| Literature DB >> 31438555 |
María Gallardo1, Juan G Cárcamo2,3, Luis Arias-Darraz2,3, Carlos Alvear4.
Abstract
These trials were carried out to determine firstly the effect of diet and type of pregnancy on the transcriptional expression of genes involved in angiogenesis and cell turnover/lactogenesis inside the sheep mammary gland from late gestation to late lactation. Eighteen Ile de France sheep, 8 twin- and 10 single-bearing ewes were alloted into two groups according to their diet, either based on ad libitum naturalized pasture or red clover hay plus lupine from day -45 pre-partum until day +60 post-partum. Samples from diets and mammary glands were collected at day -10 pre partum (time 1), day +30 (time 2) and day +60 post-partum (time 3) and analyzed by qRT-PCR. Additionally, samples from longissimus dorsi muscle were taken from lambs twice, at weaning and 45 days later, to determine the effect of the maternal treatment with regard to diet and type of pregnancy, on the mRNA expression of genes involved in lipid metabolism. The data was processed using the lme4 package for R, and SPSS Statistics 23.0 for Windows®. The results showed that the group of twin-bearing ewes fed red clover showed a higher expression of genes involved in angiogenesis before lambing and in cell turnover/lactogenesis during late lactation, explained by a lamb survival mechanism to delay apoptosis as a way to keep a secretory cells population and boosted by the diet quality, assuring a longer milk production potential during late lactation. Regarding lambs, apparently the maternal diet would influence the transcriptional expression of lipogenic enzymes in the longissimus dorsi muscle after weaning, but further studies are necessary to validate these results. In summary, Twin-bearing ewes fed red clover performed best at increasing the expression of genes associated with angiogenesis and cell turnover/lactogenesis in the mammary gland.Entities:
Keywords: angiogenesis; lactogenesis; lamb muscle; transcriptional expression
Year: 2019 PMID: 31438555 PMCID: PMC6770544 DOI: 10.3390/ani9090589
Source DB: PubMed Journal: Animals (Basel) ISSN: 2076-2615 Impact factor: 2.752
Primer specifications.
| Gene | Accession | Forward Primer Sequence | Amplicon |
|---|---|---|---|
| Angiogenesis | Reverse Primer Sequence | ||
|
| XM_012186664.1 | F: AGCGCTTTGCCATGGAGATACA | 148 |
| R: AGGGGCTGGAAGTTCACATTCTTG | |||
|
| NM_001025110.1 | F: TGCTCTACCTTCACCATGCCAA | 101 |
| R: GCGCTGGTAGACATCCATGAACTT | |||
|
| XM_015098156.1 | F: AGGTGACCTGCTTCAAGCCAAT | 106 |
| R: GAAGGCAGGTGTCGAGTACGTAAA | |||
|
| NM_001278565.1 | F: AAGACGCTGACTTGCTTTGGGA | 150 |
| R: AAATGGGAAGAGCACGCAACCT | |||
|
| XM_004011787.3 | F: GCACCCTCATGCATTCTTGTCA | 140 |
| R: ACCCTTTCCTCTACCCTATCTGCT | |||
|
| XM_004021671.3 | F: GAGACCTGCTCCCAAAGCAGTAAA | 145 |
| R: TCACTGAGTGATGCGGGTTCAA | |||
|
| XM_015103501.1 | F: TGCAGACTTTGGCACAAACGAC | 143 |
| R: AGTTTTAGCAGGACGCCTGGAA | |||
|
| XM_012177234.2 | F: CATCTTCCTCATTGCTGGCTACGA | 143 |
| R: AGTACTCAGGGGCTGGATGTTTCT | |||
| Cell turnover | |||
|
| NM_001009797.1 | F: TGCCACCCAGGCTGAACAATTA | 106 |
| R: AAATGCGGTACAGACCCATTCAGG | |||
|
| XM_015100639.1 | F: CTAAGACCTGGTGTAGCCAAGCAA | 103 |
| R: TCGAACCCATGTTCCCTGCATT | |||
|
| XM_012103831.2 | F: ATGCGGCCCCTGTTTGATTTCT | 112 |
| R: GTGGACTTCACTTATGGCCCAGAT | |||
|
| XM_015102997.1 | F: ACGACTTCATCGAGCACTTCCTCT | 127 |
| R: GGTGGGTTGGAAATGAACTTCACG | |||
|
| XM_012159642.2 | F: CCAGACTTTGCACTTCAGAAGC | 106 |
| R: GATGTGACTGGCATCTTCACCT | |||
|
| XM_012098367.2 | F: CGAGATCCTGTACATTCGCACCAA | 100 |
| R: GTTCCACTTCACGATCAGCTGAGA | |||
|
| NM_001145177.1 | F: CAGCGATGAGGCCACAGATACAAA | 117 |
| R: CTGGACTCGGTCATCAAGTGGAAA | |||
|
| NM_001159276.1 | F: AGGTTGACTACGAGTCTCAGAGCA | 122 |
| R: CAGGAACTTGAGGTCGTTCAGTGT | |||
|
| NM_001129733.1 | F: TGCGTGGACAAGTATGGGATGAAG | 103 |
| R: AGGGGACGCATCACTCAACATT | |||
|
| XM_004008038.3 | F: ATCCCACTCACCAGCATGCAAA | 145 |
| R: CTACCAAGTGCAAGCACAGTTAGC | |||
|
| NM_001009763.1 | F: TTGGATGGCCTAGGAATCTGGAGT | 105 |
| R: GTTAGACCCAACCGCTGTCAGAAT | |||
|
| NM_001024862.1 | F: GGTTATTCTGGTGCCTTCAAGTGC | 119 |
| R: AGAAGCTCATACTGGTCCCTGTCA | |||
|
| NM_001123000.1 | F: AACACGTCCACATAGCCCAAGT | 80 |
| R: ACCATCTGTGCTGATTCCATCACC | |||
|
| NM_001009400.1 | F: GCACGTGGAGCTGTACCAGAAATA | 116 |
| R: GCACAACTCCAGTGACGTCAAA | |||
|
| XM_012120354.2 | F: CCAAGGAAAACCAGCCATAGCTCA | 118 |
| R: TGTGGCCGAATCATGCCTTACT | |||
|
| XM_012099307.2 | F: CCTTACAAAGCATGTGGGCTTGAC | 132 |
| R: CCTGCACTGTAGGCGGATTCTTTA | |||
|
| NM_001009784.1 | F: TGAAGTGTGACGTGGACATCCGTA | 108 |
| R: AGGTGATCTCCTTCTGCATCCTGT |
CAIV, carbonic anhydrase IV; VEGF, vascular endothelial growth factor A; VEGFR1 (FTL1), fms-related tyrosine kinase 1; VEGFR2 (KDR), kinase insert domain receptor; ANGPT1, angiopoietin 1; ANGPT2, angiopoietin 2; MKI67, marker of proliferation Ki-67; TBXAS1, thromboxane A synthase 1; LALBA, lactalbumin alpha; BAX, BCL2-associated X protein; BCL2: B-cell CLL/lymphoma 2; CCND1, cyclin D1; IGF1, insulin like growth factor 1; IGF1R, insulin like growth factor 1 receptor; IGFBP1, insulin like growth factor binding protein 1; IGFBP3, insulin like growth factor binding protein 3; IGFBP5, insulin like growth factor binding protein 5; LPT, leptin; LPTR, leptin receptor; LTF, lactotransferrin; TGFB1, transforming growth factor beta 1; TGFB1R1, transforming growth factor, beta receptor 1; TGFB1R2, transforming growth factor, beta receptor 2; actin, β-actin.
Effect of group and measuring time (late pregnancy, early and late lactation) related to the transcriptional expression of selected genes (fold changes) associated to angiogenesis in the mammary gland (LSM ± SEM).
| Experimental Treatment 1 |
|
|
|
|
|
|
|
|
|---|---|---|---|---|---|---|---|---|
| Time 1 | ||||||||
| TP | 1.33 ± 0.35 | 0.58 ± 0.07 | 0.41 ± 0.06 | 0.43 b ± 0.05 | 0.31 b± 0.05 | 0.40 b ± 0.11 | 0.36 b ± 0.12 | 0.48 ± 0.09 |
| TC | 4.81 ± 2.24 | 1.69 ± 0.63 | 2.00 ± 0.35 | 1.89 a ± 0.18 | 4.05 a ± 1.25 | 2.35 a ± 0.10 | 2.11 a ± 0.28 | 2.56 ± 0.76 |
| SP | 1.56 ± 0.91 | 1.45 ± 0.23 | 1.83 ± 0.79 | 1.39 a ± 0.17 | 1.48 a,b ± 0.47 | 0.90 b ± 0.27 | 1.12 a,b ± 0.38 A | 1.01 ± 0.35 |
| SC | 1.77 ± 1.32 | 1.03 ± 0.18 | 1.34 ± 0.52 | 1.15 a ± 0.30 | 1.08 b ± 0.38 | 1.51 a,b ± 0.36 A | 1.61 a ± 0.29 | 1.38 ± 0.40 |
| 0.33 | 0.17 | 0.14 | 0.004 | 0.01 | 0.001 | 0.004 | 0.06 | |
| Time 2 | ||||||||
| TP | 1.73 a ± 0.28 | 1.43 ± 0.39 | 1.58 ± 0.88 | 1.03 ± 0.32 | 1.19 ± 0.48 | 1.31 ± 0.53 | 1.02 ± 0.42 | 1.38 ± 0.45 |
| TC | 1.01 a,b ± 0.20 | 1.40 ± 0.13 | 1.37 ± 0.30 | 1.05 ± 0.04 | 1.48 ± 0.26 | 1.34 ± 0.14 | 1.59 ± 0.49 | 1.75 ± 0.66 |
| SP | 1.52 a,b ± 0.28 | 1.20 ± 0.03 | 1.16 ± 0.13 | 1.74 ± 0.24 | 1.98 ± 0.57 | 1.51 ± 0.27 | 1.55 ± 0.32 A | 1.29 ± 0.21 |
| SC | 0.66 b ± 0.13 | 0.74 ± 0.17 | 0.99 ± 0.26 | 0.85 ± 0.16 | 0.63 ± 0.13 | 0.69 ± 0.12 B | 2.95 ± 2.13 | 0.64 ± 0.07 |
| 0.014 | 0.14 | 0.83 | 0.07 | 0.10 | 0.25 | 0.76 | 0.27 | |
| Time 3 | ||||||||
| TP | 1.44 ± 0.45 | 1.31 ± 0.37 | 1.04 a,b ± 0.12 | 1.00 ± 0.22 | 0.90 b ± 0.23 | 0.96 ± 0.17 | 2.61 ± 1.04 | 1.24 ± 0.45 |
| TC | 2.28 ± 0.67 | 1.99 ± 0.59 | 2.21 a ± 0.44 | 1.84 ± 0.37 | 2.01 a ± 0.25 | 2.45 ± 0.69 | 3.91 ± 1.81 | 3.13 ± 0.74 |
| SP | 0.94 ± 0.15 | 0.94 ± 0.50 | 0.78 b ± 0.24 | 0.94 ± 0.19 | 0.89 b ± 0.44 | 1.40 ± 0.96 | 0.22 ± 0.06 B | 2.66 ± 2.40 |
| SC | 0.80 ± 0.43 | 0.81 ± 0.08 | 0.88 b ± 0.20 | 0.84 ± 0.18 | 0.94 b ± 0.15 | 0.71 ± 0.11 B | 0.94 ± 0.25 | 0.78 ± 0.25 |
| 0.18 | 0.19 | 0.01 | 0.06 | 0.01 | 0.10 | 0.12 | 0.28 | |
| P times 3 | ||||||||
| TP | 0.73 | 0.17 | 0.32 | 0.16 | 0.18 | 0.19 | 0.09 | 0.23 |
| TC | 0.18 | 0.72 | 0.23 | 0.06 | 0.08 | 0.15 | 0.33 | 0.43 |
| SP | 0.68 | 0.56 | 0.36 | 0.08 | 0.36 | 0.75 | 0.04 | 0.69 |
| SC | 0.58 | 0.38 | 0.64 | 0.55 | 0.43 | 0.04 | 0.53 | 0.17 |
1 TP: twin-bearing ewes fed NP; TC: twin-bearing ewes fed RC; SP: single-bearing ewes fed NP; SC: single-bearing ewes fed RC; TP-TC (n =4); SP-SC (n = 5); 2 Different small letters (a,b) denote significant differences between groups within each measuring time at p ≤ 0.05; 3 Different capital letters (A,B) denote significant differences of each group according to time p ≤ 0.05.
Effect of group and measuring time (late pregnancy, early and late lactation) related to the transcriptional expression of selected genes (fold changes) associated to cell turnover /lactogenesis in the mammary gland (LSM ± SEM).
| Exp. Treat 1 |
|
|
|
|
|
|
|
|
|
|
|
|
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Time 1 | |||||||||||||
| TP | 2.74 ± 1.96 | 1.18 ± 0.30 | 0.91 b ± 0.23 B | 1.01 ± 0.18 | 0.71 b ± 0.12 B | 1.24 ± 0.14 | 0.63 b ± 0.15 B | 1.11 ± 0.07 AB | 1.02 ± 0.38 B | 1.56 ± 0.55 | 1.72 ± 1.03 | 1.04 a,b ± 0.07 B | 1.53 a ± 0.21 |
| TC | 1.18 ± 0.27 B | 3.14 ± 0.99 | 2.43 a ± 0.11 A | 1.38 ± 0.07 B | 2.69 a ± 0.28 AB | 1.33 ± 0.56 B | 3.11 a ± 1.04 | 2.03 ± 0.38 B | 2.61 ± 1.04 | 1.36 ± 0.45 | 1.74 ± 0.11 | 0.73 b ± 0.07 | 0.97 a, b ± 0.04 |
| SP | 0.40 ± 0.21 | 0.92 ± 0.42 | 0.73 b ± 0.09 | 0.66 ± 0.10 | 0.85 b ± 0.26 | 1.06 ± 0.39 | 0.81 a,b ± 0.12 | 0.71 ± 0.15 | 2.19 ± 1.38 | 1.05 ± 0.27 | 0.62 ± 0.17 | 1.47 a ± 0.14 A | 1.02 a,b ± 0.12 |
| SC | 2.38 ± 0.94 | 0.90 ± 0.46 | 0.89 b ± 0.23 | 1.15 ± 0.21 A | 0.85 b ± 0.18 | 1.02 ± 0.33 | 0.86 a,b ± 0.12 | 0.87 ± 0.33 | 1.48 ± 0.92 | 1.09 ± 0.28 | 2.39 ± 1.67 | 1.07 a,b ± 0.10 | 0.81 b ± 0.08 |
| 0.53 | 0.06 | 0.0002 | 0.08 | 0.0001 | 0.92 | 0.01 | 0.06 | 0.63 | 0.80 | 0.79 | 0.002 | 0.008 | |
| Time 2 | |||||||||||||
| TP | 1.82 a ± 0.28 | 1.35 ± 0.19 | 1.61 a ± 0.13 A | 1.71 a ± 0.10 | 1.88 a ± 0.35 A | 2.02 a ± 0.24 | 1.50 a,b ± 0.33 A | 1.94 a ± 0.38 A | 5.86 a ± 1.10 A | 1.72 ± 0.54 | 3.02 ± 2.07 | 1.29 ± 0.09 AB | 1.51 ± 0.27 |
| TC | 1.51 a ± 0.19 AB | 1.37 ± 0.23 | 1.38 a ± 0.11 B | 1.42 a ± 0.31 B | 1.28 a,b ± 0.16 B | 1.36 a,b ± 0.23 B | 2.00 a ± 0.43 | 1.39 a ± 0.28 B | 0.53 b ± 0.18 | 1.10 ± 0.17 | 2.93 ± 1.27 | 0.97 ± 0.05 | 1.05 ± 0.07 |
| SP | 1.70 a ± 0.25 | 0.53 ± 0.14 | 0.80 b ± 0.13 | 0.63 b ± 0.06 | 0.73 b ± 0.15 | 0.66 b ± 0.05 | 0.85 b ± 0.22 | 0.87 b ± 0.13 | 1.31 b ± 0.42 | 0.84 ± 0.12 | 1.46 ± 1.02 | 0.89 ± 0.06 B | 0.76 ± 0.21 |
| SC | 0.77 b ± 0.20 | 1.23 ± 0.30 | 0.66 b ± 0.09 | 0.82 b ± 0.16 AB | 0.72 b ± 0.10 | 0.82 b ± 0.24 | 0.70 b ± 0.21 | 0.57 b ± 0.08 | 1.41 b ± 0.38 | 1.07 ± 0.30 | 1.63 ± 0.77 | 0.97 ± 0.15 | 1.05 ± 0.26 |
| 0.021 | 0.14 | 0.0001 | 0.007 | 0.005 | 0.005 | 0.03 | 0.008 | 0.0002 | 0.38 | 0.77 | 0.10 | 0.23 | |
| Time 3 | |||||||||||||
| TP | 1.09 b ± 0.26 | 1.70 b ± 0.34 | 1.26 b ± 0.13 AB | 1.40 a,b ± 0.27 | 1.89 b ± 0.19 A | 1.93 a,b ± 0.44 | 0.65 b ± 0.09 B | 0.85 b ± 0.12 B | 2.61 ± 0.93 AB | 1.33 ± 0.36 | 1.44 ± 0.38 | 1.75 a ± 0.17 A | 1.24 ± 0.35 |
| TC | 2.36 a ± 0.28 A | 2.89 a ± 0.37 | 3.02 a ± 0.35 A | 2.64 a ± 0.50 A | 3.23 a ± 0.54 A | 3.45 a ± 0.66 A | 4.91 a ± 1.16 | 4.82 a ± 0.88 A | 1.41 ± 0.35 | 1.17 ± 0.19 | 1.47 ± 0.48 | 0.90 b ± 0.09 | 1.03 ± 0.16 |
| SP | 1.05 b ± 0.52 | 0.66 b,c ± 0.19 | 0.82 b ± 0.36 | 0.61 b ± 0.07 | 0.57 b,c ± 0.15 | 0.49 b ± 0.19 | 0.60 b ± 0.04 | 0.52 b ± 0.05 | 2.41 ± 1.26 | 0.76 ± 0.18 | 1.63 ± 0.74 | 0.97 b ± 0.13 B | 1.11 ± 0.34 |
| SC | 1.17 b ± 0.26 | 0.48 c ± 0.07 | 0.46 b ± 0.04 | 0.54 b ± 0.06 B | 0.41 c ± 0.06 | 0.45 b ± 0.06 | 0.64 b ± 0.11 | 0.53 b ± 0.06 | 0.84 ± 0.15 | 1.29 ± 0.33 | 1.06 ± 0.52 | 0.77 b ± 0.08 | 0.97 ± 0.05 |
| 0.036 | 0.0001 | <0.0001 | 0.0008 | 0.0001 | 0.0005 | 0.0004 | <0.0001 | 0.23 | 0.60 | 0.87 | 0.0002 | 0.83 | |
| P times 3 | |||||||||||||
| TP | 0.62 | 0.45 | 0.048 | 0.09 | 0.009 | 0.18 | 0.02 | 0.02 | 0.009 | 0.85 | 0.68 | 0.006 | 0.73 |
| TC | 0.023 | 0.14 | 0.0017 | 0.04 | 0.011 | 0.027 | 0.13 | 0.005 | 0.12 | 0.83 | 0.41 | 0.11 | 0.87 |
| SP | 0.10 | 0.61 | 0.96 | 0.92 | 0.61 | 0.31 | 0.47 | 0.18 | 0.75 | 0.58 | 0.59 | 0.02 | 0.58 |
| SC | 0.16 | 0.28 | 0.14 | 0.049 | 0.06 | 0.26 | 0.58 | 0.43 | 0.73 | 0.84 | 0.69 | 0.22 | 0.56 |
1 TP: twin-bearing ewes fed NP; TC: twin-bearing ewes fed RC; SP: single-bearing ewes fed NP; SC: single-bearing ewes fed RC; TP-TC (n =4); SP-SC (n = 5); 2 Different small letters (a,b) denote significant differences between groups within each measuring time at p ≤ 0.05; 3 Different capital letters (A,B) denote significant differences of each group according to time p ≤ 0.05.
Final effect of the lamb diet on the transcriptional expression of ACC, FAS, SCD1 and SREBP1c in Longissimus dorsi muscle in lambs at weaning (60 d) and 45 days after weaning (LSM ± SEM).
| Lamb Ewe-Diet | Time | ACC | FAS | SCD1 | SREBP1c |
|---|---|---|---|---|---|
| TP-NP | Weaning | 2.42 ± 0.38 | 2.05 ± 0.14 | 1.45 ± 0.03 | 0.67 ± 0.31 |
| After weaning | 1.67 ± 0.31 | 1.84 ± 0.28 | 1.77 ± 0.37 | 2.40 ± 0.46 | |
| TP-RC | Weaning | 3.29 ± 0.18 | 1.47 ± 1.08 | 1.92 ± 0.03 | 1.59 ± 0.41 |
| After weaning | 0.52 ± 0.29 | 0.51 ± 0.07 | 0.64 ± 0.21 | 2.48 ± 0.24 | |
| TC-NP | Weaning | 1.06 ± 0.28 | 1.00 ± 0.12 | 1.88 ± 0.73 | 0.66 ± 0.47 |
| After weaning | 1.39 ± 0.36 | 1.13 ± 0.66 | 0.83 ± 0.02 | 0.45 ± 0.33 | |
| TC-RC | Weaning | 0.70 ± 0.10 | 0.48 ± 0.30 | 0.31 ± 0.12 | 2.86 ± 2.61 |
| After weaning | 2.93 ± 0.68 | 2.06 ± 0.01 | 2.37 ± 0.24 | 0.46 ± 0.19 | |
| SP-NP | Weaning | 1.49 ± 0.29 | 1.19 ± 0.14 | 1.34 ± 0.18 | 2.68 ± 0.12 |
| After weaning | 1.72 ± 0.09 | 1.76 ± 0.51 | 1.26 ± 0.44 | 1.49 ± 0.35 | |
| SP-RC | Weaning | 1.06 ± 0.36 | 0.66 ± 0.12 | 3.82 ± 0.22 | 0.51 ± 0.35 |
| After weaning | 0.66 ± 0.25 | 0.36 ± 0.21 | 0.54 ± 0.34 | 1.15 ± 0.57 | |
| SC-NP | Weaning | 1.62 ± 0.87 | 1.52 ± 0.66 | 0.48 ± 0.64 | 2.15 ± 1.06 |
| After weaning | 0.26 ± 0.05 | 0.43 ± 0.10 | 0.37 ± 0.13 | 2.77 ± 2.13 | |
| SC-RC | Weaning | 1.31 ± 0.90 | 0.77 ± 0.07 | 0.67 ± 0.05 | 1.17 ± 0.18 |
| After weaning | 1.73 ± 0.02 | 1.05 ± 0.66 | 1.26 ± 0.99 | 0.29 ± 0.19 |
1 ACC: acetyl-CoA carboxylase; 2 FAS: fatty acid synthase; 3 SCD1: stearoyl CoA desaturase 1; 4 SREBP1c: sterol regulatory element binding transcription factor 1c; 5 TP-NP: lambs from TP group and fed NP at weaning; 6 TP-RC: lambs from TP group and fed RC at weaning; 7 TC-NP: lambs from TC group and fed NP at weaning; 8 TC-RC: lambs from TC group and fed RC at weaning; 9 SP-NP: lambs from SP group and fed NP at weaning; 10 SP-RC: lambs from SP group and fed RC at weaning; 11 SC-NP: lambs from SC group and fed NP at weaning; 12 SC-RC: lambs from SC group and fed RC at weaning.