan, and Guangxi provinces (Deng et al., 2013). The previous nuclear inter-simple sequence repeat (ISSR) and simple sequence repeat (SSR) markers have revealed that P. chienii possesses high genetic diversity, which provides a large pool of raw material for adaptive evolution (Su et al., 2009; Deng et al., 2013). However, the level of genetic variation in the P. chienii chloroplast genome is unknown.

Chloroplast simple sequence repeat (cpSSR) markers, which have been extensively used in population genetics, possess important and unique characteristics such as haploidy, nonrecombination, uniparental inheritance, and a low nucleotide substitution rate (Ebert and Peakall, 2009). cpSSR loci are generally distributed throughout the noncoding regions with higher sequence variations and have conservative flanking regions (Huang et al., 2015). In particular, the chloroplast genome retains ancient genetic patterns and can therefore provide unique insight into evolutionary processes (Provan et al., 2001). Therefore, cpSSR markers can be used to investigate genetic variation in small, fragmented populations and can be transferred to related species (Schaal et al., 1998; Petit et al., 2005; Pan et al., 2014). More important, because cpSSRs are paternally inherited in gymnosperms, they can be used to assess pollen-mediated gene flow, population genetic variation, and phylogeographic patterns. Information revealed by cpSSRs is complementary to that obtained from nuclear SSRs (Powell et al., 1996; Provan et al., 2001). Although no chloroplast genome sequences of P. chienii have been reported, the complete chloroplast genome sequence of T. chinensis var. mairei is available in the National Center for Biotechnology Information’s GenBank (accession no. NC_020321.1). Thus, here we first isolated 18 cpSSRs in T. chinensis var. mairei, then applied 10 polymorphic markers to evaluate the genetic diversity of P. chienii. These markers will be further applied to survey the chloroplast genetic variation in P. chienii.

METHODS AND RESULTS

In this study, a total of 109 individuals from four populations of P. chienii were collected throughout its natural distribution range, including Shuimenjian (Zjsmj) in Zhejiang Province, Zhangjiajie (Hnzjj) in Hunan Province, Zizhuba (Jxzzb) in Jiangxi Province, and Damingshan (Gxdms) in Guangxi Zhuang Autonomous Region, China (Appendix 1). One T. chinensis var. mairei population was gathered from Fenshui (Jxfs) in Jiangxi Province. Due to its rare and endangered properties, only 11 individuals were sampled. Young leaves were collected and dried in silica gel immediately. Genomic DNA was extracted using a modified cetyltrimethylammonium bromide (CTAB) protocol (Doyle and Doyle, 1987).

From the complete chloroplast genome sequence for T. chinensis var. mairei (GenBank accession no. NC_020321.1), 32 cpSSR loci were identified with the repeat threshold settings of 10 repeats for mononucleotides and five repeats for di-, tri-, tetra-, penta-, and hexanucleotide cpSSRs. Based on their flanking regions, we designed 27 primers using Primer Premier 5.0 software (PREMIER Biosoft International, Palo Alto, California, USA). One individual (SMJ27) from Zjsmj population for P. chienii and one individual (FS7) from Jxfs population for T. chinensis var. mairei were selected to screen these primers. PCR was performed in a total volume of 20 μL containing 20 ng of genomic DNA, 1× PCR buffer, 5 mM MgCl2, 0.2 mM dNTPs mixture, 0.25 μM of each primer, and 1 unit Taq polymerase (TaKaRa Biotechnology Co., Dalian, China). Reaction conditions included initial denaturation at 94°C for 3 min; followed by 35 cycles at 94°C for 1 min, annealing temperature for 1 min, and 72°C for 1 min; with a final extension at 72°C for 10 min. The annealing temperature was optimized by gradient PCR (Table 1). Amplified products were separated by 6% denaturing polyacrylamide gel electrophoresis and visualized by silver staining. The allele sizes were estimated with a 50-bp DNA ladder (TaKaRa Biotechnology Co.) as size standard. Eighteen of 27 primers (approximately 67%) could produce clear bands in both P. chienii and T. chinensis var. mairei. The 18 cpSSRs were divided into three categories in terms of motif structure: 15 perfect, one imperfect, and two compound repeats. The high frequency of perfect repeats was in accordance with Ebert’s description (Ebert and Peakall, 2009).

Table 1.

Characteristics of 18 cpSSR markers developed for Taxus chinensis var. mairei.

Locus	Primer sequences (5′–3′)	Repeat motif	Ta (°C)	Product size (bp)	Locationc
PTC-cp01a,b	F: CACCATCCACTGCCTTTG	(AT)9	54	168	trnH-GUG-trnI-CAU (337–354)
	R: GTGCGGTCAGAACTTGTCA
PTC-cp02b	F: TGCGTGGCTGTGAGATG	(AC)5	54	213	trnT-trnE (21,944–21,953)
	R: GCGGAACCCGTAGTGAA
PTC-cp03	F: AAGCCGCCCTGTTTTA	(TA)5(AT)5	54	232	trnC-GCA-rpoB (25,696–25,715)
	R: ATCTCATCGCATTGGAAGT
PTC-cp04b	F: TGTGGCACTATCCAAGGTC	(AT)5	54	135	rpoC2 (32,846–32,855)
	R: GCGTGGCAATACATCTCC
PTC-cp05	F: TGAACAGGTCCGACAGCA	(A)11TACAA(AT)5	55	376	atpF-atpA (39,353–39,378)
	R: CCATCCCATCTCCTACTTGA
PTC-cp08	F: TGATGAGTGCCGCCTAAT	(AT)5AGAAGTATACTTC(TA)5	54	173	rpl36-rps11 (57,373–57,405)
	R: CGGGGAACTAATCTTCTTGT
PTC-cp09a	F: TGTATCAACCAATGCTTCC	(TC)6	54	273	psbT-psbB (62,807 – 62,818)
	R: ATTCATAGATGTTTTCGCTG
PTC-cp13b	F: AGTCCAAAATCTCCCACAC	(AT)5	54	180	ndhF (104,893–104,902)
	R: CTTCTTCAATGCTTCTATGCT
PTC-cp15	F: GCTTGGACCCATTGTTGAA	(A)10	55	279	rpoC1-rpoC2 (32,043–32,052)
	R: CATACTTTAGGTGGCGTTGTTA
PTC-cp16a,b	F: CCCATACTCCCATTTCATAACTT	(A)10	55	237	rpoC2 (34,060–34,069)
	R: AGCACTTGCCCAGGACTAACT
PTC-cp18a,b	F: TCCAGGTGCTGATGCTACTAA	(A)10	55	186	rpoC2-atpI (35,652–35,661)
	R: TCGTGCTGCTTCTTTCTTTG
PTC-cp21b	F: GGTGGGGTGGGAACG	(A)10	55	306	rpl32 (106,169–106,178)
	R: TTGGGTGAGCCATAGAAAT
PTC-cp22a,b	F: AGCAATGTTTGGAAGGGAA	(A)10	55	130	rpl32-trnP-GGG (106,257–106,266)
	R: GGTGTAGTCTATTTGGTGGTGTT
PTC-cp23b	F: AACTAATCCCAATGGCTTCA	(T)10	55	301	ycf3 intron (9378–9387)
	R: CCCTATGCGTGCCTATCA
PTC-cp26a,b	F: TGGATAGGACCCATAACAGG	(T)10	55	326	ycf4 (65,483–65,492)
	R: AAACTACGGCGATTTCTTC
PTC-cp28	F: TGTAGTTTGCCGAGTGGTT	(T)11	55	336	psbE-petL (70,723–70,733)
	R: AATAATAGTAGACATTGGAAGGAC
PTC-cp29a,b	F: AATAGGTTCTGGAGCGGTTA	(T)11	55	254	rps8 (75,439–75,449)
	R: AGATTTAGTTCGTCACGGGTA
PTC-cp32a,b	F: CCTCGTGCGGATAACTAAA	(TCTTCC)7	55	284	rps15-chlN (121,797–121,838)
	R: TGGCAAAGATTCCCTGG

Note: Ta = annealing temperature.

Monomorphic loci for Pseudotaxus chienii.

Monomorphic loci for T. chinensis var. mairei.

Locus location (genic or intergenic region); the position amplified by the primers in the T. chinensis var. mairei chloroplast genome is given in parentheses.

The utility of these 18 cpSSR primers was further examined in 109 and 11 individuals of P. chienii and T. chinensis var. mairei, respectively. The PCR reactions were conducted as described above. Among these loci, 10 (PTC-cp02, PTC-cp03, PTC-cp04, PTC-cp05, PTC-cp08, PTC-cp13, PTC-cp15, PTC-cp21, PTC-cp23, and PTC-cp28) showed polymorphisms in P. chienii, whereas six (PTC-cp03, PTC-cp05, PTC-cp08, PTC-cp09, PTC-cp15, and PTC-cp28) were polymorphic in T. chinensis var. mairei (Table 1). The genetic parameters, including the number of alleles (A), haploid diversity (h), and unbiased haploid diversity (hunb) for each population, were evaluated with GenAlEx version 6.41 (Peakall and Smouse, 2006). Ten polymorphic cpSSR loci for P. chienii and six polymorphic loci for T. chinensis var. mairei were used. For P. chienii, A was between one and four, h ranged from 0.000 to 0.620, and hunb varied from 0.000 to 0.641 (Table 2). Population Zjsmj revealed obviously higher diversity than other populations. For T. chinensis var. mairei, A, h, and hunb were one to three, 0.000–0.496, and 0.000–0.545, respectively (Table 2).

Table 2.

Genetic properties of 10 polymorphic cpSSR loci for Pseudotaxus chienii and six polymorphic loci for Taxus chinensis var. mairei.

	Pseudotaxus chienii												Taxus chinensis var. mairei
	Zjsmj (n = 30)			Gxdms (n = 30)			Hnzjj (n = 19)			Jxzzb (n = 30)			Jxfs (n = 11)
Locus	A	h	hunb	A	h	hunb	A	h	hunb	A	h	hunb	A	h	hunb
PTC-cp02	1	0.000	0.000	1	0.000	0.000	1	0.000	0.000	2	0.320	0.331	NAc	NAc	NAc
PTC-cp03	2	0.180	0.186	1	0.000	0.000	2	0.188	0.199	1	0.000	0.000	2	0.165	0.182
PTC-cp04	2	0.180	0.186	1	0.000	0.000	2	0.100	0.105	2	0.064	0.067	NAc	NAc	NAc
PTC-cp05	3	0.127	0.131	3	0.127	0.131	2	0.100	0.105	1	0.000	0.000	3	0.430	0.473
PTC-cp08	2	0.498	0.515	3	0.504	0.522	1	0.000	0.000	1	0.000	0.000	2	0.463	0.509
PTC-cp09	NAb	NAb	NAb	NAb	NAb	NAb	NAb	NAb	NAb	NAb	NAb	NAb	2	0.463	0.509
PTC-cp13	3	0.504	0.522	1	0.000	0.000	1	0.000	0.000	1	0.000	0.000	NAc	NAc	NAc
PTC-cp15	3	0.418	0.432	1	0.000	0.000	1	0.000	0.000	1	0.000	0.000	2	0.496	0.545
PTC-cp21	1	0.000	0.000	2	0.124	0.129	1	0.000	0.000	1	0.000	0.000	NAc	NAc	NAc
PTC-cp23	2	0.124	0.129	2	0.064	0.067	2	0.100	0.105	2	0.124	0.129	NAc	NAc	NAc
PTC-cp28	4	0.620	0.641	3	0.184	0.191	3	0.421	0.444	2	0.320	0.331	2	0.463	0.509

Note: A = number of alleles; h = haploid diversity; hunb = unbiased haploid diversity; n = number of individuals sampled.

Voucher and locality information are provided in Appendix 1.

No analysis performed because PTC-cp09 was monomorphic in P. chienii.

No analysis performed because PTC-cp02, PTC-cp04, PTC-cp13, PTC-cp21, and PTC-cp23 were monomorphic in T. chinensis var. mairei.

Analysis of molecular variance (AMOVA) was performed to measure genetic differentiation and the ratio of genetic variations within and among P. chienii populations in Arlequin version 3.5 (Excoffier and Lischer, 2010). The results revealed significant difference in partitioning of variation among and within populations (29.03% and 70.97%, respectively; Table 3) and uncovered significant genetic differentiation among all populations (FST = 0.2903).

Table 3.

The analysis of molecular variance (AMOVA) within and among populations based on 10 polymorphic cpSSRs in Pseudotaxus chienii.

Source of variation	df	Sum of squares	Variance components	Percentage of variation	P value
Among populations	3	22.880	0.25926	29.03%	<0.0001
Within populations	105	66.542	0.63373	70.97%	<0.0001
Total	108	89.422	0.893	100.00%

Note: df = degrees of freedom.

CONCLUSIONS

The polymorphic chloroplast SSR loci developed from T. chinensis var. mairei in this study were verified to be reliable for assessing genetic variation of P. chienii populations. Combined with the nuclear SSR loci previously developed (Deng et al., 2013), the 18 cpSSRs will contribute to further exploration of whether the adaptation of P. chienii to environmental heterogeneity is driven through nuclear or chloroplast loci. In addition, the conservative nature of cpDNA may allow these markers to be used in other conifers.

Appendix 1.

Collection locality and voucher information for Pseudotaxus chienii and Taxus chinensis var. mairei populations used in this study.

Species	Population code	Collection locality	Geographic coordinates	Voucher specimena
Pseudotaxus chienii (W. C. Cheng) W. C. Cheng	Zjsmj	Shuimenjian, Zhejiang Province	28°43′42″N, 118°57′32″E	YJ Su 201303, SMJ27
Pseudotaxus chienii	Jxzzb	Zizhuba, Jiangxi Province	26°27′18″N, 114°06′22″E	YJ Su 201303, ZZB12
Pseudotaxus chienii	Hnzjj	Zhangjiajie, Hunan Province	29°23′12″N, 110°28′56″E	YJ Su 201303, ZJJ09
Pseudotaxus chienii	Gxdms	Damingshan, Guangxi Zhuang Autonomous Region	23°29′54″N, 108°26′12″E	YJ Su 201303, DMS17
Taxus chinensis (Pilg.) Rehder var. mairei (Lemée & H. Lév.) W. C. Cheng & L. K. Fu	Jxfs	Fenshui, Jiangxi Province	28°56′31″N, 108°02′12″E	WB Liao 201108, FS1

Voucher specimens are deposited at the herbarium of Sun Yat-sen University (SYSU).